ID: 1000005733

View in Genome Browser
Species Human (GRCh38)
Location 5:157182808-157182830
Sequence CACAAATAGCAGTTGGGCTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 110
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 98}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000005733 Original CRISPR CACAAATAGCAGTTGGGCTA AGG (reversed) Intronic
900643163 1:3696901-3696923 CAGAAATAGCAGCTGGCCGAGGG - Intronic
900959470 1:5909903-5909925 CACAAATGCCAGCTGGGCTGAGG - Intronic
901011292 1:6203955-6203977 CACAAATAGAACCAGGGCTAGGG + Intronic
901776787 1:11565570-11565592 CAAAAACAGAAGTTGGGCTGGGG + Intergenic
907310522 1:53536460-53536482 CACACACAGCACTTGGCCTACGG - Intronic
913156546 1:116105147-116105169 CAGAAATAACAGCTGGGCAAAGG - Intergenic
916935758 1:169626619-169626641 CACAAATACCAGTTGGCAGAAGG + Intronic
919760950 1:201097706-201097728 CAGTAATAGCATTTGGGCTTGGG + Intronic
921807416 1:219472023-219472045 CCCAAATGGCAGTAGTGCTAAGG + Intergenic
923445477 1:234066658-234066680 CTCAAATAGAAGTTGGACGAGGG + Intronic
1067145952 10:43694047-43694069 AACACATAGCACTTGGGTTATGG + Intergenic
1068208031 10:53882656-53882678 AAAAAATAGCAGTTGGGGTCAGG - Intronic
1072357367 10:94624614-94624636 CACAAAGAGGAGTTCGGCTGGGG + Intergenic
1078148659 11:8740385-8740407 CACAAGAAGCATTTGTGCTAAGG + Intronic
1079124667 11:17709947-17709969 CACACACAGCCGTTGGGCTCTGG - Intergenic
1080655787 11:34257119-34257141 TACAAATAGCAGGTGGCCTATGG + Intronic
1086131879 11:83409601-83409623 CTCAAAGAGCAGGTGGGCTCTGG - Intergenic
1086889408 11:92239218-92239240 AATAAATAGCAGTTGGCCCAGGG - Intergenic
1091009443 11:131985322-131985344 CACAGATTGCACTTGGGCAATGG - Intronic
1103162036 12:118737334-118737356 CATAAATTGCAGTGGGGTTAGGG - Intergenic
1110636373 13:77771055-77771077 GACAAAAAGCAGTGGGGGTAAGG - Intergenic
1110664882 13:78105379-78105401 CACAAATAACAGTAGGTCAAGGG - Intergenic
1116087740 14:40262954-40262976 GAGAAATAGCAATTGGGCCAAGG - Intergenic
1119601237 14:75978704-75978726 CACAAATAGCAGATGTCCTTGGG - Intronic
1120928079 14:89818025-89818047 AAAAAATTGCAGTTGGGGTAGGG + Intronic
1123577924 15:21691198-21691220 CACAAATAGAATTTGGAGTATGG + Intergenic
1123614549 15:22133680-22133702 CACAAATAGAATTTGGAGTATGG + Intergenic
1123773037 15:23548307-23548329 CCCAAATAGCAGCTGTGCCAGGG - Intergenic
1124783054 15:32654431-32654453 CACAAATACTAGCTGGGCTATGG - Intronic
1126378595 15:48022167-48022189 CAGAACTAGCAGTTGCTCTAGGG + Intergenic
1127302566 15:57670102-57670124 TACAAATACCAGTTGGGTTTAGG + Intronic
1130687769 15:86053982-86054004 CACAAAAATCAGATGGGCAAAGG - Intergenic
1202986794 15_KI270727v1_random:425443-425465 CACAAATAGAATTTGGAGTATGG + Intergenic
1135751413 16:25061575-25061597 AACAGAAAGCAGTTGAGCTAGGG + Intergenic
1141337302 16:83168448-83168470 TACTATTAGCATTTGGGCTAAGG - Intronic
1143859387 17:9877322-9877344 CACAAATAGTACTTCGTCTAAGG + Intronic
1146199614 17:30845325-30845347 GAAAAATTGCAGTTGTGCTAAGG + Intronic
1147166080 17:38594137-38594159 CACAAACAGCAGAGGGGCCAAGG - Intronic
1147495696 17:40912935-40912957 CAGGAATTGCAGTTGGGCAAAGG + Intergenic
1147951708 17:44111259-44111281 CTGAAATAGCAGTTGGGGGAGGG + Intronic
1158305531 18:56101282-56101304 ATCAAATGGCAGTTGGGCTGGGG + Intergenic
1159080040 18:63726389-63726411 CAGAAATAGCAGGTGGGTGAGGG - Intronic
1164603545 19:29579696-29579718 CACAAAGAGCAGTTGGAATAGGG - Intergenic
1167602571 19:50463027-50463049 CACAAAGAGCAGTTGGAAAATGG - Intronic
1168453108 19:56481256-56481278 CACAAATATGAGTTCTGCTATGG - Intergenic
928071309 2:28220274-28220296 TACAAATAGCAGTAAGGCTTGGG - Intronic
930304921 2:49665752-49665774 CCCAAATAGCCGTTGGGCTGGGG - Intergenic
932802399 2:74752543-74752565 CACAAATAGAAATGGAGCTAGGG + Intergenic
934638151 2:96009769-96009791 CTCAAATAGAAGTCGGGCCATGG + Intergenic
934795500 2:97095641-97095663 CTCAAATAGAAGTCGGGCCATGG - Intergenic
939121775 2:138125865-138125887 CAGAAATAGCATTTGGACAAAGG + Intergenic
940013251 2:149077081-149077103 AACAGACAGCAGTTCGGCTATGG - Intronic
941374003 2:164705250-164705272 CACACACAGAAGCTGGGCTATGG + Intronic
941388963 2:164888474-164888496 AACAAATAGGAGGTGGGCTATGG - Intergenic
942888632 2:180960406-180960428 CAGAAATAGCAGTTGGCCCTGGG - Intergenic
945029398 2:205649418-205649440 CGCATGTAGCAGTTGGGATAAGG + Intergenic
947406982 2:229788554-229788576 TACACATAGCAGTTTGGCTGAGG - Intronic
948945137 2:241215513-241215535 CAGGAATAGCAGTTGGGAGATGG + Intronic
1169763693 20:9125712-9125734 CACAAATATCAATAGGGCTATGG - Intronic
1175135005 20:56816572-56816594 CACCAATGTCAGTGGGGCTAAGG - Intergenic
1178326424 21:31649225-31649247 AACAAATAGCAGGTTGGGTATGG + Intergenic
1178673365 21:34611929-34611951 CCCAAAAACCAGGTGGGCTAAGG - Intronic
1179306749 21:40160916-40160938 CACAAATTGAACTTGGACTAAGG - Intronic
1180189490 21:46155656-46155678 CACAAGGAGCAGTGGGGCCAAGG + Intergenic
1184091653 22:42296078-42296100 CACAAAACTCAGATGGGCTAAGG - Intronic
949176790 3:1073219-1073241 CACAAAGAGGAGTTGCTCTATGG - Intergenic
949407689 3:3731951-3731973 AACAAATAGCAATTGGTTTATGG - Intronic
950165489 3:10794214-10794236 AACAAATGGCAGTTGAGCTCTGG + Intergenic
953570065 3:44064257-44064279 CTCAACTAGAAGTTGGACTATGG - Intergenic
953797478 3:45996363-45996385 TATAAATAGAAGTTGGGCTGAGG - Intergenic
954000715 3:47554604-47554626 CACAAATAACTGTTGGGGGATGG - Intergenic
954076637 3:48186938-48186960 CCCAATTAGCACTTGGGCAAAGG + Intronic
964691177 3:159451875-159451897 CACAAAGAGCAGCTGGGATTAGG + Intronic
966277820 3:178196986-178197008 CACAAATAGCTGGTGGGCAAAGG + Intergenic
966417295 3:179702380-179702402 CACAGATGGCAGTGGGGCCAGGG + Intronic
971530250 4:27678826-27678848 CACGAAAAGCAGTTGGGCAGTGG - Intergenic
971599976 4:28580509-28580531 CACAGATAGCAATTGGGAGAAGG - Intergenic
972587440 4:40450708-40450730 CACAAATATCAATAGGGCTGAGG - Intronic
977695007 4:99955425-99955447 CAAGAATAGCAGTTGGGAGATGG + Intergenic
981508464 4:145528720-145528742 CACAAAGAGCAGTTAGCCTATGG - Intronic
986627252 5:9733767-9733789 CACAAGTAGCAATTGGGCTCAGG + Intergenic
986884999 5:12223286-12223308 CACAAATATTATTTGAGCTAAGG - Intergenic
989703872 5:44304203-44304225 CAAAAATAGGAGTTGGGATTAGG - Exonic
989761823 5:45024508-45024530 CAAAAATGCCAGTTGGGCAAAGG - Intergenic
996838872 5:127824174-127824196 AACAATTAGCAGCTGTGCTAGGG + Intergenic
999104015 5:149053108-149053130 CACAAATAGTGGTTGAGCCAAGG - Intronic
1000005733 5:157182808-157182830 CACAAATAGCAGTTGGGCTAAGG - Intronic
1000020998 5:157319434-157319456 GACAAATAGCAGCTGGCCCATGG - Intronic
1001280126 5:170380777-170380799 CTTAAATAGCAGTGTGGCTATGG + Intronic
1003950055 6:11108560-11108582 CAGAAGTAGCATTTGGGCAAAGG + Intronic
1006938351 6:37734102-37734124 CACAAATATTAGCTGGGCCATGG + Intergenic
1013552005 6:111217094-111217116 CTCCAATAGCAGTCAGGCTAGGG - Intronic
1014407170 6:121065940-121065962 AACATATTTCAGTTGGGCTAAGG - Intergenic
1014413884 6:121160042-121160064 GACAGATAGCAGTTTGGCAATGG + Exonic
1016202285 6:141427249-141427271 CACAAATACCAGTTGAGAGAAGG - Intergenic
1017743615 6:157427700-157427722 CAGAAATGGCAGATGCGCTAGGG + Intronic
1028720894 7:94029926-94029948 AACAACTAGCAGTTGGTTTATGG + Intergenic
1031205048 7:118745713-118745735 CACAAATATCTCTTGGGCAACGG - Intergenic
1032711008 7:134460125-134460147 CAGAAAGAGCAGTTGGGGTGAGG - Intergenic
1035857464 8:2991754-2991776 CATAAATAGCATTTGGTCTATGG + Intronic
1037062228 8:14528722-14528744 CAGAAATAGAAATTGGGCCAGGG - Intronic
1042045014 8:64640924-64640946 CACAAATAGAAGTTGCCCTATGG - Intronic
1047414990 8:124657244-124657266 CACAAAAAGGGGTTGGGCTGGGG + Intronic
1051598123 9:18845573-18845595 CACACATTGCAGTTGGGCAGTGG + Intronic
1052663864 9:31469746-31469768 CCCAAATAGCTGTTGGGTCAGGG + Intergenic
1059312325 9:113396983-113397005 TACAAAAAGCAGTTGGACTCAGG - Intronic
1062169235 9:135125584-135125606 AACAAATAGCATTGGGGCCAAGG - Intergenic
1187019938 X:15370626-15370648 GACAAATAGCAATTGGGCCCAGG + Intronic
1189824460 X:44902888-44902910 GACAAAAAGCAGTAGGGCAAAGG + Intronic
1195135317 X:101900561-101900583 CAAAAATATCAGTTGGGGAAAGG - Intronic