ID: 1000012889

View in Genome Browser
Species Human (GRCh38)
Location 5:157249275-157249297
Sequence CAGAAAATCGAGAAGGAAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 355
Summary {0: 1, 1: 0, 2: 2, 3: 27, 4: 325}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000012889_1000012891 25 Left 1000012889 5:157249275-157249297 CCAGCTTCCTTCTCGATTTTCTG 0: 1
1: 0
2: 2
3: 27
4: 325
Right 1000012891 5:157249323-157249345 CATAAAACCATTAAAAGCACAGG 0: 1
1: 0
2: 3
3: 31
4: 368

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000012889 Original CRISPR CAGAAAATCGAGAAGGAAGC TGG (reversed) Intronic
900970568 1:5990385-5990407 GAGAAAATCGAGAAGGCTCCAGG + Intronic
901173546 1:7282122-7282144 CAGAAAATCCAGAAGAAATGAGG - Intronic
901433384 1:9232022-9232044 CAGAACCCCGTGAAGGAAGCCGG - Intergenic
902185814 1:14724575-14724597 CACAAAACGGAGAAGGAACCAGG - Intronic
902546194 1:17191979-17192001 AAGAAAAAGGAGAAGGAAGAGGG - Intergenic
902546519 1:17193842-17193864 CAGAAAAGAGAGCAGGAGGCAGG + Intergenic
903571297 1:24307588-24307610 CAGGAAAAGGAGAAGGAAGTGGG + Intergenic
904491317 1:30861308-30861330 GAGAGAATAGAGAAGGATGCAGG - Intergenic
904967061 1:34382821-34382843 GAGAAAATCTTGAAAGAAGCTGG + Intergenic
905035130 1:34913120-34913142 CAGAAAATGGAGAAGGAAGAAGG + Intronic
905409563 1:37759072-37759094 CAGAAGATGAAGAAGGAAGATGG - Intronic
906539802 1:46576635-46576657 CAGATCATCGAGAAACAAGCAGG - Exonic
909857150 1:80549883-80549905 AAAAAAATCCAGAAGGCAGCGGG + Intergenic
910662365 1:89687570-89687592 GAGTAAATGGAGAAGGAAGTGGG + Intronic
912918023 1:113837149-113837171 AAGAAGAAAGAGAAGGAAGCAGG + Intronic
912980818 1:114369950-114369972 AAGAAAATGGAGAAGGCACCAGG + Intergenic
916808481 1:168283563-168283585 GAGAAAAGAGAGAAGGAAGAAGG - Intronic
917001379 1:170364781-170364803 CAGAAAATCAATAAAGAAACAGG - Intergenic
917067878 1:171116695-171116717 CAGAAAAGTGAGAATGAATCTGG + Intronic
917270713 1:173270427-173270449 CAGAAGGTTGAGGAGGAAGCAGG + Intergenic
920186335 1:204161633-204161655 CAAAACATTGAGAATGAAGCAGG + Intronic
921359783 1:214320040-214320062 CAGAAAAGAAAGAAGGAAGGAGG + Intronic
922358500 1:224798975-224798997 CAGAAAATAGGAAAGGAAGGGGG + Intergenic
924542973 1:244998664-244998686 CACAAAATCAACAGGGAAGCTGG + Intronic
1063303485 10:4875188-4875210 CGGAAAATCAAGAAGGAAAAAGG - Intergenic
1063706568 10:8436575-8436597 CAAAAAATGGAGAGGAAAGCAGG - Intergenic
1064310172 10:14205434-14205456 CAGAAGATCAGTAAGGAAGCTGG - Intronic
1065287466 10:24200081-24200103 CAGGAGGTAGAGAAGGAAGCAGG - Intronic
1066299987 10:34088073-34088095 CAGAAATTCTAGAAAGAGGCAGG - Intergenic
1068241381 10:54305892-54305914 CAGAAAAAAGACCAGGAAGCAGG + Intronic
1068339091 10:55677874-55677896 CAGAAAATCAACAAAGAAACTGG - Intergenic
1068788030 10:60998606-60998628 AAGAAAAACGGGAAGGAAGGGGG + Intronic
1069432362 10:68349217-68349239 CAGAGAATCGATAATGAGGCCGG + Intronic
1069702373 10:70435992-70436014 GAGAAAACCAAGAAGGAAGGAGG + Intronic
1071847380 10:89535112-89535134 CATAAAATCCAGAAGAAAGATGG + Intronic
1072100534 10:92225267-92225289 CAGAAAATGGGGTAGGAGGCTGG - Intronic
1072179522 10:92967845-92967867 CAGTAATTCCAGAAGGCAGCTGG - Intronic
1072450240 10:95533898-95533920 CAGGAAATGGCAAAGGAAGCTGG + Intronic
1072605164 10:96975218-96975240 CAGAAAAAAAAGTAGGAAGCTGG + Intronic
1073004700 10:100314422-100314444 GAGAAGAGAGAGAAGGAAGCAGG + Intronic
1073918167 10:108429873-108429895 CAGAAAAACGTGAAGCAAGGAGG - Intergenic
1074008636 10:109454828-109454850 TAGAAACTCGAGATGGAAGCTGG - Intergenic
1074792826 10:116908871-116908893 CAGTAAATGGAGAAAGAAGTTGG - Intronic
1075046281 10:119149046-119149068 CAAAAAATCGAAAAGTTAGCCGG - Intronic
1075112927 10:119602575-119602597 GTGAAAATAGAGAAGGAAGGAGG + Intergenic
1076941574 10:133613587-133613609 CAGAATATAGATAAGGGAGCTGG + Intergenic
1076946708 10:133656573-133656595 CAGAGAGTAGAGAAGGAAGTCGG + Intergenic
1078029376 11:7734229-7734251 CAGAAAATCAACAAGGAGACAGG + Intergenic
1078106761 11:8362777-8362799 GAAAAAAAGGAGAAGGAAGCTGG - Intergenic
1078444744 11:11395693-11395715 AAGAAAAGAGAGAAGGAAGGAGG + Intronic
1078928830 11:15897807-15897829 CAGCAAGCCGAGAAGGAAGAGGG - Intergenic
1079659501 11:23021006-23021028 CAGACAACCCAGAAGGAAGAAGG - Intergenic
1079966351 11:26984828-26984850 CAGAAAGTGGAAAGGGAAGCAGG - Intergenic
1080715336 11:34794628-34794650 CAGAATATCGAGAGAGAAGCAGG + Intergenic
1081383466 11:42443986-42444008 CAGAAACTAGAGAATAAAGCAGG - Intergenic
1082580130 11:54855844-54855866 CAGATAATAGAAAAGGCAGCTGG - Intergenic
1083048419 11:59755984-59756006 CAGGAAAGGGAGAAGGAGGCTGG - Intronic
1083209017 11:61171080-61171102 CAGAAAAACTAGAGGGAAGCAGG + Intergenic
1083948179 11:65937757-65937779 CAGTAAATAGAGTAGGAATCAGG - Intergenic
1084728660 11:71059257-71059279 CTGAAAATCTAGAAGGAAATAGG + Intronic
1085871233 11:80351647-80351669 CAGAAAATATAAAAGCAAGCTGG - Intergenic
1086005971 11:82036238-82036260 GAGAAGATCTGGAAGGAAGCAGG - Intergenic
1087264125 11:96042415-96042437 GAGAAAAAAGAGAAGGCAGCTGG - Intronic
1087696478 11:101382775-101382797 CAGAGAAGCGAAAGGGAAGCAGG - Intergenic
1088011157 11:105002420-105002442 AAGAAAAAGGAGAAGGAAGGGGG - Intronic
1088086259 11:105984267-105984289 GAGAAAATGGACAAGGAGGCAGG - Intergenic
1089627312 11:119759619-119759641 GAGAAAATGGAGCAGGAAGAAGG + Intergenic
1092586490 12:9906211-9906233 CAGAAAACCAAGAAGGAAAATGG - Intronic
1092857137 12:12684782-12684804 AAGAAAATAGAGAAGGAAGGAGG - Intronic
1093769089 12:22998901-22998923 CTGAACATCGAAGAGGAAGCTGG + Intergenic
1094115334 12:26905503-26905525 CAGAAAATGGAAAAGCCAGCCGG - Exonic
1094303221 12:28989498-28989520 CAGAGAATAGAAAAGGAAACAGG - Intergenic
1094771252 12:33662762-33662784 CAGTGAATCCAGAGGGAAGCAGG + Intergenic
1095772081 12:45971147-45971169 CATTAAATGAAGAAGGAAGCAGG - Intronic
1096368016 12:51044989-51045011 CAGAGAAGATAGAAGGAAGCTGG + Intergenic
1096633118 12:52942249-52942271 CAACAAACCGATAAGGAAGCTGG + Intronic
1096730142 12:53603495-53603517 CAGCAAATTTAGAAGGAAGCAGG - Intronic
1099367983 12:81793123-81793145 GAGAAAACAGAGAATGAAGCAGG + Intergenic
1101590296 12:106119534-106119556 CAGAAAATCTGTAGGGAAGCTGG + Intronic
1102142617 12:110628022-110628044 CAGAAGAGAGAGAAGGAAGCAGG - Intronic
1102282333 12:111628185-111628207 TAGAAAAGGGAGAAAGAAGCTGG + Intergenic
1102688563 12:114742695-114742717 CAGAAAAGAGAGATGGAGGCAGG + Intergenic
1103399977 12:120637225-120637247 CAGAAACTGGAGAGGAAAGCAGG - Intergenic
1103402577 12:120653373-120653395 CACAGTATGGAGAAGGAAGCTGG + Intronic
1103586449 12:121959784-121959806 CAGAAAACTGAAAAGGTAGCGGG - Intronic
1104071765 12:125352015-125352037 CAGAAAATATAGATGGCAGCAGG - Intronic
1104236906 12:126947692-126947714 GAGAAAAGGAAGAAGGAAGCTGG - Intergenic
1106181690 13:27374730-27374752 CAGAAAACTGAGAAGTAGGCAGG - Intergenic
1107859501 13:44647508-44647530 CAGCAAACTGAGAAGGAAGAGGG + Intergenic
1109339549 13:61038389-61038411 CAGAAAATCTAGAGGGTGGCAGG + Intergenic
1109373688 13:61459626-61459648 CAGAAAATGAAGAAGGAAAGAGG - Intergenic
1110278721 13:73668001-73668023 CGGAAGATAAAGAAGGAAGCAGG - Intergenic
1110323001 13:74181384-74181406 CAGAAAATTGAGAATGAGGCTGG + Intergenic
1112187598 13:97142911-97142933 CAAAAAAATGAGAAGGTAGCAGG + Intergenic
1112245068 13:97725869-97725891 TAGAAAATCGAAAAAGAGGCAGG + Intergenic
1113684339 13:112271792-112271814 CAGTTAAGCGAGAAGGAAGGTGG - Intergenic
1114411483 14:22504684-22504706 CAAAAAAAGAAGAAGGAAGCTGG + Intergenic
1114814390 14:25939664-25939686 CACAAAATCCAGAAAGATGCTGG + Intergenic
1117172718 14:53117148-53117170 CAGAAAATCTAGAAGAAATAGGG + Intronic
1118993165 14:70813823-70813845 GAGAAAAACAGGAAGGAAGCAGG + Intergenic
1119592766 14:75905600-75905622 TGGAAACTTGAGAAGGAAGCTGG + Intronic
1120628006 14:86853374-86853396 CTGAAAGTTGAGAAGGATGCAGG + Intergenic
1120955688 14:90079930-90079952 CTGAAAGTGGAGAAGGAAACAGG + Intronic
1121042310 14:90759114-90759136 CAGAAGAGCAGGAAGGAAGCTGG - Intronic
1121097358 14:91226961-91226983 CATGAAATTGAGAAGGAGGCTGG + Intergenic
1122579952 14:102765316-102765338 TAGAAAATAGTGGAGGAAGCTGG + Intergenic
1123105273 14:105838520-105838542 CTGGAAATTGAGAAAGAAGCCGG + Intergenic
1123190591 14:106565637-106565659 CAGAAAAGCGCGCAGGAGGCCGG - Intergenic
1123678627 15:22739369-22739391 CAGAAACTCTAAAAGGAAGGAGG - Intergenic
1124213033 15:27779303-27779325 CAGAAAATCCAGAAAGCAACAGG - Intronic
1124330831 15:28813650-28813672 CAGAAACTCTAAAAGGAAGGAGG - Intergenic
1125387488 15:39153840-39153862 CAGAAAGTGGAGAAGAGAGCAGG + Intergenic
1126811776 15:52413833-52413855 TAAATAATAGAGAAGGAAGCAGG + Intronic
1126880498 15:53090300-53090322 TAGAAAATGAAGAAGGAAGAAGG - Intergenic
1128682307 15:69660969-69660991 CAGAACATTGAGATGGAAGCTGG + Intergenic
1129179068 15:73860201-73860223 CAGATAAACTTGAAGGAAGCAGG + Intergenic
1129224150 15:74156684-74156706 CAGGAGACAGAGAAGGAAGCTGG + Intergenic
1129376545 15:75137334-75137356 GAGAAAATGGAGATGGACGCAGG - Intergenic
1130541457 15:84823275-84823297 CAAAAAAGCAAGAAGGAAGTAGG - Intronic
1131310667 15:91287396-91287418 CAGAAAGGTGGGAAGGAAGCAGG - Intronic
1131833303 15:96367832-96367854 GAGAAAATTCAGAAGGAAGGGGG + Intergenic
1131903921 15:97119971-97119993 CAGAAAATCAATCAGGAAGCAGG + Intergenic
1132165382 15:99582360-99582382 AAGGAAATCAAGAAGAAAGCGGG - Intronic
1132805328 16:1772647-1772669 CTGCAAAGCCAGAAGGAAGCGGG + Intronic
1138282527 16:55783016-55783038 CAGAAAAAGGAGAAGGAAATTGG + Intergenic
1138286414 16:55813603-55813625 CAGAAAAAGGAGAAGGAAATTGG - Intronic
1140723120 16:77788722-77788744 CAAATGATCGAGAAGGAGGCAGG + Exonic
1140814735 16:78610992-78611014 CAAAAAACCAAGTAGGAAGCAGG + Intronic
1141419437 16:83903215-83903237 CAGAAACTAGAGAAGGGACCTGG + Intronic
1142169965 16:88616582-88616604 CTGATAAGGGAGAAGGAAGCAGG - Intronic
1143794586 17:9326416-9326438 TAGAAAACAGGGAAGGAAGCTGG - Intronic
1144437695 17:15256101-15256123 TAGAAAAACGAGAAGGCAGGCGG + Intronic
1146187085 17:30731244-30731266 CAGAAAGCTGAGAAGGAATCCGG - Intergenic
1146332120 17:31936604-31936626 CAGAAAGCTGAGAAGGAATCCGG - Intergenic
1148371118 17:47100393-47100415 CAGAAAGGGGAGAGGGAAGCTGG + Intergenic
1148686766 17:49505454-49505476 CAGAATAAGGAGAAGGAGGCTGG - Intronic
1150182730 17:63142131-63142153 CAGAAAATTAAGAAAGAAGTTGG - Intronic
1150425768 17:65075843-65075865 CAGAAGGGCAAGAAGGAAGCAGG - Intergenic
1150867570 17:68869968-68869990 CAGAAAAATGTGAAGGAAACTGG - Intronic
1151315596 17:73320147-73320169 CAGTAAAAAGAGAAGGAAGGAGG - Intergenic
1151512191 17:74567662-74567684 CAGAAAATCCAGATGGCAGCTGG - Intergenic
1152047541 17:77947482-77947504 AGGAAAATCAAGAAGGAAGAGGG + Intergenic
1152329898 17:79666588-79666610 CAGAAAAGAGAGAATGAGGCTGG + Intergenic
1153096981 18:1418286-1418308 CAGAGAAATGAGAAGGGAGCTGG + Intergenic
1153813868 18:8776265-8776287 GAGGAAAGCTAGAAGGAAGCAGG - Intronic
1155081189 18:22411607-22411629 CAGGAGAGCTAGAAGGAAGCTGG - Intergenic
1156629595 18:38951110-38951132 GATAAAATAGAGAAGGAAGGAGG + Intergenic
1156759001 18:40564163-40564185 CAGACAGCAGAGAAGGAAGCTGG - Intergenic
1157436605 18:47675534-47675556 CTGAAAATTGAGAAATAAGCAGG - Intergenic
1157912571 18:51631315-51631337 AAGAAAATGGAGAAGGCACCAGG + Intergenic
1158286132 18:55885380-55885402 CAGAAAATAGTGAAGGAAATGGG + Intergenic
1159952064 18:74491895-74491917 CAGAAAATGTAGATGGAAGTGGG + Intergenic
1162715928 19:12633481-12633503 CAGGAAAATGAGCAGGAAGCAGG - Intronic
1163508419 19:17721379-17721401 CAGAACATCTAGAATGAACCGGG + Intronic
1166079269 19:40433816-40433838 CAGAAAATGGAGACGGAGCCAGG + Intergenic
1167204442 19:48091109-48091131 CAGAAAATCTAGAATAAACCTGG + Intronic
925034555 2:675802-675824 CAGGAAAGGGAGAAGGAACCAGG + Intronic
925115918 2:1378310-1378332 CAGAAACTGGAGAGGGAACCAGG - Intronic
925417490 2:3680830-3680852 CAGTAAATCAAGTTGGAAGCAGG + Intronic
926971889 2:18474783-18474805 CAGATAATAGGGTAGGAAGCAGG + Intergenic
928321616 2:30287915-30287937 CTGAAAATGGAGATGGAAGATGG - Intronic
928963651 2:36955367-36955389 AAGAAAATCGAGAGGGAGGAGGG + Intronic
930756336 2:54977268-54977290 CAGAAAAATTAGAAGGAAGTGGG - Intronic
931134616 2:59383671-59383693 CAGACAATTGAGAGGGAAGGAGG + Intergenic
932273931 2:70436985-70437007 CAGATTATCAAGAAGGAAACAGG + Intergenic
932740922 2:74290733-74290755 CAGAACCTCAAGCAGGAAGCCGG + Intronic
933873390 2:86593053-86593075 CAGAAAAGCGAGCAGTGAGCTGG - Intronic
935523238 2:104135553-104135575 CAGGAAAGAGAGAAGGCAGCAGG + Intergenic
936950011 2:117968229-117968251 CAGAAGAAAGAAAAGGAAGCTGG - Intronic
938003207 2:127763420-127763442 TAGAAAATAGAGAAGGAACATGG - Intronic
938028764 2:127973534-127973556 TAGAAAATTCTGAAGGAAGCCGG - Intronic
938143808 2:128817701-128817723 CAGAAAATAGAGAAAGAAACCGG - Intergenic
939603470 2:144222807-144222829 CAGAAAAAAGAAAAGAAAGCTGG + Intronic
940988199 2:160070939-160070961 AAGAAAATAGAGAAGGTAGCAGG - Intergenic
941530217 2:166660616-166660638 ATGAAGATGGAGAAGGAAGCAGG + Intergenic
941992658 2:171572276-171572298 CAGCAAATAAAGTAGGAAGCAGG + Intergenic
942286395 2:174421708-174421730 CAGAAAATGGGGAGGGAACCTGG - Intronic
942515227 2:176745658-176745680 CAGAAAACTGAAAAGGAAGAGGG + Intergenic
942706100 2:178774367-178774389 CAGAAAATATAGAAGGAAAATGG - Exonic
943034484 2:182725206-182725228 GAGAAAAGGGAGAAGGAAGAGGG - Intronic
943976915 2:194493655-194493677 CAGAGAAAAGAGAAGGAAGCTGG + Intergenic
944531706 2:200674033-200674055 CAGAACATCCAGAACCAAGCAGG + Intronic
945426162 2:209705860-209705882 CAGAAAATCCAGAATGTAGATGG + Intronic
946035209 2:216736562-216736584 CACCAAATTGAGAAGGAAGGGGG + Intergenic
946983483 2:225245898-225245920 CAACAAATTCAGAAGGAAGCTGG + Intergenic
947394912 2:229676802-229676824 CATGAAATGGAGAGGGAAGCAGG - Intronic
947499388 2:230660866-230660888 CAGAGAATCAGGAAGGAAGCTGG - Intergenic
947761014 2:232604073-232604095 AAGAAAATCAAGAAGGAAGGAGG - Intergenic
948516221 2:238505407-238505429 CTGAGAACCGAGAAGGAACCAGG - Intergenic
949050412 2:241894826-241894848 CAGGCAAGCGAGAAGGAAGTGGG - Intronic
1169129253 20:3156108-3156130 CAGAAAATCCATAGGAAAGCTGG + Intronic
1170699278 20:18688825-18688847 CAGAATATTGAGTAGGAAGCAGG + Intronic
1171084275 20:22222833-22222855 TAGAAAATCGGAAAGGTAGCCGG + Intergenic
1172358316 20:34294946-34294968 CAGAGAGTCAAGAAGCAAGCTGG - Intronic
1172574456 20:35996967-35996989 CAGGAAATGGAGAATGAAGAAGG - Intronic
1173343344 20:42175083-42175105 AAGAACATGGAGAAGGAAGAGGG - Intronic
1173909650 20:46656874-46656896 CAGCAAATGGAGAAGGCAGAAGG - Intronic
1173994232 20:47325480-47325502 CAGCAAATCAGGAAGGCAGCAGG + Intronic
1173996295 20:47341237-47341259 GAGAAAATCTAGAAGCAAGGTGG + Intronic
1174199050 20:48794356-48794378 CAGAGAGTCCTGAAGGAAGCTGG + Intronic
1176293372 21:5058129-5058151 CAGAAAACCCAGAAGGGAGATGG + Intergenic
1177038590 21:16076885-16076907 TAGAAAATTGAGAAAGAAACTGG - Intergenic
1178310936 21:31529483-31529505 GAGTAAACAGAGAAGGAAGCAGG + Intronic
1178335631 21:31740178-31740200 TAGAAAATAGAGAAGGAGGTCGG - Intergenic
1178929258 21:36803300-36803322 GAGACCATGGAGAAGGAAGCTGG - Intronic
1179297901 21:40079629-40079651 CAGGAACTCCAGAAGGAAGGAGG - Intronic
1179863888 21:44205519-44205541 CAGAAAACCCAGAAGGGAGATGG - Intergenic
1181884098 22:26005529-26005551 CTGAAAAGCAAGAAGGAAGATGG - Intronic
1184987885 22:48147762-48147784 CAGAAAAAAGAGAATGGAGCTGG - Intergenic
949614303 3:5737053-5737075 GAGCAAATGGAGAAGGATGCAGG + Intergenic
949900270 3:8808531-8808553 CACAAAAGCTAGAAGGAAGAAGG + Intronic
950509454 3:13417030-13417052 CAAAATATCTAGAAGGAATCAGG + Intronic
951636716 3:24786814-24786836 CAGTAAAGGGAGAAGGAAACAGG - Intergenic
951884733 3:27513256-27513278 AAGAAAATGGAGGAAGAAGCTGG + Intergenic
951920340 3:27847858-27847880 CAGAAAACCAAGAATGCAGCTGG + Intergenic
952489248 3:33850784-33850806 CAGAAACTCTAAAAGGAAGGAGG - Intronic
953604746 3:44404433-44404455 CAGAAAAAGGCTAAGGAAGCAGG - Intronic
954431143 3:50471441-50471463 CAGAAGAGGAAGAAGGAAGCTGG - Intronic
955226225 3:57062492-57062514 CAGAGAAGAGGGAAGGAAGCAGG + Intronic
956615940 3:71172726-71172748 CAGTGAATCCAGAAGGAAGAGGG - Intronic
957928568 3:86847283-86847305 CAGGAAAGGGAGAAGGAAGAGGG - Intergenic
958205758 3:90388448-90388470 CATAAAAACTAGAAGGAAGGAGG - Intergenic
958479506 3:94628537-94628559 CAGAAAGCTGAGAAGGAAGTAGG + Intergenic
960340494 3:116469134-116469156 CTGAATTTCGAGAAGGGAGCTGG - Intronic
960603938 3:119485836-119485858 CTGAAAATGAAGAAGGGAGCAGG + Intronic
960775386 3:121245886-121245908 CAAAAGATCAAGAAGGAAACAGG + Intronic
960871407 3:122253537-122253559 TAGAAAATATAGAATGAAGCTGG - Intronic
961408304 3:126699017-126699039 GAGAAAACCGAGGAGCAAGCAGG - Intergenic
962551468 3:136496877-136496899 GAGAAAAGCGGGAAGGAAGCAGG + Intronic
963441820 3:145349574-145349596 TAGAAAATTGAGAAGCAAGCAGG + Intergenic
964139820 3:153384835-153384857 CAGAAAAAACAGAAGCAAGCAGG + Intergenic
964211843 3:154237249-154237271 CTGAAAATTGAAAAAGAAGCTGG + Intronic
965431636 3:168596267-168596289 CAGAAAATAGAAATGGCAGCAGG - Intergenic
967732056 3:192916340-192916362 AAGAAAACCTAGAAGGAAGAAGG + Intronic
969692899 4:8715435-8715457 CAGAAAATAGAGGAGGAGGAAGG - Intergenic
969927947 4:10602820-10602842 AAGAAAAACGAGGAAGAAGCTGG + Intronic
970949787 4:21741294-21741316 GATAAACTCGAGAAGGAAGTAGG + Intronic
971094666 4:23387296-23387318 CAGGAAATGGAGAAGGGTGCAGG - Intergenic
971199065 4:24495452-24495474 CAGGAAAGGAAGAAGGAAGCAGG + Intergenic
974218012 4:58926161-58926183 CAGAAAATTGATAAAGAAACAGG + Intergenic
975176292 4:71293265-71293287 CATAAAATCCAGAAGGAGGCTGG + Intronic
976247093 4:83015162-83015184 CAGAAACTCAATAAGGAGGCAGG + Intergenic
977534176 4:98237795-98237817 CAGAAAAGGGTGAAGGAAGAAGG + Intergenic
978345014 4:107757462-107757484 GAGGAAAGCGAAAAGGAAGCAGG - Intergenic
980096241 4:128494013-128494035 CAGAAAAGAAAGAAGGAAGAGGG - Intergenic
980658738 4:135827580-135827602 TAGAAAATAGATAAGAAAGCAGG - Intergenic
981743297 4:148026337-148026359 CAGAAAACCCAGCATGAAGCCGG + Intronic
981817098 4:148843097-148843119 CAGGAAGAGGAGAAGGAAGCAGG - Intergenic
982035845 4:151344939-151344961 GAGAAAATCAAGAAGGAAGAAGG - Intergenic
982063790 4:151632434-151632456 CAGAAGATAAAGAAGGAAACAGG + Intronic
982099268 4:151952470-151952492 CAGAAAATCCAAAATGAAACGGG + Intergenic
982515390 4:156340863-156340885 CAGAATGTAAAGAAGGAAGCAGG + Intergenic
984137847 4:175963383-175963405 GAGAAAATCTTGAAAGAAGCCGG + Intronic
985096406 4:186416933-186416955 CAGGAGACAGAGAAGGAAGCTGG + Intergenic
985450164 4:190057372-190057394 CAGAGAGTAGAGAAGGAAGTCGG + Intergenic
986063342 5:4212342-4212364 CAGGAAGTTGAGGAGGAAGCTGG + Intergenic
986145882 5:5077285-5077307 CAGAACATCTAGAAGCAAGGGGG + Intergenic
987047919 5:14124828-14124850 AAAAAAATGGAGAAGGAGGCCGG + Intergenic
987498849 5:18680615-18680637 TAGAAAATTGAGAAGTGAGCCGG + Intergenic
987617848 5:20299856-20299878 CAAATAGTCAAGAAGGAAGCTGG + Intronic
989236724 5:39156426-39156448 CAGCAAAACCAGAGGGAAGCAGG + Intronic
989510864 5:42286515-42286537 GAGAAGACAGAGAAGGAAGCAGG + Intergenic
990503119 5:56416747-56416769 CAGAAAAGGGAATAGGAAGCAGG + Intergenic
990503359 5:56419743-56419765 CAGAAAAGAGAATAGGAAGCAGG - Intergenic
990563773 5:57008778-57008800 CAAAAAATAGAGAAGTTAGCTGG + Intergenic
990979847 5:61592722-61592744 AAGAAAATGGTGAAGGATGCTGG + Intergenic
991527098 5:67571998-67572020 CAGAAAATCAATAAGAAAACAGG - Intergenic
992089494 5:73304346-73304368 CAGAAAATCGGAAAGGCAGAAGG + Intergenic
992096770 5:73370087-73370109 CAGAAATATGTGAAGGAAGCTGG + Intergenic
992312813 5:75519421-75519443 CAGAAAATCAACAAAGAAACAGG - Intronic
992689032 5:79225493-79225515 GAGGAAAATGAGAAGGAAGCTGG - Intronic
993407652 5:87531538-87531560 CACAAAAGAGAGAAGGAAGGAGG - Intergenic
994827172 5:104728529-104728551 CAGAAAATCTAGAAACAAACTGG + Intergenic
995077216 5:108000117-108000139 CAGCAAATCTAGAAGGGAGGAGG - Intronic
995168179 5:109072860-109072882 CAGAAAAGCTAGGAAGAAGCAGG - Intronic
995345694 5:111114310-111114332 GAGAAAAATGAGAAGGAAGGTGG + Intronic
995654846 5:114414083-114414105 CAGAAAATCCAGCAGGAAGTAGG - Intronic
996551625 5:124736399-124736421 CAGGAAATCCAGAAGTAAACTGG + Intronic
997621044 5:135295621-135295643 GAGAAAATACAGAAGGAACCTGG - Intronic
997925509 5:138027336-138027358 CAGAAAAGCCAGCAGGAAGCTGG + Intronic
998778386 5:145628966-145628988 CAGAAAATGGGCAAGGAAGGTGG + Intronic
999471987 5:151863240-151863262 CAGAAAGTACAGAAGGTAGCAGG + Intronic
999875720 5:155803577-155803599 CAGAGAAGAGAGAGGGAAGCAGG + Intergenic
999936722 5:156494721-156494743 CAGAAAAGTGGGAAGGAAGAAGG - Intronic
999972949 5:156883187-156883209 GAGACAGTGGAGAAGGAAGCAGG + Intergenic
1000012889 5:157249275-157249297 CAGAAAATCGAGAAGGAAGCTGG - Intronic
1000451524 5:161394808-161394830 CAGAAAATAGAGAAGGAAGATGG + Intronic
1001979159 5:176026390-176026412 CAGAAAATTAACAAGGAAACTGG - Intronic
1002238257 5:177817373-177817395 CAGAAAATTAACAAGGAAACTGG + Intergenic
1002380198 5:178822142-178822164 CAGAAAATTAACAAGGAAGCTGG - Intergenic
1003177060 6:3759730-3759752 CAGAAAGTCAAGAATGAGGCTGG - Intergenic
1008737911 6:54569460-54569482 CAGAAAATATTGAAAGAAGCTGG - Intergenic
1011125420 6:84002386-84002408 CAGCAAATGGGGAAGGAAGAGGG - Intergenic
1012479760 6:99653497-99653519 GAGAAAAGAGAAAAGGAAGCAGG + Intergenic
1013570735 6:111422241-111422263 TAGAAAATCAGGCAGGAAGCAGG - Intronic
1013585384 6:111573845-111573867 CAGAAGATGGAGAAGAAAGGGGG + Intronic
1013853694 6:114545669-114545691 CTGAAGATAGAGAAGGAATCAGG + Intergenic
1013881213 6:114903422-114903444 TAGAAAATCTAGAAGAAATCCGG + Intergenic
1015515951 6:134082753-134082775 CAGTAAATAAAGTAGGAAGCAGG + Intergenic
1016365261 6:143308991-143309013 GAGAAAATCTTGAAAGAAGCTGG + Intronic
1016774125 6:147885591-147885613 CAAAAAATTTAGAAGCAAGCAGG + Intergenic
1017026432 6:150185387-150185409 CAGGAAATCGATGAGGTAGCTGG - Intronic
1017095333 6:150799855-150799877 CGCAAAATGTAGAAGGAAGCAGG - Intronic
1019860448 7:3653585-3653607 CAGGAAATGGAGAGGGAAGGAGG + Intronic
1021440656 7:20670607-20670629 GAGAAAAACAAGAAGCAAGCTGG + Intronic
1023552184 7:41382271-41382293 GAGAAAATGGAAAAGGAAGGAGG - Intergenic
1023648218 7:42341441-42341463 CAGAAAAAGGATAAGGAAGAAGG - Intergenic
1024839033 7:53562670-53562692 CAGAAAATTGATAAGAAAGTAGG - Intergenic
1026127701 7:67594116-67594138 AGGAGAATCGAGAAGGAGGCAGG - Intergenic
1030575661 7:111282924-111282946 CAGAAGATCAACAAGGAAACAGG + Intronic
1031216672 7:118901390-118901412 CAGAAAATGGGGAATGAAGGTGG - Intergenic
1032372510 7:131371933-131371955 CAGAAAATCAAGAAGGCAACAGG - Intronic
1035761091 8:2069399-2069421 CAGAAAAGAGAAAAGGAGGCGGG - Intronic
1035867523 8:3100929-3100951 CAGCACATATAGAAGGAAGCTGG + Intronic
1038587582 8:28804083-28804105 CAAAAAATCAAGAAAGAAGCTGG - Intronic
1039968083 8:42298368-42298390 GAGCAGCTCGAGAAGGAAGCAGG - Intronic
1040654247 8:49486416-49486438 CAGAAAAGGGAGAGGCAAGCTGG - Intergenic
1040875076 8:52142245-52142267 CAGAGAATCCAGGTGGAAGCTGG + Intronic
1041686375 8:60648746-60648768 CAGAAGATGGAGAAGGGAGGAGG - Intergenic
1044513733 8:93114289-93114311 GAGGAAATCCAGGAGGAAGCAGG - Intergenic
1044946701 8:97396294-97396316 CAGAAGATGGGGAGGGAAGCGGG - Intergenic
1044985132 8:97750195-97750217 CAGAAATTCGTGATGGTAGCTGG + Intergenic
1045981165 8:108189685-108189707 CAGTTTATTGAGAAGGAAGCAGG - Intergenic
1047132741 8:122039088-122039110 CAGAGTGTTGAGAAGGAAGCGGG - Intergenic
1047835783 8:128689149-128689171 GAGGAAATGGAGTAGGAAGCTGG + Intergenic
1048151732 8:131901305-131901327 AAAAAAATCAAAAAGGAAGCGGG + Intergenic
1048608827 8:135999800-135999822 CAGCAGATAGAGAAGGAAGTAGG - Intergenic
1048752768 8:137698395-137698417 AAGAAAACCAAGAAGAAAGCAGG + Intergenic
1049120058 8:140728411-140728433 CTGAAAATCCAGAAGGGACCTGG - Intronic
1050381767 9:5038380-5038402 CAAAAAATAGAAAAGGAAGGAGG + Intronic
1050768185 9:9162600-9162622 GAGAAAATGGAGATGCAAGCAGG - Intronic
1053872986 9:42513380-42513402 CAGAAAATCTACAAAGAAGTGGG - Intergenic
1055142344 9:72889847-72889869 CAGAAAAGTAAGAAGGAAGGTGG - Intergenic
1057146226 9:92761059-92761081 CAGCAAGTCCAGAAGGCAGCAGG + Intronic
1058931286 9:109721702-109721724 CAGACAATGGAGAAAGAAGCGGG - Intronic
1059302725 9:113328055-113328077 CAGAAGAAGGAGAAGCAAGCTGG + Intronic
1188179972 X:27043339-27043361 CAGAAAATCTTGAATGAATCTGG - Intergenic
1188670864 X:32880118-32880140 CAAAAAATTGAAAAGGATGCGGG - Intronic
1188958422 X:36462147-36462169 AAGAAAAGCTAGAAGGAAGGAGG + Intergenic
1189964587 X:46359287-46359309 CAGAAAATCAACAAAGAAACAGG - Intergenic
1192156013 X:68747127-68747149 GAGAGAGTCGAGAGGGAAGCAGG + Intergenic
1193275333 X:79579841-79579863 CAGAAGAAAGAGAAAGAAGCAGG - Intergenic
1193319181 X:80099941-80099963 AAGAAAATGGAGAAGGCACCAGG + Intergenic
1195447852 X:104974605-104974627 CATCAAATAAAGAAGGAAGCTGG + Intronic
1195582687 X:106525940-106525962 CAGAAAATCAATAAAGAAGCAGG - Intergenic
1196334285 X:114512840-114512862 CAAAAAATGGAGAAGGTAGAGGG + Intergenic
1196519557 X:116657119-116657141 CAGAAAAGAGGGAAGGAATCTGG + Intergenic
1196583469 X:117402402-117402424 CTCAAAATGGAGAAGGAAGATGG - Intergenic
1196769799 X:119282107-119282129 AAGAAAATGGAGAGGGAGGCCGG - Intergenic
1196872137 X:120122744-120122766 CATAAAAGAGAGAAGCAAGCAGG + Intergenic
1196934275 X:120714088-120714110 CAGAAAATGGGGAAGGCAGAAGG - Intergenic
1197908765 X:131456980-131457002 GAGAAAATCTTGAAAGAAGCCGG + Intergenic
1198585261 X:138113741-138113763 CAGAAAATCAAGAAATAAGGTGG - Intergenic
1198626921 X:138586415-138586437 CAAAAAATAAAGAGGGAAGCAGG - Intergenic
1198640958 X:138756252-138756274 CAGAGAAAAGAGAAGGCAGCTGG + Intronic