ID: 1000004568

View in Genome Browser
Species Human (GRCh38)
Location 5:157171045-157171067
Sequence TGATGAAAGTAGAGTGAATT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000004567_1000004568 -8 Left 1000004567 5:157171030-157171052 CCAAGCAAGCTACAGTGATGAAA 0: 1
1: 0
2: 0
3: 14
4: 187
Right 1000004568 5:157171045-157171067 TGATGAAAGTAGAGTGAATTAGG No data
1000004564_1000004568 29 Left 1000004564 5:157170993-157171015 CCTGATATGAGAGCATGCCTGGT 0: 1
1: 0
2: 2
3: 17
4: 126
Right 1000004568 5:157171045-157171067 TGATGAAAGTAGAGTGAATTAGG No data
1000004562_1000004568 30 Left 1000004562 5:157170992-157171014 CCCTGATATGAGAGCATGCCTGG 0: 1
1: 0
2: 5
3: 25
4: 193
Right 1000004568 5:157171045-157171067 TGATGAAAGTAGAGTGAATTAGG No data
1000004566_1000004568 12 Left 1000004566 5:157171010-157171032 CCTGGTATGTTTAAGGAGCTCCA 0: 1
1: 0
2: 5
3: 15
4: 137
Right 1000004568 5:157171045-157171067 TGATGAAAGTAGAGTGAATTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000004568 Original CRISPR TGATGAAAGTAGAGTGAATT AGG Intronic
No off target data available for this crispr