ID: 1000004886

View in Genome Browser
Species Human (GRCh38)
Location 5:157174545-157174567
Sequence TAGAGCTATCAATTCTAAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 97
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 89}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000004886 Original CRISPR TAGAGCTATCAATTCTAAGG GGG (reversed) Intronic
905059905 1:35131105-35131127 AAGAGCTCACAACTCTAAGGGGG + Intergenic
905115804 1:35639940-35639962 TAGAGCTAACATCTATAAGGTGG - Intronic
907332125 1:53678285-53678307 TTGAGCCATCAGTTCTCAGGTGG + Intronic
913158356 1:116122418-116122440 TTAAGCTATGAATTCTAAGTGGG - Intronic
915545751 1:156596547-156596569 TGGAGCTATAAATTCTTAGGGGG - Intronic
918690986 1:187479074-187479096 TAGAGCTATTTGTTCTAAGGAGG + Intergenic
919943255 1:202302841-202302863 TAGAACTATCAGTTCTCAGCCGG - Intronic
922893074 1:229076584-229076606 TGGAGCTTACAATTCAAAGGGGG + Intergenic
923643435 1:235790488-235790510 TAGAGCTATCAGTTCTTAGGTGG + Intronic
1063782189 10:9338247-9338269 ATGAACTATCTATTCTAAGGGGG - Intergenic
1063935129 10:11069901-11069923 TAGAGTTAGCATTTGTAAGGTGG + Intronic
1065704309 10:28457857-28457879 AAGAGCTCACAACTCTAAGGGGG + Intergenic
1070339534 10:75484340-75484362 TAGTGATATCACTACTAAGGGGG - Intronic
1074162109 10:110843946-110843968 TAGAGCTCTCTATTGTCAGGTGG - Intergenic
1074613979 10:115048008-115048030 TAGAGCCATTATTTCTAAGAAGG + Intergenic
1080516228 11:33023491-33023513 TAGAGCCATAAATTATAAGTGGG - Intronic
1090286294 11:125502427-125502449 TAGTTCTATCAGCTCTAAGGAGG - Intergenic
1093081225 12:14813842-14813864 TAAAGACATCAATTCTAAGAAGG - Intronic
1095718061 12:45370468-45370490 TAGAGCTAAGAATTCACAGGTGG + Intronic
1098033434 12:66278332-66278354 TAGAACTATAAATTCTATGAAGG + Intergenic
1100500766 12:95172018-95172040 TACAGGGAACAATTCTAAGGGGG + Intronic
1100722874 12:97377206-97377228 TATCACTATCAATTCTAAGAGGG - Intergenic
1102116239 12:110405199-110405221 AAGGGCTCACAATTCTAAGGGGG + Intergenic
1106765601 13:32910572-32910594 TAGAGAAATCAATTAAAAGGAGG - Intergenic
1110072380 13:71193062-71193084 TATAGCCACCAATTCTAAGTGGG + Intergenic
1111162574 13:84414804-84414826 AAGGGCTTACAATTCTAAGGGGG + Intergenic
1114769493 14:25412141-25412163 AAGAGCTGTGAATTCTAAGCAGG - Intergenic
1115721541 14:36166983-36167005 TCTAGCCATGAATTCTAAGGTGG + Intergenic
1120399260 14:84007281-84007303 TAGAGGCATCAAGTCTAAGTGGG + Intergenic
1122145535 14:99686795-99686817 TTGGGCTATTTATTCTAAGGAGG + Intronic
1126009305 15:44287805-44287827 TAGAGCTATTATTTCTAACCCGG + Intergenic
1127939495 15:63680227-63680249 AAAAGCTTTCAATTCTAATGTGG - Intronic
1128203010 15:65825961-65825983 AAGAGCTCACAACTCTAAGGGGG - Intronic
1133612846 16:7449581-7449603 TAGAGATTTCAAGTCTAACGAGG - Intronic
1136114390 16:28085552-28085574 TAGATCTATGAAATCTGAGGAGG + Intergenic
1139642637 16:68303747-68303769 TATAGCTATCCATTCTTAGGGGG - Intronic
1142732692 17:1872190-1872212 GAAGGCTATCAATTCTAAGCAGG + Intronic
1148593995 17:48838124-48838146 AAGGGCTAACAACTCTAAGGGGG + Intronic
1148993082 17:51683179-51683201 TGGACCTGTCATTTCTAAGGAGG - Intronic
1153830847 18:8921207-8921229 AAGAGCTCACAACTCTAAGGGGG - Intergenic
1155614125 18:27701725-27701747 CAGGGCTATCAATTCTTTGGAGG - Intergenic
1156108621 18:33696287-33696309 TAAAGGAATCAATTCTAAGCAGG + Intronic
1156832632 18:41513193-41513215 TAGATATATCTATTCTAATGAGG - Intergenic
1158807011 18:60985808-60985830 AAGGGCTCACAATTCTAAGGGGG - Intergenic
1163661208 19:18578788-18578810 TAGACATAGCAATTTTAAGGCGG - Intronic
926033866 2:9618414-9618436 TAGAGAAATTAATTCTAAAGAGG + Intronic
932658126 2:73627732-73627754 TAGAGCAATCAATCATAGGGAGG - Intergenic
933226886 2:79759978-79760000 TAAAGCTATTCATTTTAAGGCGG + Intronic
933426700 2:82122652-82122674 TAGAGCTATCAATTGTTAGCTGG - Intergenic
936050537 2:109219426-109219448 TAGAGCTTCCAATTCTATGTCGG - Intronic
941850693 2:170177191-170177213 TATATCCATCAATTCTGAGGAGG - Intergenic
946913628 2:224491723-224491745 AAGGGCAATCCATTCTAAGGTGG + Intronic
1169618432 20:7476674-7476696 CAGACATATCAATACTAAGGTGG + Intergenic
1172464755 20:35147813-35147835 AAGAGCTTACAACTCTAAGGGGG + Intergenic
1173088884 20:39951466-39951488 TAGAGCCATAAATGCTAAGGAGG + Intergenic
1175054594 20:56186662-56186684 TAGAGCTATGAATTGTATGCAGG + Intergenic
949436451 3:4034821-4034843 TAGAGCAATCAATTCTAGCCAGG + Intronic
953263887 3:41367354-41367376 TAAAGATATCAATTCAGAGGAGG + Intronic
955776510 3:62439583-62439605 GATAGCTATCAGTTCTAAGCAGG + Intronic
958532189 3:95348318-95348340 AAGAGCTTACAATTCTAAGGGGG - Intergenic
959807033 3:110567675-110567697 TAGAGCTCACAACTCTAAGAGGG - Intergenic
963987291 3:151611225-151611247 TAGGGATATCATTTATAAGGTGG - Intergenic
965191663 3:165538292-165538314 AAGAACTATTATTTCTAAGGAGG - Intergenic
966103725 3:176309623-176309645 TAGTGCTATGAAATCCAAGGAGG - Intergenic
970737614 4:19193265-19193287 AAGGGCTTACAATTCTAAGGGGG + Intergenic
971916862 4:32882108-32882130 TAGAGCTATGAATGCTATGAAGG - Intergenic
973702063 4:53547194-53547216 TGGCGTTATCAATTCTAAGATGG + Intronic
978029233 4:103918268-103918290 TAGAACTATCAATTGTGACGGGG + Intergenic
978355697 4:107870510-107870532 TAGAGCTATGAACTCTTAGATGG + Intronic
988777279 5:34489125-34489147 CAGAGCTGTCAGTTCCAAGGTGG - Intergenic
990188442 5:53231979-53232001 TAGACATAGCAATTTTAAGGTGG + Intergenic
996331984 5:122340124-122340146 TAGAGTTTCCAATTCTAAGTCGG - Intronic
999123656 5:149229997-149230019 CAGAGCTATCACATTTAAGGGGG - Intronic
1000004886 5:157174545-157174567 TAGAGCTATCAATTCTAAGGGGG - Intronic
1002275830 5:178103908-178103930 AAGAGCTCACAACTCTAAGGGGG + Intergenic
1009481839 6:64169081-64169103 TGGAGCTCACAAATCTAAGGAGG - Intronic
1011310442 6:85974646-85974668 TAGACATAGCAATTTTAAGGTGG + Intergenic
1015361496 6:132344787-132344809 TAGTGCTCTCAACTCAAAGGTGG - Intronic
1016082675 6:139875282-139875304 TTGAGATATCAAGTCCAAGGAGG - Intergenic
1026368222 7:69671573-69671595 TAGGGCTGCCAAATCTAAGGTGG - Intronic
1027733139 7:81901490-81901512 AAGAGCTTACAACTCTAAGGGGG - Intergenic
1029499555 7:100919927-100919949 AAGAGCTCACAATTCTAAGCGGG - Intergenic
1032979807 7:137268480-137268502 AAGGGCTAACAACTCTAAGGGGG + Intronic
1038436156 8:27538124-27538146 TAGAGCTATGAATTCCCAAGGGG + Intronic
1041515929 8:58698715-58698737 AAGGGCTAACAACTCTAAGGGGG - Intergenic
1042489310 8:69380390-69380412 TAGGGCTCACAACTCTAAGGGGG + Intergenic
1049634528 8:143680231-143680253 AAGAGCTCACAACTCTAAGGGGG - Intergenic
1051511241 9:17880292-17880314 TAAAGCTAATAAATCTAAGGTGG + Intergenic
1051934607 9:22431519-22431541 TATAGCGATTTATTCTAAGGAGG + Intergenic
1055706299 9:79008610-79008632 AAGAGCTTACAACTCTAAGGGGG - Intergenic
1187841636 X:23494813-23494835 AAGGGCTAACAACTCTAAGGGGG + Intergenic
1190426517 X:50338395-50338417 AAGGGCTTACAATTCTAAGGGGG + Intronic
1194163026 X:90478913-90478935 TTGAGATATCCCTTCTAAGGTGG - Intergenic
1196908105 X:120458700-120458722 TAGAGCTAGCAAAGCTGAGGAGG - Intronic
1199526046 X:148793145-148793167 TACAGCTAAAGATTCTAAGGAGG + Intronic
1200509303 Y:4056645-4056667 TTGAGATATCCCTTCTAAGGTGG - Intergenic
1201065537 Y:10091695-10091717 AAGAGCTTACAACTCTAAGGGGG - Intergenic