ID: 1000003488

View in Genome Browser
Species Human (GRCh38)
Location 5:157162434-157162456
Sequence ATCCATTTAAAGAGGAGCCA GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 219
Summary {0: 1, 1: 0, 2: 2, 3: 19, 4: 197}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000003488_1000003492 11 Left 1000003488 5:157162434-157162456 CCCTGGCTCCTCTTTAAATGGAT 0: 1
1: 0
2: 2
3: 19
4: 197
Right 1000003492 5:157162468-157162490 GACGATCATCTCCGTCTTCTCGG 0: 1
1: 0
2: 0
3: 2
4: 75

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000003488 Original CRISPR ATCCATTTAAAGAGGAGCCA GGG (reversed) Exonic
900924589 1:5696152-5696174 CTCCAATTAAAAAGGAACCAAGG + Intergenic
904533655 1:31185011-31185033 GTCCATGTGAAGATGAGCCAGGG - Intronic
906022066 1:42638535-42638557 ATCCATTTTAATAGCACCCATGG + Intronic
906255095 1:44342583-44342605 CTCTATTTAAGGAAGAGCCAGGG + Intronic
906948343 1:50314793-50314815 CCCCCTTTAAAGAGGAGGCAAGG - Intergenic
910199602 1:84685338-84685360 ATCCATTTGCAAAGGATCCATGG + Intronic
911405670 1:97435259-97435281 ATCCATTTTAATAGGAGGCAGGG - Intronic
912179631 1:107204287-107204309 ATCAAATTAAAGAAGAGACAGGG - Intronic
914350572 1:146836178-146836200 AGCCTCTTAAAGAGGAGCAAGGG - Intergenic
914889122 1:151607252-151607274 ATCCAGTGAAAGAGGAGCCAGGG - Intergenic
915554612 1:156654467-156654489 TTCCATTGAAACAGCAGCCAAGG - Intronic
916329226 1:163595751-163595773 ATCCAATTAGAGAGTATCCAAGG - Intergenic
918894235 1:190319256-190319278 AACCATGTAAAGAGGAGAAAGGG - Intronic
921343088 1:214153931-214153953 ATCCATCTGCAGGGGAGCCATGG - Intergenic
921553216 1:216564862-216564884 ATTCCTTTAAAGAAGAGCAAAGG + Intronic
922226259 1:223648394-223648416 ATCCTTTTAATGAGCAGTCAGGG - Intronic
923390595 1:233511325-233511347 TTCCACTTAAAGGGCAGCCAGGG + Intergenic
924579018 1:245307374-245307396 ATTCATTAGCAGAGGAGCCAAGG - Intronic
1064450200 10:15435201-15435223 ATCCATTTAAAGAGGGCTCGAGG + Intergenic
1064814717 10:19246563-19246585 ATCCTCTTAAATAGGAGCCTGGG + Intronic
1065208202 10:23376896-23376918 AAGCATTTAAAGAGCAGCCATGG + Intergenic
1068880331 10:62042303-62042325 CTCCATTGAGAGAGGAGCCTGGG + Intronic
1071471823 10:85988901-85988923 ATCCCTAGAAAGAGGAGGCAGGG + Intronic
1071615077 10:87067742-87067764 TTCCATTTAAAGAGGAACTAAGG - Intronic
1073084067 10:100877136-100877158 CTCCAATAAAAGAGGACCCAGGG + Intergenic
1073967453 10:109007732-109007754 AGCCATGTAAAGAGGAGGCAGGG - Intergenic
1076224887 10:128766066-128766088 ATCCATATAAAATGGAACCAGGG + Intergenic
1076298174 10:129403446-129403468 ATCCATTTAACAAGGCTCCATGG + Intergenic
1078234870 11:9475196-9475218 ATCATTTAAAAAAGGAGCCAAGG - Intronic
1080339482 11:31244172-31244194 GTCCATTTAAAAAGGAGCCTCGG + Intronic
1081635198 11:44716610-44716632 ATCCCGTTATAGAGGAGCCAGGG - Intergenic
1081636361 11:44725103-44725125 ATACATTTAAAGAGGAAAAACGG - Intergenic
1082996037 11:59256305-59256327 ATCCTTTTAAAGATGAGAGAAGG + Intergenic
1085570591 11:77554897-77554919 ATCCAATTAGAGAGTACCCAAGG - Intronic
1086906495 11:92424017-92424039 AACCATTTAAAGAGGACAAATGG + Intronic
1089085717 11:115815341-115815363 AGCCATTTAAGGAGGAGACCTGG - Intergenic
1089745759 11:120615744-120615766 ACCCAGTTAAAGAGGATCCTGGG - Intronic
1089933311 11:122336565-122336587 GTCCTTTTATAGAGAAGCCACGG - Intergenic
1090061941 11:123471847-123471869 ATACATTTGGAGAGGGGCCAAGG + Intergenic
1094236127 12:28168775-28168797 CTCAATTTAAAAATGAGCCAGGG + Intronic
1094351977 12:29536962-29536984 TTCCTTTTAAAGAGGACTCAAGG + Intronic
1094476610 12:30845468-30845490 ATCCATTTTTCGGGGAGCCAGGG + Intergenic
1095865518 12:46967449-46967471 ATTCTTTTAGAGAGGGGCCAGGG - Intergenic
1097376206 12:58846055-58846077 ATCCATCTAAGGGGGAGACAGGG + Intergenic
1100153059 12:91764715-91764737 ATCCATTTAAAGGTGAGACATGG + Intergenic
1100640570 12:96478587-96478609 ATGAATTTAAAGAAGAGGCAGGG - Intergenic
1105613664 13:21992260-21992282 TTACAGTTACAGAGGAGCCATGG - Intergenic
1105953597 13:25257226-25257248 ATCCAATAAAAGAGAACCCAGGG + Exonic
1106144860 13:27041314-27041336 ATGCATTTCAGGAAGAGCCAGGG - Intergenic
1107028037 13:35823578-35823600 ATATATTTAAAAAGGAGCAAAGG - Intronic
1110494063 13:76145371-76145393 CTTCAGATAAAGAGGAGCCAGGG - Intergenic
1110673133 13:78206061-78206083 ATTCATATAAAGAGGAGTCCAGG + Intergenic
1112678712 13:101736636-101736658 ATCCAATTAAAGGAGAGCTAAGG + Intronic
1114452948 14:22838361-22838383 ACCCAATTAAAACGGAGCCAGGG - Intronic
1115773820 14:36693850-36693872 ATTCATTTAAAGACCAGCCTAGG - Intronic
1118467063 14:66040586-66040608 ATCAATGAAAAGAGGAGACAAGG - Intergenic
1122785792 14:104162783-104162805 ATCCATTTCCAGAGGAGGAAAGG + Intronic
1125586809 15:40826498-40826520 ATTCAGTTGAGGAGGAGCCAGGG + Intronic
1127063062 15:55207294-55207316 ATACATCTAAAGCAGAGCCAAGG + Intronic
1127519728 15:59731662-59731684 ATTCATTTAAAAAGGAGAAAAGG - Intergenic
1128752564 15:70159631-70159653 AAGCATTTCATGAGGAGCCACGG - Intergenic
1129520858 15:76185322-76185344 AGCCATTAAAAAAGGAGACAGGG - Intronic
1130316216 15:82799364-82799386 CTGCATATAAAGAGCAGCCAAGG - Intronic
1135955556 16:26953829-26953851 GTCCATTTAAAGAGCAGCCTGGG + Intergenic
1137033277 16:35544351-35544373 ATCAATTTAAAGTGTAACCAGGG + Intergenic
1138604480 16:58079597-58079619 ATACATTTAAAAAGTAGTCATGG + Intergenic
1139176277 16:64692219-64692241 ATGCATTTAAAGAAGGGCCATGG - Intergenic
1139983465 16:70879361-70879383 AGCCTCTTAAAGAGGAGCAAGGG + Exonic
1143076030 17:4344085-4344107 ATTTATTGAAGGAGGAGCCAAGG + Intronic
1150392722 17:64799413-64799435 ATACATTTAAAGGGGACACACGG - Intergenic
1150668140 17:67164426-67164448 AATCACTTAAAGAGGAGGCAAGG + Intronic
1150860527 17:68796336-68796358 ATCCAATTAAAGAGTGTCCAAGG + Intergenic
1150878380 17:68995280-68995302 ATCCATTTGAGATGGAGCCAGGG - Intronic
1153657330 18:7294718-7294740 ATCCAATTAAAAATGAGCAAAGG - Intergenic
1155698637 18:28715542-28715564 ATGCATTTAAAGAGCAGTCCTGG + Intergenic
1155874777 18:31072834-31072856 GTCCATCTTAAGAGAAGCCATGG + Intronic
1156135224 18:34029490-34029512 AGCCATTCAATCAGGAGCCAAGG - Intronic
1156237895 18:35221745-35221767 ATCCAATTAGAGAGTACCCAAGG - Intergenic
1156687814 18:39670943-39670965 ATCCATTTGAAATGGAGCCCTGG + Intergenic
1158099898 18:53819142-53819164 AGCCACTTAAAGAGGTGGCAGGG + Intergenic
1158760185 18:60375634-60375656 ATCCAATTAAAAATGAGCAAAGG - Intergenic
1162327938 19:10009695-10009717 AGCCATTTAAAGAGACGCAAAGG + Intronic
1163424011 19:17231047-17231069 ATCTAATTAAAGCAGAGCCAAGG - Intergenic
1163944028 19:20519578-20519600 ATCCAATTAGAGAGGGTCCAAGG + Intergenic
1165211634 19:34240800-34240822 ATCCATTTATAGTAGAGACAGGG + Intergenic
925449801 2:3959256-3959278 AGCCTTTGAAAGAGGATCCAAGG + Intergenic
927134568 2:20087322-20087344 ATCCAATTAAAGAGTGCCCAAGG - Intergenic
927310887 2:21629971-21629993 GTCCCTTTAAAGTGGATCCAGGG + Intergenic
928434954 2:31248910-31248932 GCTCATTTGAAGAGGAGCCAGGG + Intronic
932760300 2:74435216-74435238 ATTCATTTAGAAAGGAGCCCTGG + Intronic
933278645 2:80308420-80308442 TTCCTTTTAAAGAAAAGCCATGG - Intronic
935062345 2:99619701-99619723 ATCCACCTAAAGACAAGCCAAGG - Intronic
935228398 2:101074969-101074991 AATCATTAAAAAAGGAGCCATGG + Intronic
935798216 2:106666183-106666205 ATCAATTTAAACATGAGCCAAGG - Intergenic
938881672 2:135595924-135595946 ACACATTTTAAGAGAAGCCAGGG - Intronic
940007165 2:149018519-149018541 ATCCTTTTTAAGAGGAGAAAAGG - Intronic
940085934 2:149858893-149858915 ATGCATTTAAAGAAGAGCATTGG - Intergenic
940371420 2:152905264-152905286 TGCCATTTAAAAAGGACCCACGG - Intergenic
940541554 2:155026492-155026514 AGCCAAATAAAGGGGAGCCATGG + Intergenic
941629977 2:167873437-167873459 AACTATTTACAGAGGAGCCAAGG + Exonic
942624376 2:177883873-177883895 ATCCATGTGAAGAGAAGCCATGG + Intronic
943857915 2:192822593-192822615 TTCCATTTAAAGAAAAGCCCAGG + Intergenic
944410016 2:199431013-199431035 ATCCATTTAAAGCAGAGAAATGG - Intronic
944557756 2:200904879-200904901 ATCCATAGAAATAGGATCCAGGG - Intergenic
945015071 2:205506736-205506758 ATGCTTTTAAGGAGGAGACAAGG - Intronic
946696264 2:222362869-222362891 TTCCTTTTATAGAGGAGTCAAGG + Intergenic
947010313 2:225558744-225558766 ATAAATTTAAAGAGAAGCTATGG - Intronic
1169492806 20:6085547-6085569 TTGCATTTAAAGATGATCCAAGG + Intronic
1170943442 20:20868077-20868099 TTTCATTTAAAGAGGAGCTGTGG + Intergenic
1172060108 20:32181650-32181672 CTCCATTTTAAGAGGAGCCATGG + Intergenic
1173318074 20:41962843-41962865 ATCCATTTCTGTAGGAGCCATGG - Intergenic
1175127362 20:56762538-56762560 AGACATTCAAAGAGGTGCCATGG - Intergenic
1179312567 21:40209643-40209665 ATCCATCCAAGGAGGAGCCTGGG - Intronic
1182042962 22:27252720-27252742 ATCCCTTAAAAGAGGGACCAAGG - Intergenic
1182439347 22:30353281-30353303 GTCCAGTGAGAGAGGAGCCAGGG - Intronic
1182929761 22:34161607-34161629 CTCCAATTAAAGAGCAACCAAGG + Intergenic
1182985036 22:34708186-34708208 ATGCATGTGATGAGGAGCCATGG - Intergenic
1184925815 22:47636532-47636554 CTCAATTTACAGAGGACCCAAGG + Intergenic
949215582 3:1563204-1563226 AGCGAATTAAAGTGGAGCCAGGG - Intergenic
951857745 3:27216626-27216648 AGCCATTTAAAGAGAACACATGG + Intronic
952297655 3:32075396-32075418 ATCCAATTAAAGAGTGTCCAAGG - Intronic
952538325 3:34337643-34337665 ATCCAATTAAAAATGAGCAAAGG + Intergenic
953311436 3:41883942-41883964 CTCCATTTACAGACGGGCCAAGG - Exonic
953656065 3:44855835-44855857 ATCCAATTAGAGAGCATCCAAGG + Intronic
954938414 3:54348195-54348217 ATCCATTCAAAGGGCAGCAAAGG - Intronic
955401487 3:58594890-58594912 ATCCAATTAAAGAGTGTCCAAGG - Intronic
958993490 3:100874346-100874368 ATCCACTTAAAAAAGGGCCAGGG - Intronic
959247110 3:103885457-103885479 ATCTATTTAAAGATGTGCAAAGG + Intergenic
959475800 3:106810901-106810923 ATTCACTGAAAGAGGAGCAAAGG - Intergenic
963372817 3:144423172-144423194 ATCCAAATACAGGGGAGCCAGGG + Intergenic
965286159 3:166823367-166823389 ATCCAATTAGAGAGTGGCCAAGG + Intergenic
971316262 4:25570702-25570724 ATCCTTTAAGAGAGAAGCCAAGG + Intergenic
972006687 4:34118453-34118475 TTCCATTTTAACAGGAGGCATGG + Intergenic
973648899 4:52977798-52977820 ATTCATTGAAAGAAGAGCCCTGG - Intronic
976940015 4:90688457-90688479 AACCATTTAAAGAGTAGCCTAGG - Intronic
977792455 4:101123748-101123770 TTTCATCCAAAGAGGAGCCATGG + Intronic
979967548 4:127093466-127093488 ATCCATTTAAAAATGGGCAAAGG + Intergenic
982574621 4:157093790-157093812 ATCCCTTGAAAGCAGAGCCAAGG - Intronic
983884592 4:172966329-172966351 AGCCAATTAAAAAGGAGCAACGG + Intronic
984412188 4:179408548-179408570 ATCCAATTAGAGAGTACCCAAGG - Intergenic
986073990 5:4315603-4315625 ATCCAGTTAAATAAGAGCAATGG - Intergenic
986594691 5:9409148-9409170 ATCTATTTAATGATTAGCCAGGG - Intronic
986622689 5:9692028-9692050 ATCCCCATGAAGAGGAGCCATGG + Intronic
988694641 5:33608846-33608868 ATCCAATTGAAAAGCAGCCAAGG + Intronic
989352458 5:40501820-40501842 ATCCATTGCAACAGGAGACAAGG - Intergenic
990055812 5:51576922-51576944 ATCCAATTAAAAAGCAGACAAGG + Intergenic
992182982 5:74215945-74215967 ATCCAAATAGAGAGGGGCCAGGG + Intergenic
992912419 5:81409461-81409483 ATCCAATTGAAGAGGAGCTTTGG - Intergenic
995289840 5:110439238-110439260 TTCCCTTTAAAAAGTAGCCAAGG - Intronic
995626743 5:114087097-114087119 ATCCATTTAAAAATGGGCAAAGG - Intergenic
997061853 5:130515287-130515309 ATCCAATTAAAAATGAGCAAAGG - Intergenic
997605538 5:135173344-135173366 ATCCATCCAAATATGAGCCATGG - Intronic
998478576 5:142442351-142442373 TTCCATTTAAAGACGAGCTAGGG + Intergenic
998556769 5:143132837-143132859 ATCCATTTAAAAAGGAATCTGGG + Intronic
998830093 5:146148225-146148247 ATCCAGCTCAAGAGGAGCAAAGG + Intronic
998960569 5:147482096-147482118 ATCCAGATAAAGAGCAGTCAGGG + Intronic
1000003488 5:157162434-157162456 ATCCATTTAAAGAGGAGCCAGGG - Exonic
1001995750 5:176156266-176156288 TTCCAGTTATAGAGGAGCCCAGG + Intergenic
1002274437 5:178095274-178095296 ATCCATCTGAAGAGTGGCCACGG - Intergenic
1002274445 5:178095317-178095339 ATCCATCTGAAGAGTGGCCACGG - Intergenic
1002274453 5:178095360-178095382 ATCCATCTGAAGAGTGGCCACGG - Intergenic
1002274547 5:178095833-178095855 ATCCATGTGAAGAGTGGCCACGG - Intergenic
1002274599 5:178096091-178096113 ATCCATGTGAAGAGTGGCCACGG - Intergenic
1002274626 5:178096220-178096242 ATCCATGTGAAGAGTGGCCACGG - Intergenic
1002274689 5:178096521-178096543 ATCCATGTGAAGAGTGGCCACGG - Intergenic
1002274715 5:178096650-178096672 ATCCATGTGAAGAGTGGCCACGG - Intergenic
1002274724 5:178096693-178096715 ATCCATCTGAAGAGAGGCCACGG - Intergenic
1002274733 5:178096736-178096758 ATCCATCTGAAGAGTGGCCACGG - Intergenic
1002274751 5:178096822-178096844 ATCCATCTGAAGAGAGGCCACGG - Intergenic
1002274760 5:178096865-178096887 ATCCATCTGAAGAGTGGCCACGG - Intergenic
1003492482 6:6635768-6635790 ATCCACGAGAAGAGGAGCCAAGG - Intronic
1004266849 6:14155889-14155911 ATCCATTTAAAAATGAGTAAAGG - Intergenic
1007507646 6:42348554-42348576 AGACCTGTAAAGAGGAGCCAGGG - Intronic
1007917481 6:45574749-45574771 ATCCCTTGAAACATGAGCCAGGG + Intronic
1008453763 6:51684535-51684557 TACCATTTAAAGAGGCTCCAAGG + Intronic
1008740175 6:54597368-54597390 AACCATGTAAAGTGGAACCATGG + Intergenic
1010207100 6:73332709-73332731 GTCCATGAAAAGAGGAGCAAAGG + Intergenic
1016342263 6:143075759-143075781 ATACATTTAAAGTGGTGCCTAGG - Intronic
1017100326 6:150844096-150844118 ATCCATTTTTAGTGGAGACAGGG - Intergenic
1018944753 6:168339785-168339807 ATCCATGTAACCATGAGCCAGGG - Intergenic
1020589687 7:10118854-10118876 AACCCTTTAAAAAGTAGCCAAGG - Intergenic
1022856705 7:34321939-34321961 ATGCATTTAGAGAAGAGCCAGGG + Intergenic
1027549451 7:79573073-79573095 GTCCATTTAAAAATGAGCTAAGG - Intergenic
1028217209 7:88148493-88148515 ATCCATGTAAAAATGAGGCAGGG + Intronic
1029163250 7:98567920-98567942 ATACATTTAAATAGGAGCTAAGG - Intergenic
1029175170 7:98659411-98659433 ATACATAGAAAGAGGAACCAAGG + Intergenic
1030302094 7:107984547-107984569 TTCCATTTAAAGATGAGACATGG - Intronic
1031486026 7:122325777-122325799 ATTCATTTAAAGAACAGCCTAGG - Intronic
1031761547 7:125718432-125718454 ACCCATTCTAACAGGAGCCATGG - Intergenic
1032896498 7:136256860-136256882 CTCCATCTACAGAGGAACCAGGG - Intergenic
1033057362 7:138070677-138070699 TGCCATTTAAACAGGACCCAAGG + Intronic
1033399822 7:141011850-141011872 ATCCATTAACAGAGGAGGCTGGG + Intronic
1037163578 8:15800126-15800148 ATCCATTCAAGGAGCAGCTATGG - Intergenic
1037185460 8:16057358-16057380 ATGTATTTAAACTGGAGCCATGG - Intergenic
1038162958 8:25057620-25057642 CTCCATTTAAAAATGGGCCAAGG - Intergenic
1039601555 8:38842542-38842564 ATCCTTTTAAATAGGAGCTCAGG + Intronic
1043162138 8:76858873-76858895 ATCTTATTAAAAAGGAGCCAAGG - Intronic
1044169640 8:89033522-89033544 CTCCATTTAAAAATGAGCAAAGG + Intergenic
1049921915 9:372781-372803 ACCCATTTAAAGAGAAGCCCAGG + Intronic
1050115595 9:2260101-2260123 ATTCATGTAAAGAAGAGACAGGG - Intergenic
1050297037 9:4216112-4216134 TTCCATTTAAATAGATGCCAGGG + Intronic
1051577860 9:18637827-18637849 CTCTAATTAAAGATGAGCCAAGG - Intronic
1052292105 9:26853781-26853803 ATCCATTTTAACAGGAGATAAGG + Intronic
1053278649 9:36802102-36802124 TTCCTTTTATAGAGGAGGCAGGG - Intergenic
1056290500 9:85138691-85138713 AACCATTTCAAGAGGAGATAAGG + Intergenic
1056406924 9:86283371-86283393 AGCCAGGTAAAGAGGGGCCAGGG + Intergenic
1056776250 9:89515211-89515233 GTCCATTTATAGGGCAGCCATGG - Intergenic
1056876810 9:90341471-90341493 ACCTATTTACTGAGGAGCCAAGG + Intergenic
1056912568 9:90716178-90716200 AACCATTCATAGAGGATCCATGG - Intergenic
1058183560 9:101826899-101826921 ATATATTCCAAGAGGAGCCATGG - Intergenic
1059783862 9:117559216-117559238 ATCTATTTCAAGAGTAGCCCAGG - Intergenic
1060962107 9:127688292-127688314 GTACATTTAAAGAGCAGCCCAGG - Intronic
1192008733 X:67244998-67245020 TTCCATTTTAACAGAAGCCAAGG + Intergenic
1193729483 X:85085862-85085884 ATCATTTTAAAGAAGAGCCTGGG + Intronic
1197337871 X:125230490-125230512 TTTTATTTAAAGAGGAGCAAAGG - Intergenic
1198525960 X:137501268-137501290 ATACTTTTAGAGAGAAGCCAAGG + Intergenic
1198625668 X:138570300-138570322 AGCCATTTAGATAGGAGTCAAGG - Intergenic
1200014850 X:153152079-153152101 ATGCATTTAAACAGGAGAGAAGG + Intergenic
1202075777 Y:21036777-21036799 ATCCAATTAAAGAGTACCCAAGG + Intergenic