ID: 1000003530

View in Genome Browser
Species Human (GRCh38)
Location 5:157162743-157162765
Sequence CACCCACAGCTCCACCAAAA AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 240
Summary {0: 1, 1: 0, 2: 2, 3: 13, 4: 224}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000003530_1000003532 -7 Left 1000003530 5:157162743-157162765 CCTTTTTGGTGGAGCTGTGGGTG 0: 1
1: 0
2: 2
3: 13
4: 224
Right 1000003532 5:157162759-157162781 GTGGGTGGAGCTCTTGCGAGAGG 0: 1
1: 0
2: 0
3: 13
4: 246

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000003530 Original CRISPR CACCCACAGCTCCACCAAAA AGG (reversed) Exonic
900099521 1:955536-955558 CACACACAGCTCCAGGAAACAGG + Intronic
900158355 1:1212407-1212429 CACACCCAGCTCCACCCACAGGG + Intronic
900549413 1:3246604-3246626 CAGGCACAGCTCCACCAGAGGGG + Intronic
901130572 1:6960366-6960388 GACACGCAGCTCCTCCAAAATGG - Intronic
901221674 1:7587033-7587055 CACCACCAGCTCCCCCAGAAGGG + Intronic
902834428 1:19037535-19037557 CACCAGCACCACCACCAAAATGG - Intergenic
902944048 1:19821314-19821336 CACCCCCGCCCCCACCAAAATGG + Intergenic
902989387 1:20175726-20175748 CACCCACATGTCCACCGACAGGG + Intronic
904935506 1:34127149-34127171 CACGCACAGCTTCACAACAAAGG + Intronic
905461205 1:38124055-38124077 CACCCACAGCTCCCAGAAAGGGG + Intergenic
907345368 1:53773810-53773832 CACCCACAACTCCCCCAGACTGG + Intronic
908554596 1:65245235-65245257 CACCCACAACCCCACAAAAGGGG + Intergenic
913495774 1:119426872-119426894 AACCCAGAGCTCCTACAAAAGGG - Intergenic
913518825 1:119626733-119626755 CACCAACAGCACCACCAACCTGG + Intronic
913966410 1:143381084-143381106 CACCCAGTGGTCAACCAAAAAGG - Intergenic
914060784 1:144206691-144206713 CACCCAGTGGTCAACCAAAAAGG - Intergenic
914118366 1:144759678-144759700 CACCCAGTGGTCAACCAAAAAGG + Intergenic
915107771 1:153545119-153545141 CTCCCACAGCTCAGCCACAAAGG + Intronic
915243058 1:154537529-154537551 CACCCTCACCTCCACCAACCTGG - Intronic
919951213 1:202365517-202365539 CATCAACAGCTCTACCAAATAGG + Intronic
921033750 1:211356786-211356808 CCCACACAGTTCCCCCAAAATGG - Intronic
921168915 1:212528167-212528189 CACACACACCTCTACCAAATTGG - Intergenic
921496312 1:215846180-215846202 CACCACCAGCACCACCAAAAAGG - Intronic
923805320 1:237251332-237251354 TCCCCACAGCTCCACTGAAATGG + Intronic
1063423948 10:5936936-5936958 CTCCCACAGCACCACCAACTAGG - Intronic
1064997430 10:21308782-21308804 CACCCACAGGTTCAATAAAACGG + Intergenic
1067684820 10:48459803-48459825 CACACACTGCTCCACCAGCAGGG + Exonic
1068271110 10:54726110-54726132 CACTCACAATTCCACAAAAAGGG - Intronic
1069459653 10:68582655-68582677 CACCCCCACTGCCACCAAAAGGG - Intronic
1069868513 10:71518968-71518990 CACCCACAGCACCACGAAAGAGG + Intronic
1071010617 10:80936154-80936176 CACCCCCAGCCCCACTAAAAGGG - Intergenic
1072044032 10:91637053-91637075 CACCCACCGTTCCACTCAAAGGG + Intergenic
1072427055 10:95338519-95338541 CACCAACAGCTTCACCCAAGAGG + Intronic
1073066933 10:100766769-100766791 CACCCACAACCACACCAAGAAGG + Intronic
1073098211 10:100993279-100993301 CACCTACATCTCCATCAAAGCGG - Exonic
1075234192 10:120711656-120711678 CACACACAGATACATCAAAAAGG - Intergenic
1077389587 11:2293923-2293945 CACCAACGGCTCCACCAGACTGG - Intergenic
1077478025 11:2800144-2800166 AGCCCACAGCCCCACCCAAAAGG + Intronic
1077614603 11:3666054-3666076 CAGCCACAGCTCCTCCAGAAAGG - Exonic
1077888106 11:6401117-6401139 CACCCGCAGCCCCACCAGCAGGG + Intronic
1077908553 11:6554985-6555007 AATCCACATCTCCACCCAAATGG + Intronic
1078766496 11:14303560-14303582 GACCCCCATCTCCACAAAAAGGG + Intronic
1079239431 11:18712184-18712206 CACCAACTTCTCCACCAACAAGG - Exonic
1079244827 11:18744263-18744285 CAGCCACAGCCACCCCAAAAGGG - Intronic
1080316706 11:30958065-30958087 CACTCACAGCTCAACCTAATGGG - Intronic
1081634056 11:44709079-44709101 CACCCACACCTCCAGCCAGAAGG + Intergenic
1082750915 11:57016089-57016111 CACTTATAGCTGCACCAAAATGG + Intergenic
1083571866 11:63765431-63765453 CACCCACACCTCCCCCAGACTGG + Intronic
1083643384 11:64157920-64157942 AGCCCACAGCTCGAGCAAAAGGG + Intronic
1083812470 11:65113244-65113266 CATCCCCAGCCCCACCAACAGGG - Exonic
1083951372 11:65958489-65958511 CAACCACAGCTCCCCCTCAAGGG + Intronic
1084007105 11:66328974-66328996 CGCCCCCAGCTCCAGCCAAAGGG - Intergenic
1087623730 11:100571687-100571709 CACCCACCGCTCCTCAAGAATGG + Intergenic
1088568058 11:111194474-111194496 AACCCACAGCCCAACAAAAAGGG + Intergenic
1088739167 11:112752748-112752770 CACCCACAGCTCCATAAAAACGG + Intergenic
1093554079 12:20449853-20449875 CACCCAAATGTCCACTAAAAGGG - Intronic
1096493630 12:52026662-52026684 CAGTCACAGCCACACCAAAAGGG + Intronic
1097008649 12:55937009-55937031 CACCCTAGACTCCACCAAAAAGG + Exonic
1097934323 12:65228138-65228160 GACCCACAGCTACAAGAAAATGG - Intronic
1101488407 12:105189793-105189815 CATCCTCAGTTTCACCAAAAGGG + Exonic
1102417691 12:112778944-112778966 CACCCAAACCTCCACCTGAAAGG + Intronic
1104055232 12:125225008-125225030 ATCCCACACCTCCACCAGAAAGG - Intronic
1104665958 12:130647492-130647514 AACCCAGACCCCCACCAAAATGG + Intronic
1105622162 13:22078770-22078792 CATCCACATTTCCACCCAAAGGG - Intergenic
1105813140 13:24011607-24011629 GACCCTCAGATCCACCAACAAGG + Intronic
1106322676 13:28656963-28656985 CACCCAGAGCTCCAGCCACAGGG + Intergenic
1107735093 13:43391065-43391087 TCCCCACAGCTCCCCCAGAACGG + Intronic
1109715359 13:66215046-66215068 TTCCCAAAGCTCCACCAACAAGG + Intergenic
1110570205 13:76994527-76994549 CACCCACAGTTCCATGAGAAAGG + Intronic
1112389799 13:98972584-98972606 CACCGACCGCTCCACAAAATAGG + Intronic
1113412876 13:110105789-110105811 CACCCACTGCACCTCTAAAATGG - Intergenic
1113983824 13:114298047-114298069 CACACACACCACCACCTAAAGGG - Intronic
1114262765 14:21050404-21050426 CACCCGGAGCTCCACCAAACAGG - Intronic
1114616872 14:24072992-24073014 CACCCGCAGCTCCACCCGAGAGG - Exonic
1114710952 14:24777654-24777676 CTCCCATAGCTCCATGAAAATGG - Intergenic
1115322331 14:32096077-32096099 CACACACAGCTCCATCAAGTGGG - Intronic
1115378930 14:32711498-32711520 CACACACACATACACCAAAATGG + Intronic
1115451522 14:33553225-33553247 GATACACAGCTCCCCCAAAATGG + Intronic
1118816210 14:69316094-69316116 CACCCCAAGCACCACCACAAGGG - Intronic
1119228161 14:72959925-72959947 CACCCACAGCCCAACCAGAAGGG - Intergenic
1121309016 14:92924749-92924771 CACCCACGGTCCCACCAATAGGG + Intronic
1122165059 14:99816772-99816794 CACACACAGCTCCATCCAAATGG - Intronic
1123028156 14:105438343-105438365 CCCCCACAGCTTCCCCAAGAAGG + Intronic
1124074835 15:26434550-26434572 AACCCAGACCTCCACCAAAGGGG - Intergenic
1124206233 15:27723519-27723541 CACCCCCACCACCACCAAGAAGG + Intergenic
1125134771 15:36328733-36328755 CACCCACAGCTAGGCCAACAGGG + Intergenic
1125745858 15:41996767-41996789 ACCCCACACCTCCACCCAAAAGG - Intronic
1127836142 15:62792730-62792752 CACAGACAGCTACACCAAGAGGG + Exonic
1128674415 15:69598088-69598110 CCCCCATAGGTCCACCAAAGTGG - Intergenic
1128869645 15:71144034-71144056 CTTCCAGAGCTCCACCACAAGGG - Intronic
1130036187 15:80363514-80363536 CACTCACACCTCCACAGAAATGG - Intronic
1133971941 16:10574500-10574522 CACCCACTGCTCCTCCAGCAGGG + Intronic
1135769106 16:25202719-25202741 CACCCATAGCACCAACAATAAGG + Intergenic
1139502627 16:67380102-67380124 GACTCTCAGCTCCATCAAAAGGG - Intronic
1140290035 16:73644763-73644785 CACCCTCAACTCCTCCAAATAGG + Intergenic
1140429781 16:74892450-74892472 AATCCAAATCTCCACCAAAAGGG + Intronic
1141409819 16:83825413-83825435 AACCCACAGCTCCAACAGCAGGG + Intergenic
1203093278 16_KI270728v1_random:1229981-1230003 CCCCCACACCTCCCCCACAAAGG + Intergenic
1142529363 17:568599-568621 CATCCTCAGCCCCAGCAAAAAGG - Intronic
1142884300 17:2903280-2903302 CAGCCACAGCTCCTCCTCAATGG - Intronic
1143102549 17:4512406-4512428 CACCCACAGCCCCAGCAGACTGG - Intronic
1143632878 17:8148830-8148852 CACCCACTCCTCCAACAATAAGG + Intronic
1148053004 17:44778297-44778319 CCCCCTCAGCTCCACCAGTAGGG - Intronic
1150925132 17:69524913-69524935 AACCCAGAGCTCAACCAGAAGGG + Exonic
1151116002 17:71736061-71736083 CACCCACAGCACTACCAAAAAGG + Intergenic
1152236853 17:79143359-79143381 CACCCCCCGCTCCACCAACAAGG - Intronic
1152296401 17:79469636-79469658 CACCCACAGCTGCACACAACTGG + Intronic
1153573334 18:6495368-6495390 AACCCAGACCTCCACCAAATGGG - Intergenic
1157287399 18:46386384-46386406 CTGCCCCAGCTCCACCATAAGGG - Intronic
1157605521 18:48923639-48923661 CCCCAAAAGCTCCACAAAAAGGG + Intronic
1160174839 18:76584679-76584701 CACCCCCAGCTCTGCCAAGAAGG + Intergenic
1160458401 18:79019082-79019104 CACCCACTGCTCCATCCAGACGG - Intergenic
1160979538 19:1810670-1810692 CTCCCACAGCCCCACCAGCATGG - Exonic
1161420673 19:4174643-4174665 CCCCCACAGACCCCCCAAAAGGG - Exonic
1163314144 19:16531169-16531191 CACCCGCAGCGCCACCCAAGAGG - Intronic
1163468438 19:17483303-17483325 CAATCACAGCTCCCTCAAAATGG - Intronic
1165008939 19:32829129-32829151 CCCCCAGAGCTCCACCAACAGGG - Intronic
1166169617 19:41018630-41018652 CCCCCACAGCCCACCCAAAATGG + Intergenic
1168412232 19:56147189-56147211 CACCCAGAGCTCCTCCAGCAGGG - Exonic
1202700192 1_KI270712v1_random:158579-158601 CACCCAGTGGTCAACCAAAAAGG - Intergenic
927847711 2:26479966-26479988 AACCCTCAGCTCCACCTACAGGG - Intronic
927873589 2:26639940-26639962 CCCCCACAGCCCCACGAGAAGGG + Intronic
928245578 2:29624209-29624231 CTCACACATCTCCACCCAAAAGG - Intronic
930824987 2:55687812-55687834 CACCCACTCCACCAACAAAAAGG + Intronic
933941166 2:87246196-87246218 CACCCACAGCTCTTTCAGAATGG - Intergenic
934171125 2:89542054-89542076 CACCCAGTGGTCAACCAAAAAGG - Intergenic
934281431 2:91616372-91616394 CACCCAGTGGTCAACCAAAAAGG - Intergenic
935084782 2:99834573-99834595 CCCCCTCTACTCCACCAAAAGGG + Intronic
936351974 2:111719816-111719838 CACCCACAGCTCTTTCAGAATGG + Intergenic
937103207 2:119287438-119287460 CTCCCACAACCCCACCACAAGGG + Intergenic
942120150 2:172768968-172768990 CACCCACAGAAGCACCAACATGG + Intronic
942506703 2:176649289-176649311 CAGCCACACTTCCAGCAAAATGG - Intergenic
946318905 2:218936867-218936889 CACCCCCTCCACCACCAAAATGG + Intergenic
947807201 2:232977048-232977070 AACCCACAGCTCCAGCGAGATGG + Intronic
948606785 2:239140970-239140992 CACCCACAGCTCCCCCAACCTGG + Intronic
1170440806 20:16377188-16377210 CACCCACAGCACCTCCTAAGGGG - Intronic
1170614893 20:17940550-17940572 CAGCCAGAGCTCCACCAATCAGG + Intergenic
1170678933 20:18507933-18507955 CACCCACAGCTGCAACAAGCAGG - Exonic
1170977008 20:21174192-21174214 CACCCAAATCACAACCAAAATGG + Intronic
1172044720 20:32072008-32072030 CAGCCTGAGCTCCACCAAACAGG + Intronic
1172076104 20:32298782-32298804 TACCTACAGCTACTCCAAAAAGG - Intronic
1173359989 20:42334559-42334581 CAACCACAGCTTCACTGAAATGG - Intronic
1174270523 20:49365065-49365087 CACACTCAGCTCAACCAAGAGGG + Exonic
1175407900 20:58746585-58746607 CACCCACCGCTCTACCAGGAAGG - Intergenic
1175416652 20:58805516-58805538 CACCCACAGCTACACAGACATGG - Intergenic
1179062821 21:37995351-37995373 CTCCCTCAGCACCTCCAAAACGG - Intronic
1179253512 21:39695211-39695233 CATACACAGCTCCACAATAAGGG - Intergenic
1180733134 22:17996920-17996942 CACCAGCAGCTCAAGCAAAATGG + Intronic
1182145223 22:27993273-27993295 CACCCACAGCTCACCCAGCAGGG + Exonic
1182434409 22:30321185-30321207 CACTCACAGGGCCACCAAACCGG + Intronic
1203295635 22_KI270736v1_random:40672-40694 CAACCACACATACACCAAAACGG + Intergenic
949754427 3:7392681-7392703 CAGCCACCACTCAACCAAAAAGG - Intronic
949938780 3:9137436-9137458 CACTACCAGCTCCTCCAAAAAGG + Intronic
950080725 3:10220191-10220213 CACCAACAGCTACACAAGAAGGG - Intronic
950705267 3:14775549-14775571 CAGCAACAGCTACAGCAAAATGG + Intergenic
951554269 3:23904962-23904984 CAACCACAGCTACGGCAAAATGG + Intronic
952312207 3:32200297-32200319 TATCCACTGCTCTACCAAAATGG - Intergenic
952868411 3:37874309-37874331 CACCCTCAACATCACCAAAAGGG - Intronic
953056607 3:39392526-39392548 CACCTTCATCTCCACCTAAATGG - Intronic
956833006 3:73072091-73072113 CTGCCACAGCTGCACCAATATGG - Intergenic
957731130 3:84137984-84138006 CACCTTTACCTCCACCAAAAAGG - Intergenic
961459176 3:127039380-127039402 CCCCCAAAGCTCCACCATCAGGG - Intergenic
962491045 3:135894385-135894407 TACCCACATCTCCACCTACATGG + Intergenic
965468518 3:169062067-169062089 CACATACTGCTCCACCAAACTGG + Intergenic
966840638 3:184084158-184084180 CACCCACAGCTCCACTAGCTGGG - Intergenic
967105884 3:186254771-186254793 CACCCACACTTTCACCAAGAAGG + Intronic
967112255 3:186304230-186304252 CACCCCCAGCTCCAAAAACACGG - Intronic
967468737 3:189838207-189838229 CACTCACAGCAACAACAAAAAGG - Intronic
968027363 3:195453733-195453755 CACACACAGATCCAACAATAAGG - Intergenic
968511668 4:998335-998357 CACCCCCAGCTCCACAGCAAAGG - Intronic
969028640 4:4193834-4193856 CACCCAGTGGTCAACCAAAAAGG + Intronic
969363948 4:6683069-6683091 CACCCACAGCTCCAGGAAAGGGG + Intergenic
969600856 4:8175472-8175494 CACCGACAGCTACACGACAAAGG + Intergenic
969608297 4:8213053-8213075 CTCCCACAGCCCCAGCAACAGGG + Intronic
970581383 4:17477210-17477232 TACCCACAGCCACACCATAAGGG + Intronic
970747830 4:19320579-19320601 CACCCTCCGCTCCATCATAAAGG + Intergenic
972227558 4:37031211-37031233 CACCCTCTGCCCCTCCAAAAAGG + Intergenic
973844981 4:54902409-54902431 CAACCACATCTTCACCAAACTGG - Intergenic
973897137 4:55424540-55424562 CACCCACGGCTACACCATAGGGG - Exonic
976186580 4:82448552-82448574 CACCCCCAGCCCACCCAAAAAGG + Intronic
978652697 4:111026536-111026558 CCCCCAAACCTCCACAAAAAAGG - Intergenic
979952341 4:126908476-126908498 CACCCAGAGCTTCTCCATAATGG - Intergenic
981567365 4:146115157-146115179 AAACCACAGCACCACCAAAAGGG - Intergenic
982682165 4:158444462-158444484 CACCCTCAGCTCCATCACTATGG + Intronic
983387283 4:167081539-167081561 CTGCCACAACCCCACCAAAAAGG + Intronic
984642722 4:182187361-182187383 TACTAACAGCTCCACCAACATGG - Intronic
985224783 4:187748210-187748232 CACCCATAGCTCCATCACAGTGG - Intergenic
985970144 5:3370120-3370142 AACACACACCTACACCAAAAAGG - Intergenic
986950678 5:13080775-13080797 CACCCACAGCTCCAGTAAGCAGG - Intergenic
987765032 5:22214979-22215001 CCCTCACACCTCCAACAAAATGG - Intronic
987945813 5:24607078-24607100 CACCCTCAGCTTCAGCAAACAGG + Intronic
993036656 5:82766318-82766340 CAGCTCCAGCACCACCAAAATGG + Intergenic
993280642 5:85920880-85920902 AACCCACAGCCCCACCAGACTGG + Intergenic
995049547 5:107687311-107687333 CACCCACACCTCCACCCCTAGGG + Intergenic
996874074 5:128222292-128222314 CACCCAAAACTTCATCAAAATGG - Intergenic
998356055 5:141537629-141537651 CACTTCCAGTTCCACCAAAATGG + Intronic
998457465 5:142284295-142284317 CACCTACAGCTGCACCACAAAGG - Intergenic
998836115 5:146203969-146203991 CACCCTCACCCCCACCACAATGG - Intronic
1000003530 5:157162743-157162765 CACCCACAGCTCCACCAAAAAGG - Exonic
1000791759 5:165616730-165616752 GAGCCACAGCTCCACCAACTGGG + Intergenic
1003506848 6:6746692-6746714 CTCCCACAGAACCACAAAAAGGG - Intergenic
1005934634 6:30511266-30511288 CACACACAGCTCCAACAGCAGGG + Intergenic
1007235531 6:40388991-40389013 CATCCAGGGCTCAACCAAAACGG + Intergenic
1015704447 6:136072782-136072804 GTCCCGCAGCTCCACCGAAAAGG - Intronic
1017443947 6:154490554-154490576 CACACACAGTTCCTCCACAAAGG + Intronic
1017738258 6:157382075-157382097 CACCCACAGCTCCTCCCCCATGG + Exonic
1022842500 7:34178191-34178213 CACCCATGGCTAGACCAAAAAGG + Intergenic
1023299531 7:38754653-38754675 CACCCACTGGTCAATCAAAAGGG + Intronic
1030563384 7:111120028-111120050 CAACCATAGCTCTACCAATAGGG + Intronic
1032446071 7:131984719-131984741 TCCTCACAACTCCACCAAAATGG + Intergenic
1034960516 7:155361660-155361682 CACACACAGTCCCACCAAAGTGG + Intronic
1036724271 8:11205618-11205640 AACCCACATGTCCACCCAAAGGG + Intergenic
1037036456 8:14174910-14174932 GACACACAGATCCATCAAAAGGG - Intronic
1037489601 8:19385678-19385700 CATACACAGCTCCTTCAAAACGG + Intronic
1037744657 8:21633073-21633095 CACCCACTGCTCCAGCACTAGGG + Intergenic
1039403102 8:37289307-37289329 CTCCCAAAGGTTCACCAAAAAGG - Intergenic
1041766838 8:61427607-61427629 AATCCACAGCACCCCCAAAATGG - Intronic
1043516486 8:80999674-80999696 CACATACCCCTCCACCAAAAGGG - Intronic
1044675184 8:94720888-94720910 CATCCACAGCTCCACTCATAAGG - Intronic
1049210009 8:141381616-141381638 GACCCACACCTCCATCAATAAGG - Intergenic
1049351250 8:142165994-142166016 CACACACAATTCCACCAGAATGG - Intergenic
1049830687 8:144699389-144699411 CACCCACAGCACCCCCACACCGG - Intergenic
1051763608 9:20497699-20497721 CACCCAGATGTCCACCAACAGGG - Intronic
1052515586 9:29475239-29475261 CACCCACCTTTCCACCAACAAGG - Intergenic
1053195765 9:36117299-36117321 CACCCAGTCCTCCACTAAAAAGG + Intronic
1057389592 9:94631723-94631745 AACACGCAGCTCAACCAAAAGGG + Intronic
1057488726 9:95506411-95506433 CACCCACAGCTCCTCCACGTTGG + Exonic
1060060595 9:120455942-120455964 AACCCACAGCTGCAAGAAAAGGG + Intronic
1060240065 9:121895902-121895924 CACCCACACATCCACACAAAGGG - Intronic
1062342365 9:136099499-136099521 CACCCTCACCTCCACCCAAGGGG + Intergenic
1062432251 9:136531445-136531467 CACCCCCAGCCCCACCCAGACGG + Intronic
1186714428 X:12235220-12235242 CAGCCACATCTCCCCCAGAAGGG - Intronic
1188659201 X:32737121-32737143 CACCAACAGCAACAACAAAAGGG + Intronic
1193339830 X:80335099-80335121 CCTCCACAGCTAGACCAAAAAGG + Intergenic
1193513278 X:82432633-82432655 CTGCCATAGCCCCACCAAAAAGG + Intergenic
1193569695 X:83127560-83127582 CAGCAACAGCTCCAGCAATAAGG + Intergenic
1194123429 X:89987394-89987416 CGCCCACAGCTCCACAAATGGGG + Intergenic
1196186860 X:112753752-112753774 TACCAACATGTCCACCAAAAGGG - Intergenic
1196375710 X:115030500-115030522 CAGCCACATCACCTCCAAAAAGG - Intergenic
1200299442 X:154957959-154957981 CACCCCCAGCTCCTGGAAAAGGG - Intronic