ID: 1000021484

View in Genome Browser
Species Human (GRCh38)
Location 5:157322708-157322730
Sequence CAGTGCCAGGCATGTGATGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000021476_1000021484 28 Left 1000021476 5:157322657-157322679 CCTGTGGCAGGGATGGTGGGTCA 0: 1
1: 0
2: 2
3: 41
4: 458
Right 1000021484 5:157322708-157322730 CAGTGCCAGGCATGTGATGGGGG No data
1000021475_1000021484 29 Left 1000021475 5:157322656-157322678 CCCTGTGGCAGGGATGGTGGGTC 0: 1
1: 1
2: 3
3: 30
4: 311
Right 1000021484 5:157322708-157322730 CAGTGCCAGGCATGTGATGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000021484 Original CRISPR CAGTGCCAGGCATGTGATGG GGG Intronic
No off target data available for this crispr