ID: 1000000593

View in Genome Browser
Species Human (GRCh38)
Location 5:157135087-157135109
Sequence TGCAAACTTAAAAAAAATGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 956
Summary {0: 1, 1: 0, 2: 2, 3: 77, 4: 876}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000000593_1000000600 30 Left 1000000593 5:157135087-157135109 CCCTCATTTTTTTTAAGTTTGCA 0: 1
1: 0
2: 2
3: 77
4: 876
Right 1000000600 5:157135140-157135162 CATAGAAATACTTAACCCTTAGG 0: 1
1: 0
2: 1
3: 9
4: 155
1000000593_1000000597 3 Left 1000000593 5:157135087-157135109 CCCTCATTTTTTTTAAGTTTGCA 0: 1
1: 0
2: 2
3: 77
4: 876
Right 1000000597 5:157135113-157135135 GAGAGGGAACTCCCAGACAGTGG 0: 1
1: 0
2: 0
3: 37
4: 280

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000000593 Original CRISPR TGCAAACTTAAAAAAAATGA GGG (reversed) Intronic
900041199 1:465974-465996 AACAAACTTAAAAAAAATTGTGG - Intergenic
900062630 1:700950-700972 AACAAACTTAAAAAAAATTGTGG - Intergenic
900841502 1:5052199-5052221 TGACAACATAAAAAAACTGAAGG + Intergenic
902850318 1:19150448-19150470 TGAAAACTTAAAAAAATTCCAGG + Intronic
903209489 1:21808898-21808920 TGCAAAATTTTAAAAAATTATGG + Intergenic
903980096 1:27179827-27179849 TATAAACTTAAAAAAAATAATGG - Intergenic
904242382 1:29156393-29156415 TGCAAAAATAAAACAAATTAGGG - Intronic
904981950 1:34511752-34511774 TCCAGACTTACCAAAAATGAGGG + Intergenic
905297375 1:36962749-36962771 TACAAACGGATAAAAAATGAAGG + Intronic
905927775 1:41764173-41764195 ACAAAACTGAAAAAAAATGAGGG + Intronic
906896264 1:49776138-49776160 TGGAAGCTTAGAAAAAATGGTGG + Intronic
907233081 1:53018967-53018989 TGCACTCTTCAAAAAAATCATGG - Intronic
907737323 1:57127161-57127183 TTAAAATTTAAAATAAATGAGGG + Intronic
907911368 1:58829672-58829694 TGCAAGATTGAAAAAAATGTGGG + Intergenic
908240575 1:62185742-62185764 TAAAAACTTTAAACAAATGATGG + Intergenic
908350021 1:63277475-63277497 TACAAACTTAAAAAAAATCCAGG + Intergenic
908470864 1:64442613-64442635 TTAAAAGTTAAAAAAAAGGATGG - Intergenic
908776298 1:67644186-67644208 TTCAAACTTAAAATACATAAAGG + Intergenic
908800449 1:67874661-67874683 TGCCAACCTAAACAAAATCAAGG - Intergenic
908856535 1:68436078-68436100 TGCAAAATAAAGAAAAAAGAAGG - Intronic
908925875 1:69254303-69254325 TTTAAACTTAAAAAAAACTAAGG - Intergenic
909332774 1:74434242-74434264 TGCATGCTAAAAAATAATGAGGG - Intronic
909582307 1:77251527-77251549 AACATACTTCAAAAAAATGAAGG + Intergenic
909901224 1:81138201-81138223 TGCAGATTAAAAACAAATGAGGG + Intergenic
910106427 1:83636026-83636048 TCTAAACATGAAAAAAATGAAGG + Intergenic
910483010 1:87678979-87679001 AGCAAAGTTAAAAAAAAAAAGGG - Intergenic
910553960 1:88508839-88508861 TGCAAACTTTAAAAAAAAAAAGG + Intergenic
911267485 1:95760722-95760744 TGCAAAATTAACAAAACTGAAGG + Intergenic
911373438 1:97022799-97022821 AGCAAACTAAGAAAAAAAGAAGG + Intergenic
911842612 1:102703289-102703311 TGCAAATTTAAAATACTTGAAGG + Intergenic
912829318 1:112937503-112937525 TGTTAACTTAAAAATACTGATGG + Intronic
913256939 1:116962340-116962362 TAGGAACTTAAAAAAAATGCTGG + Intronic
913487319 1:119343588-119343610 GGAAAACTTGAAAAAAAAGAAGG + Intergenic
913536634 1:119779189-119779211 TGCAAATTAAAAAAAAAGGGGGG - Intergenic
913614432 1:120543289-120543311 TGCAAATAAAAAAAAATTGATGG - Intergenic
914232517 1:145776467-145776489 TTAAAACTTTAAAAAAATGTTGG - Intronic
914288855 1:146253566-146253588 TGCAAACAAAAAAAAAAAAAAGG - Intergenic
914575838 1:148967611-148967633 TGCAAATAAAAAAAAATTGATGG + Intronic
915090901 1:153425176-153425198 AGAAAACAGAAAAAAAATGATGG + Intergenic
915228177 1:154426606-154426628 AGCAAAGTTAAGAAAAATGTAGG + Intronic
915939023 1:160106686-160106708 TGCAAAGTTAACTAAAATAAGGG - Intergenic
916775101 1:167953898-167953920 TTTAAACTTGAAAAAAATGTTGG - Intronic
917168065 1:172135749-172135771 ATCAGACTTGAAAAAAATGATGG + Intronic
917295887 1:173518854-173518876 TGCAAACAAAGAAAAGATGATGG + Intronic
917496896 1:175548657-175548679 AGCAAAATTAAAAAAAAAAAAGG + Intronic
917562350 1:176172391-176172413 TGCAAACTTAAAAATATGCACGG + Intronic
918475697 1:184922088-184922110 TTAAAAATTAAAAAAAATGAAGG - Intronic
918514352 1:185346024-185346046 TGCAAACACTAAAAAACTGAAGG + Intergenic
918558021 1:185828302-185828324 TGCAAATTTAAAATAAGTGAGGG + Intronic
918854305 1:189730591-189730613 TACAGAATTAAAAAAAATAAAGG + Intergenic
919004540 1:191879422-191879444 TGCAAACTTTGAAAAAAATATGG + Intergenic
919143400 1:193602187-193602209 AGCAAACTTAAAGTAAATGGAGG - Intergenic
919186086 1:194151926-194151948 TGCAAACGTAAGATAAATAATGG - Intergenic
919288237 1:195593886-195593908 TTCACAGTTAAAATAAATGATGG - Intergenic
919352192 1:196471411-196471433 TGCACAATTAAAAAAAAACATGG - Intronic
919536305 1:198791868-198791890 TGGAAAATGAAAAAAAAAGAGGG - Intergenic
919891053 1:201975123-201975145 TGCTAACATAAAAAAAAAAATGG - Intergenic
919974888 1:202603923-202603945 TGCAAACTTAAAAGAAGAAAAGG + Intronic
921123176 1:212154268-212154290 TGCAAATTTAAATAAAGTCATGG - Intergenic
921271200 1:213471742-213471764 TCCAAAAAAAAAAAAAATGAAGG - Intergenic
921659892 1:217789326-217789348 TGCAAATTTGAGAGAAATGAAGG - Intronic
923186330 1:231577095-231577117 CACAAACTTAAAAGAGATGAGGG - Intronic
923246182 1:232134932-232134954 TTCAAAATTAAAAAAAATGTTGG + Intergenic
923344376 1:233036660-233036682 TGCAATCTTAAAGAAAAAGGAGG - Intronic
923602778 1:235418167-235418189 TGCGAACTTAAAAAAAAGGAAGG - Intronic
923707521 1:236356582-236356604 TGCACAGTTAAAAACAATGGTGG + Intronic
923889748 1:238200044-238200066 TGCAAACCTCAGAAAAATCATGG - Intergenic
923938101 1:238787056-238787078 TAAAAAATTAAAAAAAAAGAAGG + Intergenic
924405267 1:243738094-243738116 TGCAAATGTGAAAAAAATGGTGG - Intronic
924653378 1:245949934-245949956 TGCAAATTTAAAAAACTGGAAGG + Intronic
924790065 1:247237851-247237873 TGGAAAATTAAAACAAATAAAGG + Intergenic
1063070202 10:2653975-2653997 TAGGAACTTAACAAAAATGATGG - Intergenic
1063734468 10:8736973-8736995 TGCAAAGTGAATAAAAATGTTGG + Intergenic
1064091614 10:12390240-12390262 TTAAAAATTAAAAAAAAAGATGG + Intronic
1064581051 10:16793356-16793378 TGACAACTGAAAAAAAAAGATGG + Intronic
1064689805 10:17904357-17904379 AGCTATCTTACAAAAAATGAAGG - Intronic
1065073772 10:22055221-22055243 TTCAGTCTTAAAAAAAAAGAAGG - Intergenic
1065098771 10:22312161-22312183 TGCAAAGTTTAACAAAATTATGG + Intergenic
1065405038 10:25354663-25354685 TGCAAAAAGAAAAAAATTGAAGG - Intronic
1065678507 10:28204670-28204692 TGCTAACATAAAAAAAATTATGG + Intronic
1066118949 10:32265144-32265166 TTCAAACTTTAAAAAAATTGTGG + Intergenic
1066682786 10:37950561-37950583 TGCAAAAAAAAAAAAAATGTTGG - Exonic
1067977107 10:51038903-51038925 TGCAAACTTTAAAAAAATTGTGG - Intronic
1068300143 10:55128227-55128249 TGCAAATAGAAAAAAAAGGATGG - Intronic
1068474199 10:57505049-57505071 AGCAAATTTAAGAAAAGTGAAGG + Intergenic
1068686535 10:59875966-59875988 TGCAATCCCAAAAAAAATAACGG + Intronic
1069441887 10:68436231-68436253 TTCAGCCATAAAAAAAATGAGGG + Intronic
1071100908 10:82036582-82036604 TACAACTTTAAAAAATATGAAGG - Intronic
1071668390 10:87583444-87583466 TGCAAAAATAAACCAAATGAAGG + Intergenic
1072038393 10:91585083-91585105 TGCAACCTTTAAACAAAGGAGGG + Intergenic
1073847266 10:107571320-107571342 TGAAAACTTAAAATACATTAAGG + Intergenic
1074063869 10:109994723-109994745 TGGAAAAGAAAAAAAAATGAAGG + Intergenic
1075488270 10:122845373-122845395 TGCAACTTAAAAAAAAATGATGG - Intronic
1076235171 10:128858437-128858459 TCCAAACTTGAAAAAAACCAAGG + Intergenic
1076967470 11:102204-102226 AACAAACTTAAAAAAAATTGTGG - Intergenic
1078475281 11:11623831-11623853 TCCCAAGTTTAAAAAAATGAGGG + Intergenic
1078836285 11:15033825-15033847 TGCAATCTCAAAATAAAAGACGG + Intronic
1079162605 11:18008913-18008935 TCCAACCTGAAGAAAAATGAAGG + Intronic
1079748190 11:24160032-24160054 TGCCAACTTGAAAAGATTGAAGG + Intergenic
1079750934 11:24196125-24196147 TGAAAACAGAAAAAAAATAAAGG - Intergenic
1079785632 11:24667893-24667915 TGCAAACATTGAAAGAATGAGGG + Intronic
1080234936 11:30057299-30057321 TTTAAACTTAAAAAAAATTAAGG + Intergenic
1080525822 11:33116315-33116337 TGAAAACATAAAACTAATGATGG + Intronic
1080950178 11:37022705-37022727 TGCAAACATAAAATAAATCTAGG - Intergenic
1081018812 11:37916832-37916854 TGAGAACTTAAATAAAATGAAGG - Intergenic
1081160207 11:39740178-39740200 TGACAACTTAAAAAAACTCAAGG + Intergenic
1081519263 11:43865880-43865902 TGTACACTTAAAAAAAATTATGG - Intergenic
1081535297 11:43991911-43991933 TGCAAAGTTAAGAGATATGAAGG - Intergenic
1081984414 11:47291097-47291119 TGCAGACGTAAATAAAAGGAGGG - Intronic
1082198729 11:49336176-49336198 TGGAGACTTAAATAAAAGGAAGG + Intergenic
1082712850 11:56575809-56575831 TGAAAACTCAAAAAAAAAAAAGG + Intergenic
1082892196 11:58151774-58151796 TGCAAGGTTAAAAAAAAAAATGG - Intronic
1082897445 11:58206856-58206878 TGCAAACTAAAGACAAATGCTGG + Intergenic
1082897842 11:58212082-58212104 TGCAAACTAAAGACAAATGCTGG - Intergenic
1082912611 11:58393842-58393864 TGAGACCTTAATAAAAATGAGGG - Intergenic
1085089042 11:73693920-73693942 TTCAAAGTTAAAAATAAGGATGG - Intronic
1085733571 11:79019710-79019732 TGCAAACTTGAAGATAATGATGG - Intronic
1085943307 11:81233126-81233148 TGCACACTGAAATAAAATAAAGG - Intergenic
1086536727 11:87856049-87856071 TTCAAACTTAAAACAATTAAAGG + Intergenic
1086657080 11:89371917-89371939 TGGAGACTTAAAAAAAAGGAAGG - Intronic
1086901138 11:92369168-92369190 TGCAAAATTTATAAAAATGTAGG + Intronic
1086955543 11:92931205-92931227 AGCAAATTTAAAAAAAAGGTTGG - Intergenic
1086992766 11:93323567-93323589 TGCAAATTTAAAAAATATTTAGG + Intergenic
1087098553 11:94343566-94343588 AGAAAACTTAAAAAAAATACTGG - Intergenic
1087156697 11:94911529-94911551 TGTGAACTTAAAATGAATGAAGG + Intergenic
1087238084 11:95742740-95742762 TGCAAATTAAAACACAATGAGGG - Intergenic
1087612008 11:100446158-100446180 TGCAACCTTCAAAGAAAGGAGGG - Intergenic
1087777064 11:102266466-102266488 TGTGAATTTAAAAAACATGAAGG + Intergenic
1087962700 11:104371991-104372013 TTCAAACTTTAGAAAAATGTGGG - Intergenic
1088105522 11:106202823-106202845 TGTAGATTTAAAAAAAAAGATGG - Intergenic
1088427586 11:109721584-109721606 TACCAACTTAGAAAATATGAAGG - Intergenic
1088440983 11:109869995-109870017 TTCAAAATTAAAACAAATTATGG - Intergenic
1088763678 11:112956454-112956476 TGCACAATTAAAAAAAAAAAGGG + Intergenic
1088932920 11:114370098-114370120 TGCAAAATCAAAAGAATTGAAGG - Intergenic
1088937248 11:114415308-114415330 TACAAACTAATAAAATATGAAGG - Intronic
1089981768 11:122778549-122778571 TGAAAAAAAAAAAAAAATGAAGG - Intronic
1090067214 11:123513380-123513402 TGCAACCTTAAAAAAAAAAAGGG - Intergenic
1090168659 11:124578724-124578746 TGCAAACTTATTAGAAATGCAGG - Intergenic
1090535240 11:127633693-127633715 TACAAACCTAAGAAAAAAGAGGG + Intergenic
1090540197 11:127693642-127693664 TGCAATGTTAAAAGAAAAGATGG - Intergenic
1090573390 11:128072371-128072393 TGCAAGCTTAAGGAAAAGGAAGG + Intergenic
1090815388 11:130289587-130289609 TGCAGACTTTAAAAAAAAAAAGG + Intronic
1092086097 12:5762150-5762172 TGCTAAGTTAAATTAAATGATGG + Intronic
1093242529 12:16695969-16695991 AGCAGACTTAAAAAAAAAAAAGG + Intergenic
1093416247 12:18924242-18924264 TGCTTTCTTAAAAAAAAGGAGGG - Intergenic
1093421288 12:18977699-18977721 TGCAAACTTGAAGGAATTGAGGG - Intergenic
1093541442 12:20291266-20291288 TTCAGGCTTAAAAAAAAAGAGGG - Intergenic
1093606677 12:21098819-21098841 CGCAAAAAAAAAAAAAATGATGG - Intronic
1093900870 12:24630616-24630638 TGTAGACTTCAAAAAAATGTAGG - Intergenic
1093981874 12:25484080-25484102 TGTAAATTAAAAAAAAATGTTGG + Intronic
1094067440 12:26376458-26376480 TGGAAATTGAAAAGAAATGATGG - Intronic
1094129942 12:27063984-27064006 TGAAAACTCAAAAAATATAATGG + Intronic
1094179397 12:27575953-27575975 TGAAAACTCAAAAAATATAATGG + Intronic
1094879574 12:34704252-34704274 TGGAAATTCAAAAAAAAAGAGGG - Intergenic
1095522224 12:43080993-43081015 TGCAAAAAAAAAAAAAATTAAGG + Intergenic
1095619588 12:44235146-44235168 TTCAAAATGACAAAAAATGATGG - Intronic
1095789336 12:46147227-46147249 TGAAAAATTAAAAAAAAAAAAGG - Intergenic
1097541113 12:60944713-60944735 TGCAAATTTCAAAAGAATGAGGG + Intergenic
1097608484 12:61785896-61785918 ATGAAACTTAAAAAAAATTAGGG + Intronic
1097904884 12:64909504-64909526 TGCAAAATAAAAAAATTTGAGGG - Intergenic
1098142024 12:67459490-67459512 TGAATACTTAAAAAAAAAAAAGG + Intergenic
1098519124 12:71415902-71415924 TTCAAATTTAAAGAAAATTAGGG + Intronic
1098522317 12:71447207-71447229 TGCAAAGTTTAAAAATATGTTGG - Intronic
1098786342 12:74761535-74761557 TACAACGTTAAAAAAAATGCTGG + Intergenic
1098884704 12:75948975-75948997 TTCAAATTTAAAAAAAATTGGGG - Intergenic
1099122066 12:78703119-78703141 TTCAAAGATAAAAAGAATGAAGG + Intergenic
1099195612 12:79611655-79611677 TCCAAACCAATAAAAAATGATGG + Intronic
1099573326 12:84353295-84353317 TCCTAACTTTAACAAAATGATGG - Intergenic
1099649003 12:85400228-85400250 TGCAAACGCATAAAAGATGATGG - Intergenic
1099691307 12:85955802-85955824 TGCAGACTTTAAAAAAATACAGG + Exonic
1099855554 12:88160879-88160901 TCCAAAGTTAAAAAAAAGAATGG - Intronic
1099881169 12:88468213-88468235 AGCAAACTTATTAAAATTGAGGG - Intergenic
1099920217 12:88948241-88948263 TGCTAACTTTAAAAAATGGAAGG - Intergenic
1099937916 12:89150027-89150049 TATAAATTTAAAAAAAAAGAAGG + Intergenic
1100000364 12:89827342-89827364 TGGAAACTTAAAAAAAAAAAAGG + Intergenic
1100337793 12:93648397-93648419 TAAAAATTAAAAAAAAATGAAGG - Intergenic
1100482915 12:94996472-94996494 TGCTAATTAAAAAAAAATTAGGG - Intronic
1100542311 12:95568936-95568958 AGCAAACATAAAGAAAATGGAGG - Intergenic
1100848302 12:98682575-98682597 TGCTTAGTTAAAAAAAATAAAGG - Intronic
1101187973 12:102300933-102300955 AGCAAAATTAAAAAATAAGAAGG - Intergenic
1101411702 12:104474083-104474105 TGCAAACTTATAAAGATTTAGGG + Intronic
1101597857 12:106183198-106183220 TGCAAACTTAAAAACCAAGCTGG - Intergenic
1101660941 12:106765156-106765178 TGCAAGATTAGAAAAAATTAAGG + Intronic
1101926350 12:108974838-108974860 TGTAACTTTAAAACAAATGATGG + Intronic
1102278821 12:111602086-111602108 TTCAAAATTAAAAAAAAAGAAGG + Intergenic
1103822093 12:123707169-123707191 TAGAAACTTAAAAAAAAGTACGG + Intronic
1103829106 12:123764167-123764189 TGAATATTTAAAATAAATGAAGG - Intronic
1103942046 12:124506476-124506498 TGGAAACAAAAAAAAAAGGAGGG - Intronic
1104474800 12:129062361-129062383 GATAAAATTAAAAAAAATGAAGG + Intergenic
1104535067 12:129611121-129611143 TGCAAAAATAAAAATAAAGAAGG - Intronic
1106180864 13:27368250-27368272 TGCCAACTTAAAAAAAAAAATGG + Intergenic
1106385007 13:29276055-29276077 TGCTAATTTAAAACAAATTATGG + Intronic
1106428228 13:29654408-29654430 TGCTAACTGAAAAAAAATTTTGG - Intergenic
1106631129 13:31474818-31474840 TGTATACTGAAAAAAAATCAGGG + Intergenic
1106647318 13:31650385-31650407 TGCAATATTTAAAAGAATGATGG + Intergenic
1106649609 13:31676043-31676065 TGCCACCTAAAAAAAAATGCAGG + Intergenic
1106887771 13:34208339-34208361 TGCAAATTTCAAAAAAAATAAGG - Intergenic
1106966452 13:35076739-35076761 TGCAAACTAGAAGAAAATTAAGG - Intronic
1107665616 13:42687253-42687275 TGCTAAATTAAAAAAAAAAATGG + Intergenic
1107679537 13:42834109-42834131 TTAAAAATGAAAAAAAATGAAGG + Intergenic
1107745243 13:43498622-43498644 TCTAAATTTAAAAAAAAAGATGG + Intronic
1108282635 13:48874992-48875014 TTTAAATTTAAAAAAAATGAAGG + Intergenic
1109048460 13:57444393-57444415 TCCTAAGTTAAAAAAAATGCTGG + Intergenic
1109131201 13:58588202-58588224 TTCAAATTGAAAAAAAATTAAGG + Intergenic
1109319688 13:60795170-60795192 TGAAAACTAAATAAAAATCAAGG - Intergenic
1109389534 13:61674706-61674728 TGCTAAATAATAAAAAATGAAGG - Intergenic
1109680601 13:65747412-65747434 TGTACACTTAAAAATAATTAAGG - Intergenic
1110491472 13:76113868-76113890 TGCAAACATAAAACAACTGAAGG + Intergenic
1110662533 13:78073945-78073967 TTTAAAGTTAAAAAAAATAAAGG + Intergenic
1110997690 13:82134429-82134451 TGCAGAATTCAAAAAAATGTTGG + Intergenic
1111039168 13:82721893-82721915 TAAAAACTTAATAAAAATCAGGG + Intergenic
1111052552 13:82904534-82904556 TGCAAACTTGGAGAGAATGAAGG - Intergenic
1111647083 13:91044837-91044859 TGAAAACATAAAGAAAATCAAGG + Intergenic
1111681216 13:91444090-91444112 TGAAAAATCAAAAAGAATGAAGG - Intronic
1112696205 13:101951395-101951417 AGAAAACTGAAAAAAAATAAAGG - Intronic
1112814789 13:103259919-103259941 AACAAACTTCAAAATAATGAAGG - Intergenic
1112856308 13:103773860-103773882 TTGATACTTAAAAAAAATCATGG - Intergenic
1112907325 13:104440547-104440569 AGCAAAATAAAAAAAAATTACGG + Intergenic
1113701155 13:112389502-112389524 TGTAAACTTAAAAAACATTTGGG + Intronic
1114890337 14:26913688-26913710 TGCAAAATTAATAAGAATGGAGG + Intergenic
1114907188 14:27144547-27144569 TGCAAACTTCTAAAACATAAAGG - Intergenic
1114910308 14:27185744-27185766 TGCAAACTTATATAAAATTCAGG + Intergenic
1115040621 14:28920754-28920776 TGCAATATTAGAGAAAATGATGG + Intergenic
1115809689 14:37092767-37092789 TGAAAAATTAAAAAAAAAGGTGG - Intronic
1115931845 14:38506140-38506162 AGCAAAGTAAAAGAAAATGATGG - Intergenic
1116367056 14:44080277-44080299 TGTATACTTAAAAAAAAGTAGGG - Intergenic
1116420418 14:44726027-44726049 TGGAAAGTAAAAAAAAATTATGG - Intergenic
1116548307 14:46200021-46200043 TCCAAACTGAAAAAAAAAGTTGG + Intergenic
1116563648 14:46416744-46416766 TGGAAAGTTTAAAGAAATGATGG + Intergenic
1116873219 14:50087463-50087485 AGGAAACTTAAAAAAAAAAAAGG + Intronic
1117553993 14:56865967-56865989 TCAAAACTTAGAAAAACTGAAGG - Intergenic
1117620749 14:57583820-57583842 TGAAAACTGAAAAAAAAATATGG + Intronic
1117662788 14:58025131-58025153 TGCAAAGTTCAATAAAGTGAAGG + Intronic
1117927785 14:60802462-60802484 TGTCAACTGAAAAAAAAAGAGGG + Intronic
1118534511 14:66745184-66745206 TTCAAACTTTAAAAAAATGTTGG + Intronic
1119257652 14:73212411-73212433 TGCCAACTTAAAAAGTCTGAAGG - Intronic
1119491207 14:75035219-75035241 TGAAAACTTAAAAAAAAAATTGG + Intronic
1119653542 14:76400389-76400411 TGCAGATTTGAACAAAATGAGGG + Intronic
1120031701 14:79649103-79649125 TGAAAACTTAAAGAAGAGGAGGG - Intronic
1120092602 14:80350299-80350321 TGGAAAGTTAAAAAAAATACAGG + Intronic
1120146739 14:80987046-80987068 AACAAACTTAAGAAAAAGGAAGG - Intronic
1120383335 14:83810975-83810997 TACATAGTTAAAAAAAATTATGG + Intergenic
1120400908 14:84030380-84030402 TGCAAAGTTAAAAAAAAAAAGGG - Intergenic
1120422044 14:84299829-84299851 TGCAAACATGCAAAAAATTATGG + Intergenic
1120520954 14:85528019-85528041 TGCAAGCTTCAAAAAACAGAGGG - Intergenic
1121984252 14:98486658-98486680 TGGAAACTTAGAAAAAAAAAGGG + Intergenic
1122001325 14:98657217-98657239 TTCAAAATTAAAAAAAAAAAGGG - Intergenic
1122065442 14:99170256-99170278 TGCAAAGTTAAAAAAAAGGGGGG - Exonic
1122380567 14:101302225-101302247 TGCAGACAAAAAAAAATTGAGGG + Intergenic
1123796548 15:23777666-23777688 TAAAAACTTAAAAAAAAAAAAGG - Intergenic
1124007979 15:25810011-25810033 TACAAAAAAAAAAAAAATGACGG + Intronic
1124951378 15:34324286-34324308 TGTATACTTTAAAAAAATTATGG + Intronic
1125190040 15:36981088-36981110 AGAAAACTTGAAAAAAATGAAGG - Intronic
1125715372 15:41817012-41817034 TGCAAACTTAACAGCAGTGATGG - Exonic
1125840363 15:42795252-42795274 TGCAAAAAAAAAAAAAATGAAGG - Intronic
1125898862 15:43326852-43326874 TGCAAAATTAATAGAAATAAAGG + Exonic
1126056730 15:44736719-44736741 TGCTAAGTTAAAAAAAAAAAGGG - Intronic
1126281148 15:46951293-46951315 GGCAAACAGAAAAAAACTGAAGG + Intergenic
1126463067 15:48934432-48934454 AGCAAACTGAAAATAAATGTTGG + Intronic
1126642996 15:50846800-50846822 TGGAAACTCAAGAAAACTGATGG + Intergenic
1127030749 15:54859315-54859337 TGCAGACAAAAAAAAAATGGGGG + Intergenic
1127566248 15:60191653-60191675 TGGAAATTTAAGAAAAATTATGG + Intergenic
1127594170 15:60461548-60461570 TGCAATCTTTTAAAAAATGTGGG + Intronic
1127594686 15:60467951-60467973 TTCCATTTTAAAAAAAATGACGG + Intronic
1127600644 15:60533227-60533249 TGCAAGCACTAAAAAAATGATGG - Intronic
1127693094 15:61416579-61416601 TGTAAACTTAAGAGAGATGATGG - Intergenic
1127951397 15:63810415-63810437 TGTAAAAATAAAAAAAAAGAGGG + Intronic
1128041338 15:64576134-64576156 TGAAAAATTAATAAAAATGGGGG + Intronic
1128772603 15:70293523-70293545 TGCAAATTGTAAAAAACTGATGG - Intergenic
1128950251 15:71872218-71872240 AACTAACTTAAAAAAAATCAAGG + Intronic
1130642081 15:85686604-85686626 TCCAAAAAAAAAAAAAATGAAGG + Intronic
1130737578 15:86566270-86566292 TGCATACTCAAGAAAAATTAGGG - Intronic
1130793848 15:87187757-87187779 TGTAAAATTTTAAAAAATGATGG + Intergenic
1131573957 15:93567627-93567649 TGTAAACTTTAAATAGATGATGG - Intergenic
1131659898 15:94502676-94502698 TGCAAACTTATAAAAGCTGTAGG - Intergenic
1131856350 15:96600398-96600420 TGCCTACTTAAAAAAAATTCAGG - Intergenic
1132136754 15:99348952-99348974 TGAAAACTATAAAAAACTGATGG - Intronic
1132180449 15:99749048-99749070 TGGAAATTTAAAAAAATTAAGGG + Intergenic
1133566572 16:7001122-7001144 TGAAAACTGGAAAAAAATGAAGG - Intronic
1133895357 16:9922304-9922326 TGCAGATTTAAAAAAAAAAAAGG + Intronic
1134341085 16:13346847-13346869 TGCACCCTTAAAAAATATGGTGG + Intergenic
1135714870 16:24754555-24754577 TCCATACTTTAAAAAAAGGAGGG + Intronic
1136733744 16:32443374-32443396 TTCAAACTTCAGAAAATTGAGGG - Intergenic
1137030266 16:35517423-35517445 TCCAAACAGAAAAAAAAGGAAGG - Intergenic
1137650147 16:50112954-50112976 TAAAAAATGAAAAAAAATGAAGG - Intergenic
1138863548 16:60789409-60789431 TACTAAGTTAAAAAAAAGGAAGG - Intergenic
1138943830 16:61823045-61823067 TGCAAAGGCAAAAAAAGTGAGGG + Intronic
1138957929 16:61993473-61993495 TGCAAACATTTAAAAAATTATGG - Intronic
1138997288 16:62471660-62471682 TGCAAATTTGAGAAAAATTAGGG - Intergenic
1139061360 16:63256470-63256492 TATAAACTAAGAAAAAATGATGG - Intergenic
1139731548 16:68950263-68950285 TGTACACTTAAAAAAATTAAAGG + Intronic
1140144560 16:72293999-72294021 TTCAAAAACAAAAAAAATGAAGG + Intergenic
1141265763 16:82495530-82495552 TCAAAACTTCAAAGAAATGAGGG + Intergenic
1141278308 16:82607603-82607625 TCCAAACTTAAAACATATGAAGG - Intergenic
1141297808 16:82786009-82786031 GGCAAATTTAAAGAGAATGATGG + Intronic
1141372545 16:83500953-83500975 TGCAATCTTAAAAACATTAACGG - Intronic
1141784818 16:86192032-86192054 AGCAAACTTTAAAAAAATAAAGG - Intergenic
1141954986 16:87364707-87364729 TGCAAAGTGAAACTAAATGATGG - Intronic
1203019339 16_KI270728v1_random:386227-386249 TTCAAACTTCAGAAAATTGAGGG + Intergenic
1203037674 16_KI270728v1_random:659385-659407 TTCAAACTTCAGAAAATTGAGGG + Intergenic
1143688934 17:8544010-8544032 TGTTAAGTTAAAAAAAATCAGGG - Intronic
1143848329 17:9790366-9790388 TGCAAACTTAAGGACAATTACGG + Intronic
1144288958 17:13807117-13807139 AGTAAACTGACAAAAAATGAGGG - Intergenic
1144307426 17:13981874-13981896 TGCTAACTTGAAACAAATCAAGG + Intergenic
1145216358 17:21055560-21055582 TACAAAGTTAAAATAAATGTAGG - Intergenic
1146044793 17:29495303-29495325 TGCAGAGTTAAAATAACTGAAGG - Intronic
1146311833 17:31775227-31775249 TGTAAACTTAAAAACTATAAAGG - Intergenic
1146707182 17:35009584-35009606 TGCAAAAAAAAAAAAAATCAGGG + Exonic
1147207677 17:38849783-38849805 TGCAAACTCACAAAAAAGCAAGG + Exonic
1148933546 17:51146513-51146535 TCCTCACATAAAAAAAATGAGGG + Intergenic
1149275005 17:55024024-55024046 TACAAAAGTAAAAAAACTGATGG + Intronic
1149897904 17:60444451-60444473 TGCGATCTTAGAAATAATGAAGG - Exonic
1149935617 17:60803753-60803775 GGGAAAATGAAAAAAAATGAAGG - Intronic
1150243444 17:63655125-63655147 AGCAAACTTAACAATCATGATGG + Intronic
1150422154 17:65047053-65047075 TGTAAACTTAAAGGAACTGACGG + Intronic
1150461014 17:65351422-65351444 TGTAAACATAAAACAAAAGAAGG + Intergenic
1150513397 17:65780412-65780434 TACAAACTTTAAGAGAATGAGGG + Intronic
1151110142 17:71666744-71666766 TGCAATCTTAAAAAAAAAAATGG + Intergenic
1153091668 18:1353321-1353343 TGAAAAATTGTAAAAAATGAAGG + Intergenic
1153775112 18:8446079-8446101 AGCTAACTTAGAAAAAAAGAGGG - Intergenic
1155063110 18:22246088-22246110 TGTACACTTATAAAAATTGAGGG - Intergenic
1155795723 18:30034585-30034607 TGCAAACTTAACATAAAACAGGG - Intergenic
1155816780 18:30321149-30321171 TTGAAACTTAAGAAAAATTAAGG + Intergenic
1156072927 18:33235569-33235591 TGGAAACTTAGTAAAAAGGAAGG - Intronic
1156173820 18:34518679-34518701 TGCCAAATTAAAAAAAAAAACGG - Intronic
1156619036 18:38826670-38826692 TGGAATATTAAAAAAAAGGAAGG + Intergenic
1156623288 18:38878714-38878736 TGCCAACTTATACAATATGAAGG - Intergenic
1156664248 18:39385978-39386000 GGCAAACTGAAGGAAAATGAAGG - Intergenic
1158003486 18:52646013-52646035 TGCAAACTAAAGCAAAATCATGG - Intronic
1158022806 18:52863968-52863990 TGCAAACTTAAAAAGCATTTAGG + Intronic
1158367864 18:56759755-56759777 TTCAAACTTAAAAAAAAGTAGGG - Intronic
1158447702 18:57535543-57535565 TGCAAAGTTAAAAAGAAAGGAGG - Intergenic
1158543533 18:58377390-58377412 TGTGAAATTAAAAAAAAAGAAGG - Intronic
1158828624 18:61253118-61253140 TGAAAAAATAAAAAAAAGGAAGG + Intergenic
1158913415 18:62093150-62093172 TCAAATCTTTAAAAAAATGACGG - Intronic
1159069917 18:63612169-63612191 TTAATACTTAAAAAAATTGATGG - Intergenic
1159161842 18:64652124-64652146 TGCCAACTGAAAAAATATGGTGG - Intergenic
1159297575 18:66515967-66515989 TGCAAACTTAAAAAGTATTGAGG + Intronic
1159313022 18:66734919-66734941 TGTAAACTTAAAATAAATGCTGG - Intergenic
1159347451 18:67225412-67225434 TGCAAAGTTAAAGAAAAATAAGG - Intergenic
1159459830 18:68710924-68710946 TCCAAACTTTAAAGAAAGGAAGG + Intronic
1159764055 18:72464984-72465006 TCTAATCTTAAAAAAAATTATGG - Intergenic
1159784775 18:72699713-72699735 TCAAAAATTAATAAAAATGATGG + Intergenic
1159804806 18:72943384-72943406 GGCATTCTTAAAAAGAATGATGG + Intergenic
1160644274 19:171827-171849 AACAAACTTAAAAAAAATTGTGG - Intergenic
1162704771 19:12547217-12547239 TACAAAATTAAAAAAAATTGTGG - Intronic
1162714211 19:12619357-12619379 TACAAACTTAAAAAAAGTGGTGG + Intronic
1163515393 19:17760043-17760065 TGCAAAAAAAAAAAAAAAGATGG - Intronic
1164184058 19:22846320-22846342 TGCTTACTTAAACAAGATGACGG + Intergenic
1164466779 19:28493835-28493857 TGTACACTTAAAAATAAAGATGG - Intergenic
1164768117 19:30787247-30787269 CTCAAACTGAAAAAATATGAGGG + Intergenic
1165567219 19:36741057-36741079 TTTAAAAGTAAAAAAAATGATGG + Intronic
1166578522 19:43868388-43868410 TTAAAATTTAAAATAAATGAAGG + Intergenic
1167980671 19:53272628-53272650 TGGAAGGTTAAAGAAAATGAGGG + Intergenic
925513587 2:4654183-4654205 TGCATGCTTAAAAAACAGGAAGG + Intergenic
925590633 2:5506176-5506198 TGGAACCATAAAGAAAATGAAGG - Intergenic
926522463 2:13932332-13932354 TGCAAACTTAGAAAGAAACATGG + Intergenic
926593373 2:14763038-14763060 TGCACACTCAAAAAACATGGTGG - Intergenic
926794590 2:16608435-16608457 TGCGATCTTAAAATAGATGAGGG - Intronic
926903281 2:17781132-17781154 TGCAAACATAAAGAAAGTGTTGG + Exonic
927383644 2:22507730-22507752 TGAAAACTTAATAAACAAGATGG - Intergenic
927414267 2:22861019-22861041 AGAAAACATAAAAGAAATGAGGG - Intergenic
927764109 2:25788608-25788630 TCCAAAATTAAAAAGACTGATGG - Intronic
927830629 2:26346627-26346649 TGGAAACTTCACTAAAATGAAGG - Intronic
928812962 2:35251765-35251787 TGAAAAGTTAAAAAAAATCCAGG - Intergenic
928940577 2:36723518-36723540 TGCAAGCTAAAGCAAAATGAGGG - Intronic
929052778 2:37852286-37852308 TGCAAACTGAAAAAACAAAAAGG + Intergenic
929319433 2:40524288-40524310 AGGAAAGTTAAAAGAAATGAGGG - Intronic
929367344 2:41175876-41175898 TTCAGTTTTAAAAAAAATGATGG + Intergenic
929626021 2:43407854-43407876 TGGGAACATAAAAAGAATGATGG + Intronic
929816468 2:45236823-45236845 TGTTTTCTTAAAAAAAATGACGG + Intergenic
930441447 2:51412532-51412554 TTCAAACTTAAAAAAAGAGAAGG + Intergenic
930991301 2:57658709-57658731 TGCAAAATCTAAAAACATGAAGG - Intergenic
931064524 2:58570498-58570520 TGCAAAATTTAATAGAATGATGG + Intergenic
931150340 2:59566077-59566099 TGCCAAATTAAAAAAAATTCTGG + Intergenic
931265964 2:60660716-60660738 TTGAAAATTAAAAAAAAAGAAGG - Intergenic
932163536 2:69484893-69484915 TAAAAACATAAAAAAAAGGAAGG + Intronic
932511557 2:72298307-72298329 TGGAAAGTTAAAAAAAAAGCAGG - Intronic
933003869 2:76964577-76964599 TGAAAACTGAAATAAAATTATGG + Intronic
933168955 2:79104133-79104155 TTGACACATAAAAAAAATGAAGG + Intergenic
933526283 2:83444399-83444421 TGCAAACTTAAAAATTTTGAAGG + Intergenic
933526356 2:83445139-83445161 TGCAAACTTAAAAATTTTGAAGG - Intergenic
933529694 2:83491708-83491730 TGAAAACTTAAAAAAATTAATGG + Intergenic
933690321 2:85174723-85174745 TGAAAACTGAAGAGAAATGATGG - Intronic
933854793 2:86402759-86402781 AGCAAACTTAGTTAAAATGAGGG + Intergenic
935213951 2:100961432-100961454 AAAAAACTTAAAAAAACTGAGGG - Intronic
935327649 2:101951949-101951971 TGCACACTTCAAAAAAGTCAAGG - Intergenic
935533110 2:104259961-104259983 TGTAAAAATAAAATAAATGAAGG + Intergenic
936007256 2:108900728-108900750 TGCAAACTTCAATAACAAGAAGG + Intronic
936544835 2:113382105-113382127 TGGAAACTGAAAAAAAAAAAGGG + Intergenic
936613939 2:114029528-114029550 TGCAAATTAAAAAAACATTAAGG - Intergenic
936725037 2:115303655-115303677 TACAAGGTTAAAAAAAATAAAGG - Intronic
936819842 2:116507067-116507089 AGCACAATTAAAAATAATGAAGG - Intergenic
936843956 2:116807339-116807361 TGGAAACTAAAAGAAAATCAAGG + Intergenic
937199091 2:120185629-120185651 TGCAAATGTCAACAAAATGAAGG - Intergenic
937615064 2:123912169-123912191 TGGGAACTTTAAAAAAATCACGG + Intergenic
937628528 2:124071236-124071258 TGCATAAATAAAAAAAATAAGGG + Intronic
937709388 2:124961628-124961650 AGAAAACTTAAAAAAAATATAGG + Intergenic
938045547 2:128116374-128116396 TGGAGGCTTAAAGAAAATGAGGG - Intronic
938166869 2:129037246-129037268 TGCAAACTCAATAAAAATCCCGG + Intergenic
938517346 2:132026913-132026935 TGGAAACATAATAGAAATGAGGG + Intergenic
939309216 2:140451780-140451802 GGCTGACTTATAAAAAATGAAGG + Intronic
939422199 2:141986497-141986519 TATAAACTAAAGAAAAATGAGGG - Intronic
939436776 2:142187035-142187057 TGAAATCTTAAAAAAAAAGAGGG - Intergenic
939576877 2:143906644-143906666 TGAAATTTTAAAGAAAATGATGG + Intergenic
939814062 2:146872098-146872120 TTAATACTTAAAAAAAATGCTGG - Intergenic
939816717 2:146905394-146905416 TGCCAACTTAAAGAAAGTTATGG + Intergenic
939824157 2:146994508-146994530 TGCCAGCTTAAAAAAAAAAAAGG + Intergenic
939902672 2:147868931-147868953 AGGAAACTGAAAAAAAATAAAGG - Intronic
940234896 2:151500149-151500171 TGAAAATTTAACAAAATTGAAGG + Intronic
940367367 2:152863098-152863120 TGCAAATTTAAAAAAACTAAAGG - Intergenic
940552974 2:155185143-155185165 TTCAAACTTAGAGAAAATTAAGG + Intergenic
940740959 2:157507128-157507150 TGAAAACTTAAAAGAGATCAAGG - Intergenic
940825537 2:158407667-158407689 AGCAAAATTAAAAATAATGTGGG + Intronic
940868318 2:158838551-158838573 TAAAAACTCAAAAAAAATCAGGG - Intronic
940953300 2:159701497-159701519 TTCAAACTTTAAAAAAATTCAGG + Intergenic
940956789 2:159737786-159737808 CTCAAAATTAAAAAAAAAGATGG + Intronic
941169785 2:162122122-162122144 TTAAAACTGAAAAAAAATAATGG - Intergenic
941221722 2:162789709-162789731 AGAAAACTTAAAAAAAATGTTGG + Intronic
941883313 2:170503523-170503545 TGCAAGGCTAAAAAAAAGGAAGG - Intronic
941883320 2:170503582-170503604 TGCAAGGCTAAAAAAAAGGAAGG - Intronic
941924084 2:170878930-170878952 CTCAAAATTAAAAAAAAAGAAGG - Intergenic
942039411 2:172043929-172043951 TGCAAAATAAAAAAAAATATTGG + Intronic
942240735 2:173963293-173963315 TACATTATTAAAAAAAATGAGGG - Intronic
942502871 2:176610153-176610175 TGGAAACTTAAAAAAAAGGTTGG - Intergenic
942563584 2:177245439-177245461 TGCTAATTTAAAAAGAATTAAGG - Intronic
942783079 2:179669452-179669474 TGGAGACTTAAAAAATATGCTGG - Intronic
943234367 2:185299509-185299531 TAGAAACTTCAAAAATATGAAGG - Intergenic
943651470 2:190462453-190462475 TGTAAACTGATAAAATATGAGGG - Intronic
943789479 2:191916287-191916309 TGGAACATTAAAATAAATGAGGG + Intergenic
943826942 2:192407242-192407264 GGGAAAATAAAAAAAAATGAAGG - Intergenic
943948790 2:194102446-194102468 TGCAAACTTTTAAAACATCAAGG - Intergenic
943990556 2:194685336-194685358 TGAAAACTTAAAAAAATAGCTGG + Intergenic
944150810 2:196556112-196556134 TGCAAATTTAAGAGAAATTAAGG + Intronic
945129769 2:206558347-206558369 TGGCAACTTATAAAAAATGGTGG - Intronic
945365123 2:208943381-208943403 TGCAATCATATAAAAAATAAAGG - Intergenic
945560463 2:211333138-211333160 TGCAAGGAAAAAAAAAATGAAGG - Intergenic
945585625 2:211658005-211658027 TGCAAATTTAAAAAAATACAAGG + Intronic
945610764 2:211999418-211999440 TGCAAAAATGAGAAAAATGAGGG - Intronic
945695525 2:213098429-213098451 TTCAACCTTACACAAAATGATGG + Intronic
946091867 2:217233544-217233566 TTCAAACATAAAAGAAATTAGGG - Intergenic
946646496 2:221842336-221842358 TGCAAAATAAAAAATGATGAGGG - Intergenic
947058036 2:226129924-226129946 TGCAAACTAAATTAAAATTAGGG + Intergenic
947279367 2:228432112-228432134 TTCAAAGTAGAAAAAAATGATGG - Intergenic
947421384 2:229944056-229944078 TGGAAACTTAACAATCATGATGG - Intronic
947521401 2:230848966-230848988 TGCAAATTAAAACAACATGATGG + Intergenic
947556366 2:231096817-231096839 GGCTAACTTAAAGAGAATGACGG + Intronic
948064824 2:235069792-235069814 TACAAAGCTAAACAAAATGAAGG + Intergenic
948149012 2:235729870-235729892 TGTAAACATAAAAACAAAGAAGG + Intronic
948283122 2:236763782-236763804 TGAAAATTTAGAAAAATTGATGG - Intergenic
948964768 2:241369993-241370015 TGGGAACTGAAAAAAAGTGATGG + Intronic
1169795194 20:9454807-9454829 TACAACTTTAATAAAAATGAGGG - Intronic
1170085369 20:12525678-12525700 CTCAAACTTAAAAAATAAGAAGG + Intergenic
1170199119 20:13723380-13723402 TGTAAAATTACAAAAAATAAAGG + Intronic
1170309644 20:14978379-14978401 AGCCAACTTAAAAAAAGTGGGGG - Intronic
1170384165 20:15797703-15797725 TGCAGCCTTAAAAATAATCAGGG + Intronic
1171024725 20:21619397-21619419 TACAAAGATAAAAAAAATGGGGG - Intergenic
1171106386 20:22437203-22437225 TGCCAACTAAAAATAAAAGAGGG - Intergenic
1171324443 20:24278792-24278814 TAAAAACTTAAAAAAAAAAAGGG - Intergenic
1171559277 20:26108199-26108221 TGAAAACTCAAAGAAAATGTGGG + Intergenic
1173206048 20:40994260-40994282 TGCAAAAAAAAAAAAATTGAAGG + Intergenic
1173702813 20:45088054-45088076 TGCAAACTTAAAACAAATGCTGG + Intergenic
1174142765 20:48427973-48427995 TGCAAAAGTAAAAGGAATGATGG - Intergenic
1174240790 20:49133169-49133191 TGAAACCTTAACAAAAGTGAAGG + Intronic
1174634662 20:51988675-51988697 TGCAGACTCAAACAAAGTGAGGG + Intergenic
1174634993 20:51991541-51991563 TGAGAACTTAACAAAAATCATGG - Intergenic
1174731147 20:52918841-52918863 TGTCAGCTTTAAAAAAATGAGGG - Intergenic
1174911661 20:54614859-54614881 TGCTAAAATAAAACAAATGAAGG + Intronic
1175768821 20:61610020-61610042 TTGAAACATACAAAAAATGATGG + Intronic
1176670656 21:9732289-9732311 TGTAAAATGAAAAAAAATTATGG - Intergenic
1176700475 21:10042852-10042874 TGCATACTTATAATAATTGAAGG + Intergenic
1176718404 21:10373765-10373787 TTAAAACTAAAAAAAAAAGAGGG + Intergenic
1177051241 21:16237695-16237717 TGCAGTCTTAAAAAAAAAAAAGG + Intergenic
1177470126 21:21549636-21549658 TGCAAACTTTAAAACCTTGATGG + Intergenic
1177697751 21:24595136-24595158 TGAAAAGCTAAAAAAACTGACGG - Intergenic
1177795076 21:25767360-25767382 TACAAGTTTAAAAAAAAAGAGGG + Intronic
1177886515 21:26752533-26752555 TGGAAATTCAAAAAATATGATGG - Intergenic
1177933454 21:27315247-27315269 AGCAAAATCAAAAAATATGAAGG - Intergenic
1178569334 21:33720561-33720583 AACAGACTTAAAAAAAAAGAAGG - Intronic
1178812541 21:35897284-35897306 TGCAAAATTAAAGAAAATAATGG - Intronic
1179174636 21:38999615-38999637 AGTGAACTTAAAAAAAATCATGG - Intergenic
1179215302 21:39362220-39362242 TGGAAACCTGAACAAAATGAGGG + Intergenic
1180643185 22:17316283-17316305 TAAAAATTTAAAAAAAAAGAAGG + Intergenic
1181337208 22:22146414-22146436 TCCAAACTTCAGACAAATGATGG + Intergenic
1182133849 22:27881921-27881943 TTCAAAATGAAAAAGAATGATGG - Intronic
1182207209 22:28640658-28640680 TGCATACTCAACAGAAATGACGG + Intronic
1184069493 22:42139295-42139317 TGCAAACAGCAAAAGAATGATGG - Intergenic
1184124506 22:42477537-42477559 GGCTTACTTAAAAAAAATCAGGG + Intergenic
1184907896 22:47501949-47501971 TGAAAACTAAAAAAAAAAAAAGG + Intergenic
949781463 3:7693537-7693559 TGCAAACATGACAAAAATGAGGG - Intronic
950429418 3:12942304-12942326 TTTAAACTTAAAAAAAAGGCCGG + Intronic
950771619 3:15315839-15315861 TTCAAACTTGGAAAAAATGAGGG + Intronic
950947355 3:16962941-16962963 TTCAAACTTAAAAAAGGTAATGG + Intronic
951015579 3:17728927-17728949 AGCAAATTTAAAAACAATGTTGG + Intronic
951056779 3:18156363-18156385 TGCAAAATTTAAAAAAATCAGGG - Intronic
951491369 3:23273235-23273257 TGCAACTTTAAGAGAAATGATGG + Intronic
951687854 3:25364427-25364449 TGCAAATTTACACAAAATGTGGG + Intronic
951733032 3:25831939-25831961 TGCTTGCCTAAAAAAAATGAGGG + Intergenic
951855450 3:27191804-27191826 TGCAAAAATAAAATAAATTATGG + Intronic
952121582 3:30251142-30251164 TTCAAACTAATAAAAAAAGATGG - Intergenic
952415807 3:33090918-33090940 TGCAAAATTAAAAAAAAAATAGG + Exonic
952573497 3:34745796-34745818 TGAAAAATTAAAAAGAAGGAAGG + Intergenic
953529004 3:43721890-43721912 TGCAAAATAAAATAAAATAATGG + Intronic
954154606 3:48678504-48678526 TGGAAACTGAAACAAAATGGTGG - Intronic
955194423 3:56791858-56791880 AGCAAAATTAAAAAAAAAAAAGG + Intronic
957282667 3:78173437-78173459 TGCAAAGTTAAAATTAATGCAGG - Intergenic
957582721 3:82095508-82095530 TTCAAACTCAAAGAAAAGGATGG - Intergenic
957740252 3:84257036-84257058 TGCTAAATTTAAAAAAATAATGG - Intergenic
957909020 3:86597828-86597850 TCCAAAATTAAAAAAAAATAAGG + Intergenic
958017066 3:87950552-87950574 TGTCAACTTAAAAAAAAAAAGGG + Intergenic
958478073 3:94610629-94610651 TGCCAAAATAATAAAAATGATGG - Intergenic
958924362 3:100141572-100141594 TGAAAACCTAAGGAAAATGATGG + Intronic
959108046 3:102088549-102088571 AGCAAAGTTAAGACAAATGATGG + Intergenic
959147120 3:102561395-102561417 TGAATACTTCAAAAAAAAGAGGG - Intergenic
959234281 3:103698477-103698499 GGCCAACTTAAAAAAATTGCTGG + Intergenic
959287452 3:104434242-104434264 TGCAAACTTTCAAGAAATAAGGG - Intergenic
959294445 3:104518123-104518145 TGCTAAGTTAAATTAAATGATGG - Intergenic
959347138 3:105211143-105211165 GGCATTCTTAAAAAAAATGCTGG - Intergenic
959393436 3:105805187-105805209 TGCGAACTTTATAAAAATTAGGG - Intronic
959455193 3:106551045-106551067 TGCAAACATACAGAAAATAAGGG + Intergenic
959487597 3:106945263-106945285 TGCAAACTTAAGCCAAAGGAAGG + Intergenic
960324658 3:116281078-116281100 TGCAAACTTGGAAAAAATACAGG + Intronic
960651276 3:119952804-119952826 CTCACACTTAAAAAAAAAGATGG + Intronic
960658819 3:120035622-120035644 TGAATACCTAAAAAAAAGGATGG - Intronic
960675437 3:120189963-120189985 TGAAAAGTACAAAAAAATGATGG + Intronic
960692980 3:120366617-120366639 AGAAAACTTCAAAAAAATCAAGG - Intergenic
961058944 3:123812276-123812298 TGTAAGCTTAAACCAAATGAGGG + Intronic
961969705 3:130947970-130947992 TGCAAAAATAACAAAGATGAGGG - Intronic
961997187 3:131258334-131258356 TAAAAACTTAAAAAAAGAGAAGG + Intronic
962418448 3:135205169-135205191 TGTAAATTAAAACAAAATGATGG - Intronic
963245838 3:143061296-143061318 TGGAAACTTAAAGAAAAAGTGGG - Intergenic
963285135 3:143427559-143427581 TGCAATTTTTAAAAAAATCATGG + Intronic
963504755 3:146170165-146170187 TGGAAACTTAAACAAAATTTAGG + Intergenic
963646824 3:147925370-147925392 TGTAAACTGAAAAAAAAAAAAGG - Intergenic
963768945 3:149368944-149368966 TGCAAACTGGAAAAAAAAAAGGG + Intergenic
963919603 3:150892938-150892960 TGCAAAAAAAAAAAAAATGGAGG + Intronic
963934765 3:151040921-151040943 TGCACAATTCAAAAGAATGATGG + Intergenic
964632434 3:158826230-158826252 AGCAATCTTAATAAATATGAAGG - Intronic
964785696 3:160393648-160393670 TGTACACTTTAAAAAAAAGATGG + Intronic
965068447 3:163883542-163883564 TCCAAACTTCCAAAACATGAGGG - Intergenic
965227662 3:166010309-166010331 TACAAAATTACAAAAAATTAGGG - Intergenic
965361696 3:167748555-167748577 TGCAACATTAAAAATAAGGAAGG + Intronic
965475773 3:169153449-169153471 TCCGAAGTTAAAAAGAATGAGGG - Intronic
965955474 3:174363830-174363852 AGAACACTGAAAAAAAATGAGGG - Intergenic
966089699 3:176118188-176118210 TGAAAAGTTAAAAAAAAACATGG + Intergenic
966199313 3:177345189-177345211 TGCAAACTAAAAAAGAATGGAGG + Intergenic
966625766 3:182014589-182014611 TGCAAAGTTAAAGAAAAAGGAGG + Intergenic
967671707 3:192244036-192244058 TGTAATTTTAAAAAATATGATGG - Intronic
967898817 3:194425778-194425800 CCCAAAATTAAAAAAACTGAGGG - Intronic
968016039 3:195334045-195334067 TAAAAACTTAATTAAAATGAGGG - Intronic
968179127 3:196577857-196577879 TGTAAATTTAAAACAAATTAAGG - Intronic
968297556 3:197589007-197589029 TACAAAGATAAAAAAAATGTTGG + Intergenic
968327664 3:197834229-197834251 TTTAAACTTAAAAATAATGGGGG + Intronic
968680105 4:1912524-1912546 TGAATACTTGAAAAAAATTAAGG - Intronic
968893279 4:3384031-3384053 TGTAAACTTCATAAATATGAAGG - Intronic
969071543 4:4543427-4543449 TGCACACTTAAAAATTATTAAGG - Intergenic
969157706 4:5226241-5226263 TGAAAACTTTAAGAAAATAATGG - Intronic
970067304 4:12113264-12113286 AGCACAATTAAAAACAATGAAGG - Intergenic
970132579 4:12887509-12887531 TGCACAGTAAAAAAAAAAGATGG + Intergenic
970658982 4:18263186-18263208 TGCAAACTGTCAAAAAAGGAAGG - Intergenic
970675839 4:18449584-18449606 TTTCAACTTAAAAAAAATTAAGG - Intergenic
971944996 4:33263463-33263485 TACAAAATAAAAAAAAATCAAGG - Intergenic
972150501 4:36083776-36083798 TGCAAACTTGATTAAATTGAAGG + Intronic
973552971 4:52053400-52053422 TGCAAACTCAAGAGAAATGATGG - Intronic
974298023 4:60029221-60029243 TAAAAACAGAAAAAAAATGATGG - Intergenic
974431409 4:61801608-61801630 TACAAAAAGAAAAAAAATGAAGG + Intronic
974475200 4:62370333-62370355 TCCAAACCTATAAAAAATGTTGG + Intergenic
974879511 4:67736671-67736693 TGATAACTAAAAAAAATTGAAGG - Intergenic
974909354 4:68097703-68097725 TAAAAACGAAAAAAAAATGAAGG - Intronic
975138704 4:70899223-70899245 AGTAAAATTAAAAAAAAAGAGGG - Intergenic
975384625 4:73741713-73741735 AGCAAACTTAAAATTAAGGAAGG + Intronic
975462448 4:74670240-74670262 TGGAAAGTTAAATGAAATGAAGG + Intergenic
975554029 4:75641880-75641902 CACAAAATTAAAAAAAATCAAGG + Intergenic
975667042 4:76742207-76742229 TGCAAGGTTAAGAAAAATTAGGG + Intronic
975794343 4:77990499-77990521 TGCAATCTTAGTAAAAAGGAAGG - Intergenic
975905639 4:79208778-79208800 TATAAGCTTTAAAAAAATGAAGG + Intergenic
975966010 4:79973198-79973220 TGTAAACTTATAAAAAATGTTGG + Intronic
976197735 4:82549574-82549596 TGTACACTTAAAAATAGTGAAGG + Intronic
976212113 4:82681771-82681793 TTAAAAGTTAAAAAAAATGAGGG + Intronic
976567761 4:86571413-86571435 TCCAAACATCACAAAAATGATGG + Intronic
976875888 4:89852993-89853015 TGCAAACATTTGAAAAATGAAGG - Intergenic
976997952 4:91459782-91459804 TGCAAAGTTAAAAATACTGATGG - Intronic
977263434 4:94825541-94825563 TCCCATCTTAAAAAAAAAGATGG - Intronic
977684260 4:99829967-99829989 TGCAAAATTACAAAAAAGAAAGG - Intronic
977705071 4:100061659-100061681 TGCACTCTTAAAAAAGATTAGGG - Intergenic
978077263 4:104547783-104547805 TGAAAACTTACATAAAATTATGG + Intergenic
978326204 4:107559717-107559739 AGAAAACTTTATAAAAATGAGGG - Intergenic
978898550 4:113921170-113921192 TTCAAACTTAAATAAAAGTATGG + Intronic
978975956 4:114872908-114872930 GGCAAAAGGAAAAAAAATGACGG - Intronic
979061529 4:116067619-116067641 AAGAAATTTAAAAAAAATGATGG + Intergenic
979062971 4:116089791-116089813 TGGGAAGTGAAAAAAAATGATGG + Intergenic
979097476 4:116569196-116569218 CCCAAACTTAAAATAAATGTTGG + Intergenic
979324499 4:119362865-119362887 TGCCATCTAAAACAAAATGAAGG + Intergenic
979428466 4:120597317-120597339 TGAAAACTGAAAAAAAAACAAGG + Intergenic
979692853 4:123578805-123578827 TACCAACTAAAACAAAATGATGG + Intergenic
979876685 4:125900460-125900482 TTCAAAAATAAACAAAATGAGGG + Intergenic
980311121 4:131129965-131129987 TGCATTCTTAAAAATAATGTGGG + Intergenic
980380862 4:132014146-132014168 TTCTAAGTTAAACAAAATGAGGG + Intergenic
981059181 4:140402425-140402447 TATAAACTAAAAAAAAATAAAGG + Intronic
981217697 4:142190776-142190798 TGAAAAGTGAAGAAAAATGAAGG + Intronic
981233047 4:142381019-142381041 TGAAAAATTAGAAAGAATGAAGG - Intronic
981245912 4:142537594-142537616 TGCAACTTTAAGCAAAATGATGG + Intronic
981257670 4:142681670-142681692 TGCAAACGCCAAAGAAATGAAGG + Intronic
981384181 4:144108189-144108211 TGCAAAATTTAAAAAAATCCAGG + Intergenic
981786539 4:148485723-148485745 GGAAAACTTGAACAAAATGAGGG + Intergenic
981856554 4:149300739-149300761 GGAAAAGTTAAAAACAATGAAGG - Intergenic
982145857 4:152390968-152390990 TGGAAACATAAAAAATCTGAAGG + Intronic
982440736 4:155432900-155432922 TGCCAACTGAAAACAAAGGAGGG + Intergenic
982500977 4:156154160-156154182 TGCAAACAAATAAAAAATTATGG + Intergenic
982612289 4:157590577-157590599 TGGAAACGTACAAAAAAAGAAGG - Intergenic
982744887 4:159096113-159096135 TGCAAAAAAAAAAAAAATTAAGG - Intergenic
982765426 4:159342227-159342249 AACAAACTTAAAAAAAAAGTGGG - Intronic
983139252 4:164127906-164127928 TGAAAAAGAAAAAAAAATGAAGG + Intronic
983147399 4:164233753-164233775 TGCAAACTGTTAAAAAATGAAGG + Intronic
983301996 4:165937553-165937575 TGCAGAATAAAAATAAATGAGGG - Intronic
983314571 4:166114393-166114415 TGCAAAAATAAAAAAAATTGAGG + Intergenic
983711708 4:170725243-170725265 TACAAAAATAAAGAAAATGAAGG - Intergenic
983873338 4:172847810-172847832 TCCAAACTTACAAGACATGAGGG + Intronic
985031616 4:185796063-185796085 AGAAAATTTAAAAAAAATAAGGG - Intronic
985039439 4:185874853-185874875 TGCAAAAAAAAAAAAAATCAGGG - Intronic
985404123 4:189619250-189619272 TGTAAAATGAAAAAAAATTATGG + Intergenic
985417433 4:189750986-189751008 AGTAAACATAAAAGAAATGAGGG - Intergenic
985516575 5:348328-348350 TGCAAAAAAAAAAAAAAGGAGGG - Intronic
985726142 5:1516631-1516653 TACAAGCTTAAAAAAAAAAAAGG - Intronic
986006803 5:3675079-3675101 AGAAAACTTAAAAAAATTTAAGG - Intergenic
986350191 5:6870469-6870491 TGCAATCTCAAGCAAAATGATGG + Intergenic
986372885 5:7098454-7098476 TGAACACTTCAAGAAAATGAGGG - Intergenic
986457632 5:7935360-7935382 TGGATACTGAAAAACAATGAAGG + Intergenic
986553897 5:8990755-8990777 AGCAAACTTAAAGAAAATACAGG - Intergenic
987208527 5:15653875-15653897 TGCAAAGTTAGGAAAACTGAAGG - Intronic
987258710 5:16182114-16182136 TGCCAACTGAAAATGAATGAGGG + Intergenic
987365458 5:17144511-17144533 TGAAAAATGAAATAAAATGAAGG + Intronic
987583721 5:19827052-19827074 GGCAAACAGAAAAAAAGTGAGGG + Intronic
987670672 5:21003350-21003372 TAGAAACCTAAACAAAATGAGGG - Intergenic
987793054 5:22593114-22593136 TGCAAACTTTAAACCAATGAGGG - Intronic
987847069 5:23300952-23300974 TGCAAGTTTAAAAAAAATTGTGG - Intergenic
987870002 5:23603872-23603894 TACATACATAAAATAAATGAAGG - Intergenic
988040423 5:25881890-25881912 TGCAAACTTGCAAAAAATCTAGG - Intergenic
988118812 5:26933474-26933496 GGCTAACTAAAAAAAAAAGAAGG + Intronic
988312541 5:29579572-29579594 TGTAAAATTAAAAACACTGATGG - Intergenic
988464617 5:31476518-31476540 TGCAAAGTTAACAACACTGAAGG + Intronic
988623063 5:32843187-32843209 TTCAAAGAAAAAAAAAATGAAGG + Intergenic
988627783 5:32896696-32896718 TGGAAAGTTAAAAAAAATCAAGG - Intergenic
988728870 5:33950340-33950362 TGCAAACTAAGAAAAAATCCAGG - Intronic
988954455 5:36300739-36300761 TGAAAATTTAAAAAGACTGATGG + Intronic
989236601 5:39155096-39155118 TACAAACTTCAAAAAAAATACGG + Intronic
989277723 5:39609283-39609305 TCCTAAGTTAAAAAAAATTATGG + Intergenic
989400548 5:41003447-41003469 GGCAAAATTAAAAAAAATAATGG + Intronic
989402198 5:41020401-41020423 TGCCATGTTAACAAAAATGAGGG - Intronic
989810543 5:45667405-45667427 ATCAGACTTAAAAAAAATAAAGG + Intronic
989974853 5:50572806-50572828 AGCAAACTAAAAAAAAAAAAGGG + Intergenic
990047389 5:51450118-51450140 TAAAAAATTAATAAAAATGAAGG - Intergenic
990107765 5:52285690-52285712 TGGAAATTTGAAAAAAGTGATGG + Intergenic
990157849 5:52899676-52899698 CGAAAACTTAAAGAAATTGAAGG + Intronic
990211003 5:53481263-53481285 TGGATACTTAAAAAAAAAAAAGG + Intronic
990258914 5:54000149-54000171 TCCAAACTTAAAAAAACTAGAGG - Intronic
990556678 5:56943327-56943349 TGGAAATTTAAAAAAAAAAAAGG + Intronic
990978621 5:61581233-61581255 AGCAAACCTAAAAAAAAGTAGGG + Intergenic
990995421 5:61728202-61728224 TGAAAATTTAAATAAAATGGAGG - Intronic
991256617 5:64621443-64621465 TGGAAGCTTGAAAAAAATGATGG - Intergenic
991487076 5:67148554-67148576 TTTTAACTTAAAAAAAATTAGGG - Intronic
991517000 5:67448085-67448107 AGCAAAATTAATAAACATGAAGG - Intergenic
991627970 5:68624288-68624310 TGCAAATGGAAAACAAATGAAGG - Intergenic
991704978 5:69349166-69349188 TGCAAACATTAAAAAGATGAGGG + Intergenic
991986855 5:72297332-72297354 TATCAACTTAAAAAAACTGATGG + Intronic
992249082 5:74859258-74859280 CACAAACTAACAAAAAATGAAGG + Intronic
992813364 5:80411398-80411420 TGCATAGTAAAAAAATATGAAGG - Intronic
992913246 5:81420099-81420121 TGTAAACGTGAAAAAAAGGATGG + Exonic
992944317 5:81794696-81794718 ATCAAAGTTAAAAAAAATAAAGG - Intergenic
993198706 5:84783670-84783692 ATAAAACTTAAAAAAAGTGAAGG + Intergenic
993418783 5:87673284-87673306 TTGAGACTAAAAAAAAATGAAGG - Intergenic
993434537 5:87875517-87875539 TGCAAATTTAAAAAATAAAAAGG - Intergenic
993594385 5:89834515-89834537 TGCAAATATAAAACAAATGGAGG - Intergenic
993756463 5:91736024-91736046 TGCACACTTAAAGAAAAAGCTGG + Intergenic
993884180 5:93397264-93397286 AGCAAACTTATTAAGAATGATGG + Intergenic
994008211 5:94866542-94866564 TGCAAAAAAAAAAAAAAAGAGGG - Intronic
994025309 5:95074655-95074677 TGCCAAGTGAATAAAAATGAAGG + Intronic
994149022 5:96426891-96426913 TGCAAACCTATTAAAAATAATGG + Intronic
994349142 5:98724482-98724504 TGCAAATTAGAAAAAAAAGAGGG - Intergenic
994413436 5:99438621-99438643 TGCAAAGTTAAAAAAAGAGGGGG + Intergenic
994829665 5:104763195-104763217 AGCAGACTTGAGAAAAATGAAGG + Intergenic
994968889 5:106710043-106710065 TGCTAAATTAATTAAAATGAAGG + Intergenic
995195733 5:109365312-109365334 TGCAGACTTAAAATGAATAAAGG + Intronic
995971685 5:117979597-117979619 TGCAAAATTATAAAACAAGAAGG + Intergenic
995984170 5:118148159-118148181 TGCAAACTGAAAAAAAAATAGGG - Intergenic
996060426 5:119027119-119027141 TGGAAATTAAAAAAAAATTATGG - Intergenic
996594333 5:125184288-125184310 AACAAACTTAAAAAAAATGGTGG + Intergenic
997044936 5:130304044-130304066 TTCTAAATTAAAAAAAAAGATGG + Intergenic
997311603 5:132889326-132889348 TGTAAACTTTAAAAAAAAAAAGG + Intronic
997728841 5:136148741-136148763 TCCAAAGTTTATAAAAATGATGG - Intronic
998589366 5:143461132-143461154 TGCAAATTTAAAAAAAAATTAGG - Intergenic
998840207 5:146245167-146245189 TGCAAAAAAAAAAAAAATTAGGG - Intronic
999343693 5:150796125-150796147 TCCAAACTGAGAAAACATGAAGG - Exonic
1000000593 5:157135087-157135109 TGCAAACTTAAAAAAAATGAGGG - Intronic
1000207557 5:159076901-159076923 TGCAGCATTAAAAAGAATGAAGG + Intronic
1000539622 5:162524544-162524566 TGTACACTTAAAAATGATGAAGG - Intergenic
1000872247 5:166591420-166591442 GGCAAAAAAAAAAAAAATGAAGG + Intergenic
1000941344 5:167364825-167364847 AGCAAAATTAACAAAAATAAAGG + Intronic
1002732647 5:181352954-181352976 AACAAACTTAAAAAAAATTGTGG + Intergenic
1002751891 6:121152-121174 AACAAACTTAAAAAAAATTGTGG - Intergenic
1003219494 6:4146005-4146027 TGCTAACTTAAATAAAGTAATGG + Intergenic
1003358610 6:5400381-5400403 TGAAAACTGACAAAAAAAGAAGG - Intronic
1003714190 6:8627930-8627952 AGCAAAATGAAATAAAATGATGG - Intergenic
1004039621 6:11962606-11962628 TACTCACTTAAAAAAAATGAGGG - Intergenic
1004150212 6:13111873-13111895 TTAACAGTTAAAAAAAATGAAGG - Intronic
1004638246 6:17489089-17489111 TCCAAAATTAATAAAATTGATGG + Intronic
1004689495 6:17980660-17980682 AGCAAAATAAAGAAAAATGAGGG + Intronic
1005188851 6:23195081-23195103 TGCAAACAAAAAAAAAAAAAAGG + Intergenic
1005228824 6:23674969-23674991 TAGAAACTTAAGAAAAATGTGGG - Intergenic
1005246970 6:23897897-23897919 TGCAATCCTAAACAAAATCATGG - Intergenic
1005725568 6:28644284-28644306 TGTAAATGTAAAATAAATGATGG + Intergenic
1006548826 6:34803225-34803247 TGTAAAGTTAAAAAAAAAAAAGG + Intronic
1007678191 6:43615640-43615662 TGCATAGTTAAAAAAAAAAAAGG + Exonic
1008119470 6:47595408-47595430 TTCAAATTTAAAAAGCATGATGG - Intronic
1008176619 6:48275866-48275888 TGCAAATGTAATAAAAATTATGG + Intergenic
1008372395 6:50747642-50747664 TGCACACTTCAACAGAATGATGG - Intronic
1009419828 6:63453584-63453606 TGCAAACAAAAAAAAAAGCAGGG - Intergenic
1009757155 6:67955103-67955125 TGAAAATGTAAAAGAAATGAAGG - Intergenic
1009925838 6:70119680-70119702 TTCAAAGATAAAGAAAATGAGGG - Intronic
1009951714 6:70404386-70404408 AGTAAACTAAAAAAAAATAAAGG + Intergenic
1010979267 6:82351960-82351982 TGCAAACAACAAAAAAATGTAGG - Intergenic
1010984942 6:82412979-82413001 TGCAAACTGCAAAAGACTGAGGG + Intergenic
1011369592 6:86620666-86620688 TGGAAACTTAAGAAATATGAAGG + Intergenic
1011664185 6:89619037-89619059 TAAAAACTTAAACAAAATAAAGG - Intronic
1012019750 6:93903937-93903959 TACAAATTGAAAAAGAATGATGG - Intergenic
1012304077 6:97628754-97628776 TGCAAACTTAAAAAAATATATGG - Intergenic
1012551971 6:100471250-100471272 TGAAAAGTGAAAAAAAATCAAGG - Intergenic
1012685928 6:102248670-102248692 TGCAAACTTAATAAAAAATGTGG + Intergenic
1012756986 6:103244416-103244438 TGAAAATTTAAAAGAAAAGAGGG + Intergenic
1012995639 6:105970505-105970527 TGCGTACTTAAAATAATTGAAGG - Intergenic
1013238671 6:108223085-108223107 AGGAAACTTCAAAAAAATGGGGG + Intronic
1013248584 6:108312217-108312239 TAGAAACTTAGGAAAAATGAGGG - Intronic
1013427558 6:110027489-110027511 TGCAAAGTCAAAAACAATAATGG + Intergenic
1013533412 6:111041070-111041092 TGCAAACTTAAGAACAACAATGG + Intergenic
1013929953 6:115518410-115518432 TGAAAATTTAAAAAAAAAGCAGG + Intergenic
1014578079 6:123099091-123099113 TGAAAAATCAAGAAAAATGAAGG - Intergenic
1014596720 6:123352522-123352544 AGCAAGGTAAAAAAAAATGAAGG - Intronic
1014662566 6:124191869-124191891 TGAACACTTAGAAAAAATGAAGG - Intronic
1014789124 6:125651883-125651905 TGCTAATTTTAAAATAATGATGG + Intergenic
1015531323 6:134224038-134224060 TGTAATCTTAAAAAAAATATTGG - Intronic
1016066147 6:139685224-139685246 TGCAAACCTATCAAAATTGAGGG - Intergenic
1016502046 6:144732598-144732620 TGCATACTGAAAAAAAATCTTGG + Intronic
1017258255 6:152359059-152359081 TACCAACTTAAAAAAAATTCTGG - Intronic
1017372316 6:153726821-153726843 TTTAAAATTTAAAAAAATGAGGG - Intergenic
1017428447 6:154346430-154346452 TGCCAATTTAGAAAAAAGGAGGG - Intronic
1017739566 6:157394892-157394914 TGAGAATTTTAAAAAAATGATGG + Intronic
1017955252 6:159171712-159171734 TGCAAACATTAAAATTATGATGG + Intronic
1018406657 6:163491463-163491485 TAAAAAATAAAAAAAAATGAGGG - Intronic
1018928078 6:168220975-168220997 TTCATACATAATAAAAATGAGGG - Intergenic
1019236902 6:170625272-170625294 AACAAACTTAAAAAAAATTGTGG + Intergenic
1019328224 7:450013-450035 TGCAATTTTTAAAAAAAGGAAGG + Intergenic
1020250125 7:6460826-6460848 TGAAAACTTAAAAATAATAAAGG - Intronic
1020549282 7:9580246-9580268 TGCCAACTGAAAATAAATAATGG + Intergenic
1020596183 7:10210935-10210957 GAGAAACTTTAAAAAAATGAAGG - Intergenic
1020707770 7:11567217-11567239 TGGAAACTTAAAAATCATGGTGG + Intronic
1020831265 7:13098572-13098594 TTCAAAGGTAAAAAAAATCATGG - Intergenic
1020950735 7:14673480-14673502 TACAAAGTTAAAACTAATGATGG - Intronic
1021192613 7:17639147-17639169 TGCATACTTAAAAAAAATATTGG - Intergenic
1021214056 7:17894000-17894022 TTCAAACTTAAAAAAAAATCAGG + Intronic
1022087903 7:27087175-27087197 TGCAAGTTTAAAAAAAAAGCTGG + Intergenic
1022533257 7:31080010-31080032 AACAAACTTTAAATAAATGACGG - Intronic
1022618360 7:31955712-31955734 TTGAAACGTAAAAAAATTGAGGG + Intronic
1023592302 7:41793220-41793242 AACAATCTTAAAACAAATGAGGG - Intergenic
1024142148 7:46472418-46472440 TCCAAACTTAAAACAAATTCTGG - Intergenic
1024429422 7:49269156-49269178 TCCATACTTTAAAAAGATGAAGG + Intergenic
1024711572 7:52020803-52020825 TTCAAAATTACAGAAAATGAGGG - Intergenic
1024838438 7:53553789-53553811 TGCAAACATACAAAAAAAGGAGG + Intergenic
1025223937 7:57140349-57140371 TGCAAACTCAAATAAAAGTAAGG + Intergenic
1026080299 7:67212259-67212281 TGCTAAGTTAAAAAAAAAAAAGG - Intronic
1026540756 7:71277912-71277934 TCCAAACTGAAAAGAAATAATGG - Intronic
1026667520 7:72355968-72355990 TGAAGCCTTAAAAAAAATTATGG + Intronic
1026729649 7:72900226-72900248 TTCCCACTTATAAAAAATGAGGG + Intronic
1026744432 7:73000016-73000038 TTCATACTTAAAAAAAAAAAAGG + Intergenic
1027030537 7:74884681-74884703 TTCATACTTAAAAAAAAAAAAGG + Intergenic
1027099305 7:75365076-75365098 TTCATACTTAAAAAAAAAAAAGG - Intergenic
1027114345 7:75466881-75466903 TTCCCACTTATAAAAAATGAGGG - Intronic
1027712607 7:81624544-81624566 TGCAAAATTGGAAATAATGATGG - Intergenic
1027940197 7:84668614-84668636 TGTAATCTTGAAAAATATGAAGG + Intergenic
1028205841 7:88015935-88015957 AGAAAAATTAAAAAAAAAGAAGG - Intronic
1028622466 7:92840006-92840028 GGAAAAATTAAAAAAGATGATGG - Intergenic
1028657408 7:93225452-93225474 TGCAAACTTTAACAAAATATAGG + Intronic
1028678597 7:93497723-93497745 TGGAAACTGAAAAGATATGAAGG - Intronic
1028687576 7:93609243-93609265 TTCAAAATAAAAAAAAATTAGGG - Intronic
1028758415 7:94465145-94465167 GGCAAACTTTAATAAAAAGAAGG + Intergenic
1029605286 7:101595303-101595325 TGCAAGCTTAATGAAAATGCAGG + Intergenic
1029792143 7:102855433-102855455 AGCACACATAAAAAAAATTATGG - Intronic
1029801228 7:102949595-102949617 TGCTTCCTTAAAAAAAATCAAGG + Intronic
1029841078 7:103363847-103363869 TCCTAATTTAAAAAAAATTATGG - Intronic
1030076882 7:105744638-105744660 TGTAATCTTTAAAAACATGAAGG + Intronic
1030894322 7:115038581-115038603 TGAAAGCTTGAAGAAAATGATGG - Intergenic
1030960465 7:115914130-115914152 TGCCATATGAAAAAAAATGAGGG - Intergenic
1031346059 7:120668502-120668524 TGAAAAATCAAAAAAAATAAAGG - Intronic
1031354380 7:120772838-120772860 TGGAAAATTAAAAAAAATAAAGG - Intergenic
1031722292 7:125192237-125192259 TGCAAAATGAACAAAACTGAAGG + Intergenic
1032009452 7:128333848-128333870 TGCAAAATCAAAAAGACTGATGG + Intronic
1032822039 7:135532767-135532789 TCCAAATTTTAAAAAAATGTAGG - Intergenic
1032837712 7:135689343-135689365 TGAACAGTTAAAAAGAATGAAGG + Intronic
1032976013 7:137223351-137223373 TGCTAATTTACAAACAATGATGG + Intergenic
1033638701 7:143238993-143239015 TGAAAACTAAAAAACCATGAGGG + Intergenic
1034286158 7:149884586-149884608 TGTCAACTTAAAAAAAAAAAAGG + Intergenic
1034720093 7:153284180-153284202 ATCAAAGTTAAAAAAAATTAAGG - Intergenic
1034750812 7:153567367-153567389 TGGAAAATTAAAAAATATGTAGG - Intergenic
1035102079 7:156407756-156407778 TTCACACTTAATGAAAATGATGG - Intergenic
1035146565 7:156823577-156823599 TGCAAATCTGAAAAAAATGCAGG + Intronic
1035313930 7:157986681-157986703 TGCTAAATTAGAAATAATGAAGG + Intronic
1035444929 7:158934067-158934089 TCCAACCTTAAGAATAATGATGG - Intronic
1035510868 8:181338-181360 AACAAACTTAAAAAAAATTGTGG - Intergenic
1035976187 8:4314187-4314209 TGCAGTCTTGAAAATAATGAGGG - Intronic
1036146946 8:6262689-6262711 TGCACAGTTAAAAAAAAAAAAGG - Intergenic
1036172451 8:6501928-6501950 AGCAAACTGAAAAAAAAAAAAGG - Exonic
1036416725 8:8556408-8556430 TACAAAATAAAGAAAAATGATGG + Intergenic
1036714900 8:11111886-11111908 TGCAAACCTAAAAAACAAAAAGG + Intronic
1036797153 8:11764555-11764577 TGCCTCCTTAAAAAAAAGGAGGG + Intergenic
1037011394 8:13847124-13847146 TGCATACTTAGAAGAAATGTGGG + Intergenic
1037136502 8:15468934-15468956 TGCTGACTTAAAAATAATGAGGG + Intronic
1037167429 8:15847867-15847889 TCCTAGCTTAAAAAAAATTAAGG - Intergenic
1037193987 8:16165290-16165312 TGCAAACTTAAATATATTAATGG - Intronic
1037269938 8:17115491-17115513 TGGAAAATGAAAAAAATTGATGG + Intronic
1037279774 8:17226087-17226109 TGCAAGCTAAGACAAAATGAAGG + Intergenic
1037576354 8:20207766-20207788 AGCAAAATTAAAAGATATGAAGG + Intronic
1037591981 8:20320599-20320621 TGCAAAGTAAAAAAAAAAAATGG - Intergenic
1038082457 8:24154462-24154484 TGCAAATTTAAAAAATAAGATGG + Intergenic
1038127797 8:24693621-24693643 TGAAAAATTAAAAATGATGATGG + Intergenic
1038257498 8:25963553-25963575 TCAAAAATTAAACAAAATGAGGG + Intronic
1038451771 8:27644066-27644088 AGCAGACTTAAAAAAAAAAAAGG + Intronic
1038470942 8:27819745-27819767 GTCAAACATAATAAAAATGAGGG - Intronic
1038614845 8:29083867-29083889 TGAAAGTTTAAGAAAAATGAAGG + Intronic
1038878078 8:31574278-31574300 TGTACACTTAAAAATAATTAAGG + Intergenic
1039021601 8:33213457-33213479 ATCAAACTTAAATAAATTGATGG + Intergenic
1039156424 8:34563918-34563940 TGCAATCTTAAAAAAATAGTAGG + Intergenic
1039222566 8:35350689-35350711 TTGAGACTTAAAAAAAAGGATGG - Intronic
1039340983 8:36649684-36649706 TTCAAACTTAAAAAAAAATCAGG + Intergenic
1039561869 8:38518890-38518912 TGTAAATTTAAAATAAATTATGG - Intronic
1039874862 8:41577116-41577138 TGAAAATTAAAAAAAAATGGTGG - Intergenic
1039918868 8:41879083-41879105 TGAAAAATTAAAAAAAATGCAGG + Intronic
1040068482 8:43169156-43169178 TCCAAACTGAAAATAAATAAAGG - Exonic
1041197536 8:55416068-55416090 TACAAACTTAAAAATTATGGCGG - Intronic
1041262680 8:56035550-56035572 TCTCAATTTAAAAAAAATGAAGG + Intergenic
1041925045 8:63228037-63228059 TGCAAAATGAGACAAAATGAAGG + Intergenic
1042030446 8:64470316-64470338 TTCAAATGGAAAAAAAATGAAGG + Intergenic
1042151684 8:65793355-65793377 TACAAAATTAAAAAAATTAAAGG + Intronic
1042176061 8:66037812-66037834 AGAAAACTTCAACAAAATGAGGG + Intronic
1042319878 8:67463526-67463548 TCCAAATTTAAAATAAATGTTGG - Intronic
1042572772 8:70184774-70184796 TGCAAGCTTCATAGAAATGAGGG - Intronic
1042817736 8:72896013-72896035 TGGAAACTTGAAAAAAATAAAGG - Intronic
1042896240 8:73671630-73671652 AGCAATCTTAACAAAAAAGAGGG + Intronic
1043541968 8:81274303-81274325 TGAAAATTTTAAAAAATTGAAGG - Intergenic
1043767735 8:84158571-84158593 AGCAAAATTAAAAAGTATGAAGG + Intergenic
1044167456 8:89004433-89004455 TGAAAACCTAAGAAAAATCAAGG + Intergenic
1044268051 8:90206328-90206350 AGCAAATTTAAAGAGAATGACGG - Intergenic
1044362891 8:91309456-91309478 TGCTAACTTAAACAAATGGATGG - Intronic
1044468656 8:92538989-92539011 TACAAAATAAAAGAAAATGAGGG + Intergenic
1044831106 8:96250405-96250427 TGAAAACATAAAAATAATAATGG + Intronic
1044846538 8:96387468-96387490 GCCAAACTTAAAAAAAAAAACGG + Intergenic
1044907002 8:97015138-97015160 TACAATTTTAAAGAAAATGATGG - Intronic
1045134375 8:99198029-99198051 TACACACTTTGAAAAAATGAGGG + Intronic
1045347445 8:101305755-101305777 TGCGAAGTTAAAAAAAAGGTTGG - Intergenic
1045478598 8:102574972-102574994 TACAAAGTTAAAAAAAAAAAAGG + Intergenic
1046540652 8:115577600-115577622 TGCAAACATAGAATAAATAATGG - Intronic
1046824879 8:118677407-118677429 TGCAAATTTTAAAAAAATCAGGG + Intergenic
1047311397 8:123695516-123695538 TGGAAACCTAAAAAAAATCCTGG - Exonic
1047577784 8:126177065-126177087 ATCAAATTTAAAAAAAATAAAGG + Intergenic
1047846921 8:128816201-128816223 TGCAAAAAAAAAAAAAATGCTGG - Intergenic
1047975191 8:130122905-130122927 TGCAAACATTTAAAAAATGCTGG + Intronic
1048235062 8:132681908-132681930 AGGAAACTGAAAAACAATGAGGG - Intergenic
1048457788 8:134593441-134593463 AGCAAACTTAAAAAGAGTGGTGG + Intronic
1048567754 8:135621119-135621141 TGCAGCCTTAAAAAAAAGGGGGG + Intronic
1048684149 8:136883278-136883300 TCCAAATTTAAAATAAAAGATGG - Intergenic
1049330620 8:142048542-142048564 TGTAAACTTATAAGAAATTAGGG + Intergenic
1049559301 8:143300490-143300512 AGGAAACTCAAAAATAATGATGG + Intergenic
1049812963 8:144584006-144584028 TGCAAACTTAATGACAAGGAAGG + Intronic
1050577522 9:7012982-7013004 TGCCACATTAAAAAACATGAAGG - Intronic
1051228885 9:14932903-14932925 TGGAAACTAAGAAACAATGAAGG + Intergenic
1051495729 9:17720711-17720733 AGGAAACGTAAGAAAAATGAAGG + Intronic
1051505216 9:17819354-17819376 TGAAATCTTAAAAAAAATTCTGG + Intergenic
1052095617 9:24380495-24380517 TTCAAACTTAAAACAAAGGTTGG - Intergenic
1052490715 9:29163553-29163575 GGAAAGCTTCAAAAAAATGATGG + Intergenic
1052496774 9:29236660-29236682 AGCAAAATTAAATAAAATGAGGG + Intergenic
1052497098 9:29240801-29240823 TACCAACTTAAAAATAATCAAGG - Intergenic
1053315581 9:37048371-37048393 TGCAAACTAAATAAAAATCTGGG - Intergenic
1053320504 9:37094137-37094159 TGCAAACTAAATAAAAATCTGGG - Intergenic
1053637675 9:40029658-40029680 TGCATACTTATAATAATTGAAGG + Intergenic
1053768406 9:41435563-41435585 TGCATACTTATAATAATTGAAGG - Intergenic
1054547075 9:66347061-66347083 TGCATACTTATAATAATTGAAGG - Intergenic
1054827717 9:69589873-69589895 TGCAATTTTAAGAGAAATGATGG + Intronic
1055285878 9:74727412-74727434 TGTAAACTTATAACAAACGAAGG - Intronic
1055705325 9:78994111-78994133 AGCAAATTAAAAAAAACTGATGG - Intergenic
1055805518 9:80088752-80088774 TGCAAACATAAAAAAAAGACAGG - Intergenic
1056526732 9:87450167-87450189 TAATAACTTAAGAAAAATGAGGG - Intergenic
1056882467 9:90409782-90409804 TGCAAACTTTATAAGAATGCTGG + Intergenic
1057109508 9:92454199-92454221 TGCAAACTTAAAACCAAAAATGG + Intronic
1057456443 9:95217005-95217027 TGTAAACTTCAAAATAATGTTGG - Intronic
1057603411 9:96479863-96479885 TTCCAATTTAAAAAAAATGCTGG + Intronic
1057625446 9:96672317-96672339 ACAAAACTTAAAAAAAATTATGG + Intergenic
1057681227 9:97187615-97187637 TGCAAGCTTATAAAAAAAAATGG - Intergenic
1058183768 9:101829657-101829679 TGAAAATTTAAAAAAAACAAAGG - Intergenic
1058284587 9:103160945-103160967 TGCAATCTCAAAAATGATGATGG - Intergenic
1058305183 9:103432497-103432519 TGCAAGCATAAAAAAAATCAAGG - Intergenic
1060113563 9:120923952-120923974 TGCAAACTACCAAAAAATGTGGG - Intronic
1060582888 9:124768394-124768416 GGCAAACTTAAAAAAATTTTTGG + Intronic
1060618474 9:125041234-125041256 TGAAAACTTACAATAAATGTGGG - Intronic
1060785021 9:126444711-126444733 TTAAATGTTAAAAAAAATGAAGG - Intronic
1061057201 9:128230235-128230257 TTAAAAATTAAAAAAAAAGATGG + Intronic
1061696235 9:132376103-132376125 GGAAAAGTTAGAAAAAATGATGG - Exonic
1061703644 9:132435495-132435517 TTCAAACTAAATAAAAGTGAAGG + Intronic
1062336166 9:136069651-136069673 TGCAAACATAAAAGAAAGCAAGG + Intronic
1062757053 9:138305278-138305300 AACAAACTTAAAAAAAATTGTGG + Intergenic
1185793736 X:2947275-2947297 TGCAAAGTTAAAAGAACTGTAGG + Intronic
1186263113 X:7802165-7802187 GAGAAACTTTAAAAAAATGAAGG + Intergenic
1186522400 X:10217742-10217764 TGAAAAAAAAAAAAAAATGAAGG - Intronic
1187037968 X:15562298-15562320 TGTTTACTTAAAAAAAGTGATGG - Intronic
1187124879 X:16445695-16445717 TGCATCCTTAAAACAAATGAGGG - Intergenic
1187215437 X:17271437-17271459 TGCAAAAAAAAAAAAAATGCGGG - Intergenic
1187357817 X:18594369-18594391 TGCATTTTTAAATAAAATGAGGG - Intronic
1187541578 X:20201578-20201600 AATAAACTTAAAAAGAATGAAGG - Intronic
1187557678 X:20367588-20367610 TGCAAACATAAAAGAAAAAATGG + Intergenic
1187722378 X:22164767-22164789 TGCAAAATTAAATACAATGCCGG + Intronic
1187993290 X:24898799-24898821 TCCAGATTTAAAAAAAATGGGGG - Intronic
1188163284 X:26829061-26829083 TGCAAAGTCACACAAAATGAGGG + Intergenic
1188295544 X:28443485-28443507 TTCAAAGTAAAAAAAATTGAAGG + Intergenic
1188461477 X:30432267-30432289 TGTCAACTTTAAAAAAATTAAGG + Intergenic
1189073730 X:37892421-37892443 TTCAAACTTATAGCAAATGAAGG - Intronic
1190033192 X:46994527-46994549 TGCTAAATTAAAGATAATGAAGG - Intronic
1191163512 X:57361940-57361962 TGCTATCTTCAAAATAATGAAGG - Intronic
1191686200 X:63893488-63893510 GTCAAACTTTTAAAAAATGAAGG + Intergenic
1191743345 X:64459594-64459616 TGCAAAAGAAAAAAAAATAAAGG - Intergenic
1192001919 X:67160178-67160200 AGGAAACTAAAAAAAAATCAAGG + Intergenic
1192126681 X:68507514-68507536 TGCAAACCAAAAGAAAATGGAGG - Intronic
1192594306 X:72390017-72390039 TTAAAAATTAAAAAAAATTAAGG - Intronic
1193136832 X:77981060-77981082 TGCTAATTTAAAAAAAAGCAAGG - Intronic
1193514090 X:82441791-82441813 TGTAAACTTAAAATAAAAGTTGG + Intergenic
1193556195 X:82956536-82956558 AGAAAACTAAAAATAAATGAAGG + Intergenic
1193884178 X:86964104-86964126 TGCAAACTGGAAAAAAATTTGGG + Intergenic
1194189084 X:90812386-90812408 CGGAAACTAAAAAAAAAAGATGG + Intergenic
1194238722 X:91417286-91417308 TACAAAGATAGAAAAAATGATGG + Intergenic
1194671213 X:96734847-96734869 TGCACACTAAAAAAAAAATAGGG - Intronic
1194675061 X:96784582-96784604 TGCAGTTTGAAAAAAAATGAAGG + Intronic
1194941692 X:100017712-100017734 TGCTAATTTCAAATAAATGATGG + Intergenic
1195151926 X:102080517-102080539 TGGAAAATTAAAAAAAAAGAGGG + Intergenic
1195507677 X:105677005-105677027 TGGAAACTTTAAAAAATTGGAGG - Intronic
1195786908 X:108535207-108535229 TTCTAACTTAAAAATAATAAAGG - Intronic
1196075529 X:111571688-111571710 AGTAAACTTCAAAAAAAAGAAGG + Intergenic
1196475781 X:116083745-116083767 CACAAAATTAGAAAAAATGATGG + Intergenic
1197488718 X:127088871-127088893 TGCAAACTTAATAGCTATGAAGG - Intergenic
1197532423 X:127645971-127645993 TGCAAACTGCAAAACAATGATGG + Intergenic
1197556601 X:127963378-127963400 TACAAACTTTAAAGAAACGATGG - Intergenic
1197736910 X:129857469-129857491 TGCAAAACAAAAAAAAAGGAGGG - Intergenic
1198193854 X:134340071-134340093 TGCTGACTGAAAAAAAATGACGG - Intergenic
1198214129 X:134541721-134541743 TATCAACTTAAAAAAAATCAGGG - Intergenic
1198293931 X:135265720-135265742 TTCAATCTGAAAGAAAATGATGG + Intronic
1200354748 X:155536515-155536537 TACCAACTTAACTAAAATGAGGG - Intronic
1200885585 Y:8265511-8265533 TTAAAACTTAAAAAAATTAAAGG + Intergenic
1200917468 Y:8583958-8583980 TGGGAAATTCAAAAAAATGAAGG - Intergenic
1201383228 Y:13409473-13409495 TGTAAACTTTAAAACAATTAAGG + Intronic
1201498788 Y:14618927-14618949 TGCTAAATTTCAAAAAATGAAGG + Intronic
1201938606 Y:19434479-19434501 AGAAAAATTAAAAAAAGTGAGGG + Intergenic