ID: 1000004148

View in Genome Browser
Species Human (GRCh38)
Location 5:157167343-157167365
Sequence GGGGATTTACTGGGAACCAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 153
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 145}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000004148 Original CRISPR GGGGATTTACTGGGAACCAC AGG Intronic
900082548 1:869631-869653 GGGGCTTTACTGGGACTCTCTGG + Intergenic
903268771 1:22174783-22174805 GGGCATTTACTGGGAGGCAGTGG - Intergenic
903837550 1:26215342-26215364 GGGAATGTAGTGGGAACCAGGGG + Intergenic
906453140 1:45969950-45969972 GGGGAAATACTGAGAAGCACTGG - Intronic
907603217 1:55790530-55790552 GGGAATTGACTGGGAACAAATGG - Intergenic
914704068 1:150157251-150157273 GGGGATTTACTGGACACGAAGGG - Intronic
1066225258 10:33376426-33376448 TGGGATTTACTGGTAGCCAGGGG - Intergenic
1068711398 10:60139159-60139181 GGGGATTTGCTGATAACCAAAGG - Intronic
1069137042 10:64780445-64780467 CGGGGGTTCCTGGGAACCACCGG - Intergenic
1069613048 10:69788109-69788131 GGGGATATACTGGGGAACATGGG - Intergenic
1074799070 10:116980654-116980676 TGGGATGTTCTTGGAACCACTGG - Intronic
1078548107 11:12261013-12261035 GGGGATCCGCTGGGAGCCACAGG - Intronic
1078811873 11:14776238-14776260 GGGAATTGATTTGGAACCACTGG + Intronic
1079994175 11:27277925-27277947 GTGGATTGACTGGGATTCACTGG + Intergenic
1082003837 11:47408986-47409008 GGGGCTCCACTGGGGACCACAGG - Intronic
1083856100 11:65393860-65393882 GGGGATGGGCTGGGAGCCACCGG + Intronic
1089624149 11:119740716-119740738 GGGGGTAAACTGGGGACCACAGG - Intergenic
1091347874 11:134867290-134867312 GGGCATTTATTGGGCACCACCGG + Intergenic
1096515703 12:52154033-52154055 GGGGATATAGTGGGTAGCACAGG - Intergenic
1097895886 12:64824702-64824724 GGGGACTTACGGGGCACCGCGGG - Exonic
1099296139 12:80830407-80830429 AGGGATTTACTGAGAACTAAAGG + Intronic
1100685522 12:96983090-96983112 AGGCATTTACTGGGGACCAGAGG - Intergenic
1102254312 12:111406917-111406939 GGGGATTCCCAGGGAACCCCAGG - Intronic
1109373993 13:61464777-61464799 GGGGAATTACTTATAACCACAGG + Intergenic
1110051373 13:70904358-70904380 CAGGATTTACAGGGAACCAGTGG - Intergenic
1115496915 14:34014044-34014066 TGGGAATTACTGGGACTCACTGG - Intronic
1115613195 14:35068647-35068669 GAGCAGTTACTGGGAACCCCGGG - Intronic
1119235260 14:73014372-73014394 TGGTGTTTACTGGGAAACACAGG - Intronic
1121431054 14:93888769-93888791 GGGAACTCACTGGGAACCAGGGG + Intergenic
1121445718 14:93977670-93977692 GGGGACTGCCTGGGGACCACTGG - Intergenic
1121840646 14:97130971-97130993 GGTGATGTTCTGGGAGCCACTGG - Intergenic
1126314070 15:47349501-47349523 GCAGAACTACTGGGAACCACTGG - Intronic
1126746417 15:51830072-51830094 GGTGATTCACTGGGAACGCCAGG - Intronic
1128041826 15:64581559-64581581 GGGGCCTTCCAGGGAACCACCGG + Intronic
1128341652 15:66826487-66826509 GCCTATTGACTGGGAACCACGGG + Intergenic
1131277545 15:90994597-90994619 GGGGATTTTCTTGGAGCGACGGG - Intronic
1131377531 15:91937779-91937801 GGGGACATTCTGGGAAGCACAGG + Intronic
1135594306 16:23729969-23729991 GGGGCTTTTCTGAGGACCACAGG - Intergenic
1139323534 16:66134370-66134392 GGGGATTTGTTGGAAAGCACTGG - Intergenic
1140093463 16:71855540-71855562 GGCGATTTAGGGGGAAGCACAGG + Exonic
1141801850 16:86315179-86315201 TGGGTCTTACTGGGCACCACTGG + Intergenic
1141801865 16:86315260-86315282 TGGGTCTTACTGGGCACCACTGG + Intergenic
1141801904 16:86315458-86315480 TGGGTTTTACTGGGCATCACTGG + Intergenic
1145782442 17:27571921-27571943 AGGGATTTACTAGCAGCCACGGG - Intronic
1146279569 17:31536542-31536564 GGGGATTTCCTGGGTCCCAAAGG - Exonic
1146736666 17:35243973-35243995 GGGGAATTTCAGGGAACCTCGGG + Intronic
1151098992 17:71533635-71533657 AGGGCTTTGCAGGGAACCACAGG + Intergenic
1151863835 17:76786461-76786483 GGGGATTCACTAGGACTCACAGG + Intergenic
1152314406 17:79571974-79571996 GGTGATTTGCTGGGAGCCATCGG + Intergenic
1153601306 18:6783602-6783624 GGGTATTTACTTTTAACCACAGG + Intronic
1160848507 19:1177931-1177953 GGGGATTTCCAGGGAATCACAGG + Intronic
1202648921 1_KI270706v1_random:163296-163318 GGAGAGTAACTGGGAGCCACAGG + Intergenic
926081589 2:9990934-9990956 GGGGTTTTCCTGGGGACTACAGG + Intronic
933570576 2:84005839-84005861 GGGGAATGACTGAGAAACACTGG + Intergenic
936442678 2:112568595-112568617 AGGGATCAACTGGGAAGCACAGG - Intronic
936573204 2:113633454-113633476 GTGGATCCACTGAGAACCACAGG + Intronic
945000448 2:205344664-205344686 GGGTACATACTGGGAGCCACCGG + Intronic
945989776 2:216385802-216385824 GGGGAATTGCTGGGAAGGACAGG - Intergenic
947522675 2:230860572-230860594 GGGGATTTACTGGAAAAGAATGG + Intergenic
947591166 2:231386833-231386855 GGGGCTTTACTGGGAGGCTCAGG + Intergenic
949034509 2:241810377-241810399 GGGGATTTACTGGGGGCAGCTGG - Intronic
1171805981 20:29680646-29680668 GGGGAGTTCCTTGGAAGCACAGG + Intergenic
1174151830 20:48491228-48491250 GGGGATTTAGAGGGAGGCACAGG + Intergenic
1174172983 20:48628532-48628554 GGGGCTGTCCTGGGAACCACAGG + Intronic
1175446687 20:59025095-59025117 GTGGATTTGCAGGGAGCCACTGG + Exonic
1175611473 20:60355057-60355079 GTGGATTTACTGAGGACAACAGG - Intergenic
1176602482 21:8806253-8806275 GGAGAGTAACTGGGAGCCACAGG + Intergenic
1176611864 21:8991081-8991103 GGAGAGTAACTGGGAGCCACAGG - Intergenic
1179055477 21:37928090-37928112 TGGGATTCACTGGGAGCCACTGG - Intergenic
1180344767 22:11697806-11697828 GGAGAGTAACTGGGAGCCACAGG + Intergenic
1180352590 22:11816800-11816822 GGAGAGTAACTGGGAGCCACAGG + Intergenic
1180352959 22:11819045-11819067 GGAGAGTAACTGGGAGCCACAGG - Intergenic
1180385282 22:12173312-12173334 GGAGAGTAACTGGGAGCCACAGG + Intergenic
1180385664 22:12175557-12175579 GGAGAGTAACTGGGAGCCACAGG - Intergenic
1181496104 22:23288409-23288431 GGGGATTCACAGGGGATCACAGG - Intronic
1185426981 22:50777426-50777448 GTGGATCCACTGAGAACCACAGG - Intronic
952881919 3:37990857-37990879 GGGGGTTTCCAGGGAACCAGTGG + Intronic
953016312 3:39080180-39080202 GGGGTATTACTGGCAACTACTGG - Intronic
956045926 3:65195869-65195891 GGGAATTTATTGAGAACCATTGG + Intergenic
956336512 3:68170308-68170330 GGGCATTTATAGGGAGCCACTGG - Intronic
960998422 3:123354523-123354545 GGGAAGTCACTGGGAACCACTGG + Intronic
962846777 3:139280326-139280348 GTGAATTTACTGGGCCCCACTGG + Intronic
968501379 4:951746-951768 GAGGCTTTGCTGGGCACCACTGG + Intronic
973376030 4:49287136-49287158 GGAGAGTAACTGGGAGCCACAGG + Intergenic
973376953 4:49293299-49293321 GGAGAGTAACTGGGAGCCACAGG + Intergenic
973377874 4:49299454-49299476 GGAGAGTAACTGGGAGCCACAGG + Intergenic
973378819 4:49305734-49305756 GGAGAGTAACTGGGAGCCACAGG + Intergenic
973379399 4:49309920-49309942 GGAGAGTAACTGGGAGCCACAGG - Intergenic
973380273 4:49315916-49315938 GGAGAGTAACTGGGAGCCACAGG - Intergenic
973381192 4:49322082-49322104 GGAGAGTAACTGGGAGCCACAGG - Intergenic
973385818 4:49513739-49513761 GGAGAGTAACTGGGAGCCACAGG - Intergenic
978232926 4:106422914-106422936 GGGGTGTTACTGGAATCCACTGG - Intergenic
978567746 4:110102362-110102384 GGGGAGTTACTGGCCAACACTGG + Intronic
979207372 4:118054987-118055009 TGGGATTTACTGGGAAAGTCTGG + Intronic
980579431 4:134730993-134731015 GGAGATTCATTGGGAACCACTGG - Intergenic
985623463 5:969176-969198 GGAGAACTGCTGGGAACCACAGG + Intergenic
986704467 5:10443734-10443756 TGGGTTTTCCTGAGAACCACTGG - Intronic
988710575 5:33770312-33770334 TGGGATCTACTGGGAAACATTGG + Intronic
990040988 5:51378633-51378655 GGAGATTTACTGGGGACGAGCGG - Intergenic
992666553 5:79015167-79015189 GTGGATTAACTAGGAAACACAGG - Intronic
998500849 5:142631312-142631334 GCAGAATTCCTGGGAACCACAGG + Intronic
1000004148 5:157167343-157167365 GGGGATTTACTGGGAACCACAGG + Intronic
1001665989 5:173434106-173434128 GGGAATTCACTGAGAACCATGGG - Intergenic
1001975746 5:175997036-175997058 GGGGAGTTACTGGCACCCAGTGG - Intronic
1002241680 5:177846736-177846758 GGGGAGTTACTGGCACCCAGTGG + Intergenic
1004410444 6:15376783-15376805 GGGGAGCTACTTGGAATCACTGG + Intronic
1006131479 6:31871718-31871740 GGGGATAGACTGGGCTCCACAGG - Intronic
1006212579 6:32409506-32409528 GGGCATTTCCTCGGCACCACCGG - Intergenic
1006500009 6:34452374-34452396 GGGGATATACTAAGAAGCACAGG - Intergenic
1006821404 6:36898934-36898956 GGTGATTTACTGAGAGCAACAGG - Intronic
1011207938 6:84921631-84921653 GGTGATTTACAGGGAACCTTGGG - Intergenic
1011737687 6:90328567-90328589 GTGGATTTACTGGAAAGCAGAGG + Intergenic
1013290968 6:108718601-108718623 GGGTATTCACTAGGAGCCACTGG - Intergenic
1016326119 6:142903648-142903670 TGTGAATTAATGGGAACCACCGG - Intronic
1017676618 6:156820866-156820888 GGAGGTTTCCTGGGAACCAGTGG + Intronic
1023193107 7:37604267-37604289 TGGAATTTACTTGCAACCACAGG + Intergenic
1023336236 7:39173828-39173850 GGGAATGTAGAGGGAACCACAGG + Intronic
1023539521 7:41250676-41250698 GGGGCTTTACAGGCAGCCACAGG + Intergenic
1027160133 7:75796398-75796420 TGGGATTTAGTAGGAGCCACGGG + Intergenic
1028540733 7:91940350-91940372 GGAGATTGAGTGGGAACCAGTGG + Intergenic
1030148911 7:106383232-106383254 AGGCATTGACTGGGAACCACTGG - Intergenic
1030457113 7:109789965-109789987 TGGGATTTAATGCAAACCACAGG + Intergenic
1034175092 7:149093413-149093435 GGGGAGTTTCAGGGAACCAAGGG + Intergenic
1035637466 8:1157134-1157156 GTGGATTTACTGGTGACCGCGGG + Intergenic
1038348915 8:26758642-26758664 GATGATGGACTGGGAACCACGGG - Intronic
1041656414 8:60355188-60355210 GGGGTCTTCCAGGGAACCACTGG - Intergenic
1044932226 8:97261163-97261185 GGGATTTTCCTGGGAGCCACAGG - Intergenic
1048233979 8:132673046-132673068 GGCCATTTATTGGGAAGCACGGG + Intronic
1048278219 8:133083881-133083903 GGGGGAAAACTGGGAACCACTGG - Intronic
1053434533 9:38066676-38066698 GGGGATATTCTGGGGACCTCGGG + Intronic
1054843546 9:69768921-69768943 GTGGATTGACTGGGACCAACTGG + Intergenic
1056758261 9:89396377-89396399 GGGGATGTGCTGGGAAGGACAGG - Intronic
1059402479 9:114078865-114078887 GGGGATTTACTGGACACCTGTGG - Intergenic
1061766432 9:132884436-132884458 AGGGATTTACTGGTGACCAGAGG + Intronic
1062167690 9:135116172-135116194 GGGGACCTACTGTGAAGCACGGG + Intronic
1203699805 Un_GL000214v1:125661-125683 GGAGAGTAACTGGGAGCCACAGG + Intergenic
1203700706 Un_GL000214v1:131653-131675 GGAGAGTAACTGGGAGCCACAGG + Intergenic
1203479540 Un_GL000224v1:251-273 GGAGAGTAACTGGGAGCCACAGG + Intergenic
1203480506 Un_GL000224v1:6547-6569 GGAGAGTAACTGGGAGCCACAGG + Intergenic
1203481473 Un_GL000224v1:12875-12897 GGAGAGTAACTGGGAGCCACAGG + Intergenic
1203482437 Un_GL000224v1:19184-19206 GGAGAGTAACTGGGAGCCACAGG + Intergenic
1203549026 Un_KI270743v1:153048-153070 GGAGAGTAACTGGGAGCCACAGG + Intergenic
1203549424 Un_KI270743v1:155501-155523 GGAGAGTAACTGGGAGCCACAGG - Intergenic
1203550382 Un_KI270743v1:161813-161835 GGAGAGTAACTGGGAGCCACAGG - Intergenic
1203568572 Un_KI270744v1:111375-111397 GGAGAGTAACTGGGAGCCACAGG + Intergenic
1203569145 Un_KI270744v1:115609-115631 GGAGAGTAACTGGGAGCCACAGG + Intergenic
1203570094 Un_KI270744v1:121898-121920 GGAGAGTAACTGGGAGCCACAGG + Intergenic
1186220691 X:7346026-7346048 TGGGATTGCCTGGGGACCACAGG - Intronic
1187080999 X:15987642-15987664 TGGGATAAACTGGGATCCACAGG + Intergenic
1191845504 X:65544491-65544513 GGTGCTTTACTGGGAACTCCTGG + Intergenic
1196751980 X:119126379-119126401 GGGGAATTGTGGGGAACCACAGG - Intronic
1199491312 X:148403492-148403514 GGGGATATATTGGGAAGCAGAGG - Intergenic
1200227152 X:154424513-154424535 GGAGCATTGCTGGGAACCACCGG - Intergenic