ID: 1000000859

View in Genome Browser
Species Human (GRCh38)
Location 5:157137362-157137384
Sequence GACCTACACCCAGAAGTTTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 133
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 123}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000000859 Original CRISPR GACCTACACCCAGAAGTTTC TGG Intronic
903937929 1:26909653-26909675 GACCCAAATCCAGAAGATTCAGG - Intronic
905243479 1:36596463-36596485 GACCTATTGCCAGAATTTTCTGG + Intergenic
905779995 1:40700423-40700445 GACTTGAACCCAGAAGTTTGAGG - Intronic
906262106 1:44401323-44401345 GACCTATCCCCAAAAGTATCAGG + Intergenic
912390332 1:109298198-109298220 GACCTACATCCGGAAGGTTGGGG - Exonic
917611439 1:176692704-176692726 CACCCACACCCAGAAGTGCCTGG - Intronic
923194817 1:231655025-231655047 GCTTTACACTCAGAAGTTTCTGG + Intronic
1068156856 10:53210477-53210499 GAGCTACCCTCAGAAGATTCAGG - Intergenic
1069265776 10:66455569-66455591 CAGCAACACCCAGAAGTTACTGG + Intronic
1069790384 10:71015787-71015809 GACCTACAGCTGGAAGTTTCAGG + Intergenic
1073271512 10:102268516-102268538 GGCATATACTCAGAAGTTTCAGG - Intronic
1073446313 10:103582543-103582565 GGCCCACACCCAGAGCTTTCTGG + Intronic
1075110638 10:119578545-119578567 CACTTATACCCAGGAGTTTCAGG + Intronic
1077029447 11:457682-457704 GACTTACATGCAGATGTTTCAGG - Intronic
1077737613 11:4807886-4807908 CACCTAAACCCAGAAGTTCAAGG - Intronic
1079374962 11:19883831-19883853 AACCTATACCCAGATGTTGCTGG - Intronic
1081761995 11:45583134-45583156 GACCTACACTCAGAAGTTATAGG - Intergenic
1082928615 11:58577741-58577763 GACCTACACCGAGAAGCTGAAGG - Intronic
1084121313 11:67070640-67070662 GACCTACACCCTGAGCGTTCTGG - Intronic
1086126232 11:83351303-83351325 GGCCTACAGCCTGAACTTTCGGG + Intergenic
1086537942 11:87871417-87871439 GAACTTGACCCAGAAGTTTGTGG + Intergenic
1088598120 11:111454977-111454999 GGGCTTCACCCAGAAGTTTAAGG - Exonic
1091524906 12:1289917-1289939 GTCCTCCACCCAGCAGTCTCTGG + Exonic
1092508291 12:9126755-9126777 GAACTATGCACAGAAGTTTCAGG - Intergenic
1093192811 12:16094426-16094448 GACCAGCACACAGAATTTTCTGG + Intergenic
1096336242 12:50758877-50758899 GACCAACATCAAGAAGGTTCTGG + Intergenic
1097064481 12:56310855-56310877 GACCTAATACCAGAGGTTTCTGG + Intronic
1097761966 12:63476428-63476450 GACTTAAACCCAGGAGTTTGAGG + Intergenic
1103072186 12:117954004-117954026 CACCTGAACCCAGAAGTTTAAGG + Intronic
1104574214 12:129952020-129952042 CACCAACACTCTGAAGTTTCTGG - Intergenic
1106470158 13:30046986-30047008 GACCTAGTCCCAGGAGTTGCTGG - Intergenic
1119851506 14:77869762-77869784 GACCCACAGACAGAAGTTGCTGG - Intronic
1121009815 14:90513294-90513316 CACCTCCACCCAGAATTTTCTGG - Intergenic
1121219381 14:92274505-92274527 GACCCACACCCAAAAGTAGCAGG - Intergenic
1122832146 14:104403723-104403745 GTCCTGCATTCAGAAGTTTCTGG + Intergenic
1123463431 15:20495137-20495159 CACCTGCACCCAGGAGTTTGAGG + Intergenic
1123654629 15:22505277-22505299 CACCTGCACCCAGGAGTTTGAGG - Intergenic
1124274274 15:28312545-28312567 CACCTGCACCCAGGAGTTTGAGG + Intronic
1124308540 15:28600476-28600498 CACCTGCACCCAGGAGTTTGAGG - Intergenic
1127541860 15:59947270-59947292 GCCCTTAACCCAGAAGATTCTGG + Intergenic
1129203223 15:74018565-74018587 TGCCTACACCCAGGAGTTCCAGG - Intronic
1129395419 15:75242338-75242360 CACCTAAGCCCAGAAGTTTGAGG + Intergenic
1132559547 16:587156-587178 GACCTCCACCCAGAAGTTTGGGG - Intergenic
1134363956 16:13559459-13559481 GACCTAAGCCCAGGAGTTTGAGG - Intergenic
1134619828 16:15679212-15679234 CACTTGCTCCCAGAAGTTTCAGG - Intronic
1136362611 16:29790647-29790669 GACCCACACGCAGCAGCTTCCGG + Intergenic
1138827349 16:60336398-60336420 GTATTACACACAGAAGTTTCAGG - Intergenic
1144742320 17:17590946-17590968 GACCACCACCCAGCCGTTTCGGG - Intronic
1146582459 17:34051075-34051097 AACCTACACCCAAGAGTTGCAGG - Intronic
1146684515 17:34832337-34832359 AACCTCCACAGAGAAGTTTCTGG - Intergenic
1148354005 17:46962825-46962847 TAACTACTCCCAGAAATTTCTGG - Intronic
1151244135 17:72781297-72781319 GAACTCCTCCCAGAACTTTCAGG + Intronic
1153020542 18:624870-624892 GAACTTCATTCAGAAGTTTCAGG - Exonic
1154207568 18:12350725-12350747 CACTTACAGCCAGGAGTTTCGGG + Intronic
1156015674 18:32544472-32544494 GACTCACACCCAGTATTTTCTGG - Intergenic
1157488269 18:48104926-48104948 GGCCCACACCCAGCTGTTTCAGG + Intronic
1158883181 18:61800522-61800544 GATCTAAACCTAGCAGTTTCTGG - Intergenic
1168656162 19:58129996-58130018 GACTTAGACCCAGAACTTTTAGG - Intronic
931984937 2:67732616-67732638 TGCCTACACCCAGAAGTCTACGG + Intergenic
933785264 2:85835339-85835361 GACCTACTACTCGAAGTTTCAGG + Intergenic
934634735 2:95973965-95973987 CACCTGAACCCAGAAGTTTGAGG + Intronic
934798899 2:97131271-97131293 CACCTGAACCCAGAAGTTTGAGG - Intronic
934834538 2:97572196-97572218 CACCTGAACCCAGAAGTTTGAGG + Intronic
943589984 2:189784819-189784841 GTCCTCCACCCAGAAGGGTCTGG - Intronic
943989071 2:194662490-194662512 TACCTACAACCGTAAGTTTCTGG + Intergenic
1172159964 20:32860820-32860842 TACCTGCATCCAGAAGTTTGAGG - Intronic
1174513640 20:51074911-51074933 CTCCTACACCCAGAGGCTTCTGG + Intergenic
1174668926 20:52287648-52287670 GACCTACACTAATAAGTTTTAGG + Intergenic
1179301853 21:40118872-40118894 AACCCATACCCAGAAGTTCCAGG - Intronic
1180884235 22:19228826-19228848 TACCTGCTCCCACAAGTTTCAGG + Intronic
1182377644 22:29859358-29859380 CACCTGAACCCAGAAGTTTGAGG + Intergenic
953038800 3:39236884-39236906 GAGCGACACCCAGAAGTGTGAGG + Intergenic
957221396 3:77387462-77387484 GACCTACACCCTGGATTTTCAGG + Intronic
961104657 3:124230722-124230744 TCCCTAAGCCCAGAAGTTTCTGG - Intronic
963731070 3:148973150-148973172 CACCTTCACCTTGAAGTTTCAGG - Intergenic
964003329 3:151803120-151803142 GTCATACACCCAGAAGTATAGGG + Intergenic
964780336 3:160330229-160330251 GACCTACCCCCAGGAGATTCTGG - Intronic
974106809 4:57478855-57478877 GACCTACACTCAGGAGTGGCTGG - Intergenic
979619354 4:122781295-122781317 GACCAAAACACAGAAGTTTCAGG - Intergenic
982073180 4:151713645-151713667 AACCTACAGCTAGAAGTTGCAGG + Intronic
983120231 4:163874267-163874289 GAAGTACACTCAGAAGTTTAAGG + Intronic
983161045 4:164414649-164414671 GACATATACCCAGTAATTTCTGG + Intergenic
990234005 5:53746507-53746529 CACAAACACCCAGAATTTTCTGG - Intergenic
995284834 5:110376284-110376306 GACCTATACCCATCATTTTCTGG + Intronic
996458601 5:123714351-123714373 AACCTGCACCCAGATGTTTGTGG - Intergenic
998025495 5:138812135-138812157 GACCTACATTCAGAATTTTTGGG + Intronic
998962974 5:147508935-147508957 GCTCCACACCCAAAAGTTTCAGG + Intronic
1000000859 5:157137362-157137384 GACCTACACCCAGAAGTTTCTGG + Intronic
1001300626 5:170531094-170531116 TACCTAAACCCACAAGCTTCAGG - Intronic
1001457831 5:171879408-171879430 AACCTGCACCCAGATGTTTATGG - Intronic
1002329251 5:178430127-178430149 CAGTTCCACCCAGAAGTTTCTGG - Intronic
1004111108 6:12720004-12720026 TCCATACACCCAGAAGTTTGAGG - Intronic
1004463713 6:15863152-15863174 AACCTACACACAGAAGTGTGAGG - Intergenic
1005230537 6:23696988-23697010 AACCTATAAACAGAAGTTTCTGG - Intergenic
1008497495 6:52147573-52147595 GTCCTACTTCCAGATGTTTCGGG + Intergenic
1009890934 6:69681044-69681066 GAACAACAGTCAGAAGTTTCTGG - Intronic
1011819883 6:91240072-91240094 TACCTAAACACAAAAGTTTCTGG - Intergenic
1016652810 6:146482790-146482812 CACCTGAACCCAGGAGTTTCAGG - Intergenic
1018304891 6:162444606-162444628 GACCTCCCCCAAGAAGCTTCTGG + Intronic
1019164402 6:170088521-170088543 GAGCCACACCGAGAGGTTTCTGG + Intergenic
1022514783 7:30968689-30968711 GACCTGCTCACAGTAGTTTCAGG - Intronic
1023413826 7:39913916-39913938 TACCTAAGCCCAGAAGTTTGGGG - Intergenic
1023606309 7:41934367-41934389 AACCTACACCCCTAAGTTTCTGG + Intergenic
1024582302 7:50809905-50809927 GACTTACAAAGAGAAGTTTCAGG + Intergenic
1024826871 7:53400513-53400535 GGTCTACACCCAGATGCTTCAGG - Intergenic
1025867265 7:65395271-65395293 GACTTAAAGCCAGAAGTTTGAGG - Intronic
1027126773 7:75562210-75562232 GACCCACACACAGAATTCTCTGG - Intronic
1028500594 7:91514990-91515012 GAACAACACCTTGAAGTTTCAGG - Intergenic
1032749347 7:134822046-134822068 GACTTACCCCTATAAGTTTCTGG - Intronic
1033115219 7:138619187-138619209 GGCCTAAACCCAGAAGTTGGAGG + Intronic
1033733501 7:144200466-144200488 CACCTAAACCCAGGAGTTTGAGG - Intergenic
1033749549 7:144350507-144350529 CACCTAAACCCAGGAGTTTGAGG + Intergenic
1036764396 8:11538317-11538339 GGGCTGCACCCAGCAGTTTCAGG - Intronic
1037111367 8:15167814-15167836 GATCTACAGCCAGAGGTTGCTGG - Intronic
1039426307 8:37489273-37489295 CACCTACACTGAGATGTTTCAGG + Intergenic
1043877021 8:85497009-85497031 GACCAATACCCAGAAGAATCAGG - Intergenic
1044163092 8:88945428-88945450 GAACTAAACCAAGAGGTTTCTGG - Intergenic
1046389470 8:113550739-113550761 GACCTTCACTCAGAACTCTCTGG + Intergenic
1048547555 8:135401862-135401884 GACACACACACAGAAGTTTATGG + Intergenic
1051393567 9:16593232-16593254 AACATATGCCCAGAAGTTTCTGG - Intronic
1051470409 9:17433709-17433731 GACACACACCCAGCAGTTTGAGG - Intronic
1051812181 9:21061884-21061906 ATCCTACACCCAGAATTTCCTGG - Intergenic
1052112684 9:24607965-24607987 GAGCTTCACCCAGTAGTGTCAGG + Intergenic
1052406113 9:28063480-28063502 CACCTGCACCCAGGAGTTTGAGG - Intronic
1052540249 9:29802398-29802420 GATCTACACCTAGAACTTCCTGG + Intergenic
1053199774 9:36144525-36144547 GAGCTACAACCTGAAGTATCGGG - Intronic
1056526866 9:87451557-87451579 AACCTACCCCCAGAAGTCCCCGG + Intergenic
1060044059 9:120326069-120326091 ATCCTACACCCAGAAGGCTCAGG - Intergenic
1061612722 9:131758798-131758820 GAGTTACAACCAGAACTTTCTGG - Intergenic
1187366827 X:18672656-18672678 GAACTACAACCAGAAGTCTCAGG + Intergenic
1196592526 X:117503885-117503907 CACTTAAACCCAGAAGTTTGAGG + Intergenic
1197024785 X:121736205-121736227 GACCTACTCACAGAGGCTTCAGG + Intergenic
1202015266 Y:20399354-20399376 GAGCTACAGCCAGAAATTGCTGG + Intergenic