ID: 1000023857

View in Genome Browser
Species Human (GRCh38)
Location 5:157342191-157342213
Sequence TCCCTTCTGTTTGCAGCAGG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 233
Summary {0: 1, 1: 0, 2: 2, 3: 17, 4: 213}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000023857 Original CRISPR TCCCTTCTGTTTGCAGCAGG AGG Exonic
900725756 1:4215515-4215537 CCTCTCCTGTTTGCATCAGGAGG - Intergenic
902885486 1:19401832-19401854 TCCCCTCTGGGTGGAGCAGGGGG - Intronic
903012303 1:20339771-20339793 TGCCTTCTGATTGCATCAAGTGG - Intronic
903366026 1:22805883-22805905 GCCCATTTGTATGCAGCAGGGGG + Intronic
904078368 1:27856726-27856748 TCCCTTCCCTTCTCAGCAGGTGG - Intergenic
906732342 1:48093848-48093870 TACCTTCTATGTGCACCAGGTGG + Intergenic
907100180 1:51825343-51825365 TCCTTTCTGTTTGCATCAGAAGG + Exonic
907476023 1:54706191-54706213 TTCCCTCTGACTGCAGCAGGGGG + Intronic
909056469 1:70826633-70826655 TCCCTTCTGACTCCTGCAGGAGG - Intergenic
911440605 1:97921169-97921191 TCCCTTCTGCTTGCAGGCTGGGG - Intergenic
912484182 1:110011539-110011561 TTCCTTCTGTTCTCAGCATGTGG + Intronic
912992998 1:114508235-114508257 TCCTTTCTTTTTGAAGGAGGGGG - Intronic
917371318 1:174297452-174297474 TTCGCCCTGTTTGCAGCAGGAGG - Intronic
917822789 1:178782340-178782362 TCACTTCTGCTTCTAGCAGGAGG + Intronic
918000167 1:180486278-180486300 TCCCTGCTGTGACCAGCAGGTGG - Intronic
918352370 1:183670390-183670412 TCCCTTATGATTCCAGCAGGGGG - Intronic
920572922 1:207031545-207031567 TCCCTCTTCTCTGCAGCAGGAGG + Intronic
922727346 1:227928562-227928584 TCCCTTCAGTTGGCTGCATGTGG - Intronic
1063106234 10:2995078-2995100 TCCCTTTTGCATGGAGCAGGGGG + Intergenic
1063868612 10:10393947-10393969 TCCTTTCTCTTTGATGCAGGAGG + Intergenic
1067153306 10:43753693-43753715 GCCCTTCTTGTTGCAGCAGGAGG + Intergenic
1067945119 10:50684362-50684384 TTCCTTCTGTTTCCAGGTGGAGG + Intergenic
1068492256 10:57738344-57738366 TCCCTTCTATGTGGAGCAGTTGG - Intergenic
1070398133 10:76030874-76030896 TCCCTTCATTTTCCACCAGGTGG + Intronic
1070765477 10:79053803-79053825 TCACAGCTGTTAGCAGCAGGAGG - Intergenic
1070866624 10:79711234-79711256 TTCCTTCTGTTTCCAGGTGGAGG + Exonic
1070880413 10:79849355-79849377 TTCCTTCTGTTTCCAGGTGGAGG + Exonic
1071633536 10:87233457-87233479 TTCCTTCTGTTTCCAGGTGGAGG + Exonic
1071646983 10:87365673-87365695 TTCCTTCTGTTTCCAGGTGGAGG + Exonic
1074224871 10:111474978-111475000 TCCCTCCTGTTTCCAGCGAGAGG + Intergenic
1074243843 10:111668009-111668031 TGTCTTATGTTTCCAGCAGGGGG + Intergenic
1074449371 10:113546722-113546744 TCTCTTCTTTTTGCAGAAGCAGG - Intergenic
1074665195 10:115714431-115714453 TTCGTGCTGTTTGCAGCGGGAGG - Intronic
1074789573 10:116873276-116873298 TCCATTCTATTAGCAGCAGCAGG + Intronic
1075030703 10:119022973-119022995 TCCCTGCTGTCTGCAGGGGGAGG - Intergenic
1077136796 11:1003663-1003685 ACCCTTGTGTTTTCTGCAGGTGG + Intronic
1078427964 11:11266582-11266604 TCCCTCCTGTTTGGAGCTGAAGG + Intergenic
1078591359 11:12642895-12642917 TCTCTTCTGCTAGCAGCACGAGG - Intergenic
1078959860 11:16252585-16252607 TCCCGTGTGATTCCAGCAGGGGG + Intronic
1079363639 11:19790796-19790818 TCCTTTCTGTTTGCAAAAGGGGG + Intronic
1083171703 11:60927274-60927296 ACACTTCCGTGTGCAGCAGGTGG + Exonic
1084477158 11:69395587-69395609 GCCCTGCTGTCTGCAGCAAGAGG - Intergenic
1084767143 11:71319875-71319897 TCCCTTCTGCTTTCAGGAGAAGG + Intergenic
1085346901 11:75774090-75774112 TCACCTGTGTCTGCAGCAGGAGG + Intronic
1085507705 11:77069611-77069633 ACCCTGCTCTTTGCAGCTGGGGG - Intronic
1087874074 11:103334855-103334877 ACCCTTCTCTCTGCAGCATGTGG - Intronic
1088298720 11:108330796-108330818 TCCCATATTTCTGCAGCAGGGGG - Intronic
1088452777 11:109999596-109999618 TCCCTTCTTTTTGCCACAGGAGG + Intergenic
1089016760 11:115171736-115171758 TCCCTCTTGTCTGCAGCATGAGG - Exonic
1089143403 11:116306425-116306447 ACCCTTCTCTTTGTAGCAGAAGG + Intergenic
1090269247 11:125374381-125374403 TCCCTGCTTTTTGAAGCAGCTGG + Intronic
1090474711 11:127009485-127009507 TCTCTTCTCTCTGCAGCATGAGG - Intergenic
1091437751 12:486144-486166 CCCCTTCTACTTCCAGCAGGGGG + Intronic
1094756802 12:33480260-33480282 TCCATTCTTTTTGCAGCAAATGG + Intergenic
1097334783 12:58370079-58370101 GCCCAGCTGTTTGCGGCAGGAGG + Intergenic
1100548774 12:95627614-95627636 TGCCTTCTTTTTGAGGCAGGGGG + Intergenic
1101412650 12:104482227-104482249 TCCCTTCTCTTTGCTGAAGACGG + Intronic
1102061527 12:109935758-109935780 TTCCTTCTCTGTGTAGCAGGAGG - Intronic
1102097028 12:110249118-110249140 TCACTTCTGTTTGCAGAGTGTGG + Intergenic
1102236629 12:111298093-111298115 TCCCCTCTGTTAGCAGGGGGTGG - Intronic
1102284012 12:111640475-111640497 TCACTTCTCTTGGCAGCAGAAGG - Intergenic
1103001007 12:117385270-117385292 TCCCTTCTGCTTGGCACAGGGGG - Intronic
1103198926 12:119070519-119070541 GCTCTTCTGTGTGCGGCAGGGGG - Intronic
1105307813 13:19181435-19181457 GCCCTTCTGTCTTCAGGAGGCGG + Intronic
1105722820 13:23134253-23134275 TCCCTTCTCTAAGGAGCAGGTGG - Intergenic
1107697037 13:43010591-43010613 TCCCTTCTGCTCCCAGCTGGCGG - Intergenic
1107814592 13:44233024-44233046 ACCCTTCTGCTGGCACCAGGAGG + Intergenic
1108661856 13:52595149-52595171 TCAGTTCTGTCTGCAGTAGGAGG - Intergenic
1110214537 13:73011409-73011431 CCCCTTCCGTTTCCAGCAGTGGG + Intronic
1112488147 13:99838324-99838346 TCTCTACTGTTTGGAGGAGGGGG + Intronic
1114658729 14:24331479-24331501 GCCCTGCTGTGTGCAGCGGGAGG - Intronic
1116934866 14:50729582-50729604 TCCTTTCTGCCTGCAGCAGCTGG + Exonic
1117925389 14:60773714-60773736 TCTCTTATGTTTGAAGCAGGTGG + Intronic
1119642080 14:76323042-76323064 TCCCTTCTGAATGCAGTGGGTGG + Intronic
1119721140 14:76891334-76891356 ACCCTTCTGTCTGCAGGTGGAGG - Intergenic
1121103592 14:91265939-91265961 TCCTTTCTTTTTGTAGAAGGGGG - Intergenic
1122258206 14:100495409-100495431 CCCCTTATGTTTCCAGCAGAAGG - Intronic
1125197783 15:37068263-37068285 TCCCTTAAGTTTGCAGGAGTTGG + Intronic
1125203910 15:37129385-37129407 TCCCTTTGGTTTGGAGCAGTGGG + Intergenic
1129297969 15:74610206-74610228 CCACTTCTGTCTGCAGCAGCAGG + Intronic
1131512354 15:93056336-93056358 TCCCTGCTGTTTGCTCCTGGGGG - Intronic
1131599558 15:93832359-93832381 TCCCTTCTGTGGGCAGCAGTGGG - Intergenic
1131919608 15:97309855-97309877 CCCCTTATGCTTCCAGCAGGAGG - Intergenic
1133166929 16:3954489-3954511 TCCCTTCTGGTTTCAGCACCAGG - Intronic
1134522739 16:14925988-14926010 TCCCTTCTGCCTGCAGCGGTGGG + Intronic
1134710409 16:16324639-16324661 TCCCTTCTGCCTGCAGCGGTGGG + Intergenic
1134718580 16:16368927-16368949 TCCCTTCTGCCTGCAGCGGTGGG + Intergenic
1134949195 16:18344006-18344028 TCCCTTCTGCCTGCAGCGGTGGG - Intergenic
1134956173 16:18383232-18383254 TCCCTTCTGCCTGCAGCGGTGGG - Intergenic
1135983943 16:27169747-27169769 TCCCTACTGTTTCCAGCCAGAGG - Intergenic
1136372117 16:29843001-29843023 GCCCTGCTGTTTGCAGCCTGTGG + Intronic
1138505660 16:57477064-57477086 TCCCTACTGTTTCCAGTAAGAGG - Intronic
1139122040 16:64032393-64032415 TCTCTTGTGATTCCAGCAGGGGG - Intergenic
1142144864 16:88488691-88488713 TCCCCTCTGCTGGCAGCTGGGGG - Intronic
1142653740 17:1375456-1375478 TGTCATGTGTTTGCAGCAGGTGG + Intronic
1142972668 17:3623289-3623311 GCCCTTCAGATTGGAGCAGGAGG + Intronic
1145117730 17:20227086-20227108 TCCCTCCTGCTTGTAGGAGGGGG + Intronic
1146570731 17:33950505-33950527 TCCCTTCAGTATTCAGAAGGGGG - Intronic
1146773498 17:35590619-35590641 TCCCTTCTCTTTAGAGCAGCAGG + Intronic
1151472390 17:74326335-74326357 TCCTTCATGATTGCAGCAGGTGG - Exonic
1151813743 17:76460708-76460730 TCCCTTCTTTGTCCAGGAGGTGG + Intronic
1152073787 17:78146787-78146809 TCCCTCCTGGCTTCAGCAGGTGG + Intronic
1152248550 17:79199329-79199351 GCCCTTCTTCTTCCAGCAGGTGG + Intronic
1152586463 17:81191595-81191617 TCCCATCTGGTAGCAGAAGGTGG - Intronic
1155203972 18:23541459-23541481 TCACTTCTGTTTACAGCCGGGGG + Intronic
1157625678 18:49048827-49048849 TCACTTCTGGTTGTACCAGGTGG - Intronic
1159493512 18:69169449-69169471 TCCCTTCTGATAACAGCAGCAGG + Intergenic
1161577726 19:5064129-5064151 TCCGTTCTGTTTGCAACTTGGGG + Intronic
1161975953 19:7607829-7607851 TGCCTTCTGTTTGAAGGAGTCGG + Exonic
1165533451 19:36422732-36422754 TCCCAGGTGTTTGCAGAAGGCGG - Intergenic
926733861 2:16057932-16057954 CCCGTTCTATGTGCAGCAGGTGG + Intergenic
927225931 2:20766729-20766751 CCCCTCCTGATGGCAGCAGGGGG + Intronic
927304309 2:21553120-21553142 TGGCTTCTGTTCTCAGCAGGAGG + Intergenic
929758877 2:44790068-44790090 TCCCTTGAGTTTGCTGCAAGGGG + Intergenic
929915852 2:46134846-46134868 TGCCTTGTGTTTCCAGCATGTGG - Intronic
933894079 2:86794707-86794729 TCCTTTCAGGTTGAAGCAGGGGG - Intronic
936037846 2:109127170-109127192 TTGCTTCTGATAGCAGCAGGTGG - Intergenic
937288611 2:120768486-120768508 CCCCTTCTGTTCCCAGCAGCGGG - Intronic
937383085 2:121399412-121399434 TCCCTTCTTCTGGCAGCATGGGG + Intronic
939959196 2:148551174-148551196 TCCTTTATGTTTGCAGCTGAGGG - Intergenic
945221395 2:207488145-207488167 TCCCTTCTGAAAGCAGCAGAGGG + Intergenic
947617590 2:231568432-231568454 ACCTTTCGGTTTGCACCAGGTGG + Intergenic
948564174 2:238873124-238873146 TCCCTACTGTGTCCAGGAGGAGG - Intronic
948897381 2:240933778-240933800 TCCGCTCTGCCTGCAGCAGGAGG - Intronic
1169492782 20:6085330-6085352 CCCCCTCTGTGTGCAGCAGGGGG - Intronic
1169950664 20:11039886-11039908 TCCCTGCTGTGTGAAGCTGGAGG + Intergenic
1171037389 20:21726672-21726694 TCACTTGTGTTTGTAGAAGGTGG + Intergenic
1171520186 20:25770019-25770041 TCGGCTCTGATTGCAGCAGGTGG - Intronic
1171556733 20:26086474-26086496 TCGGCTCTGATTGCAGCAGGTGG + Intergenic
1173976027 20:47187408-47187430 TTCCTTTTCTTTGCAGCAGGTGG - Intronic
1174355048 20:49991898-49991920 TCCCTTCTGTGGGCAGAAGAGGG + Intergenic
1174795098 20:53515631-53515653 ATCCATCTGTTTGGAGCAGGTGG - Intergenic
1175032700 20:55971446-55971468 TCCATTCTGTATGCAGCAGGTGG - Intergenic
1175147328 20:56906814-56906836 TCTGTTCTGTCTTCAGCAGGAGG + Intergenic
1175553912 20:59834273-59834295 GCCCTTCTGTGGGCAGCATGGGG + Intronic
1175711746 20:61226895-61226917 CCCCTTCTCTTGGCACCAGGAGG - Intergenic
1176163943 20:63663182-63663204 CCCCTACTGTTTGCACCAGCAGG - Intronic
1177629006 21:23702357-23702379 TCCCTTCTGCAATCAGCAGGAGG + Intergenic
1180854713 22:19038688-19038710 TCACTTCTTTTGGCAGAAGGCGG + Exonic
1182447285 22:30397220-30397242 TCCCTTCTCGCTGCCGCAGGAGG - Intronic
1183187417 22:36300002-36300024 TCTCTTCTGCCTGCAGCATGAGG - Intronic
1184018175 22:41801217-41801239 TCCCTTGAGTTTGGAGCAGGAGG + Intronic
1185027689 22:48425039-48425061 TCCCTGCTGCGTGCAGCCGGTGG - Intergenic
949438710 3:4057178-4057200 TCCCATCTGAGTGCAGCTGGTGG - Intronic
950335865 3:12192396-12192418 TTCCTTCTGTTTCCAGCTGTAGG + Intergenic
950560567 3:13719188-13719210 TACCTTCTGTTTACAGAAGGTGG - Intergenic
950584940 3:13885599-13885621 CTCCTTCTGTATCCAGCAGGGGG - Intergenic
950958625 3:17081112-17081134 TCCCCTCTTTGTGGAGCAGGTGG + Intronic
952264124 3:31768953-31768975 TCCATTCTTTTGTCAGCAGGGGG - Intronic
952325040 3:32313316-32313338 TTCATGCTATTTGCAGCAGGGGG + Intronic
953576661 3:44118071-44118093 TGCCTACTGTTTGCAGAATGTGG + Intergenic
954638383 3:52083975-52083997 TCCCTTCTGTTTCGAGCTGAGGG - Intronic
956813737 3:72888961-72888983 TCCCTTCTGTTCTAAGCATGGGG - Intronic
957832572 3:85542680-85542702 TTCTTTCTTTTTGCAGTAGGTGG - Intronic
959802550 3:110512534-110512556 TACCTTCTGTTTTCAGGAAGTGG + Intergenic
960210294 3:114956551-114956573 TCACTTCAGTTTGAAGTAGGTGG + Intronic
960319351 3:116215446-116215468 TCTCTTCTTCTTGCAGCAGCGGG - Intronic
964743370 3:159989449-159989471 TGCCTTCTGTTTGTAGCTGAGGG - Intronic
968582040 4:1399674-1399696 TTCTTCCTGTTTGCAGCCGGGGG + Intergenic
969327296 4:6451457-6451479 TCCCTTCTGTTTCTTGCATGAGG + Intronic
972564207 4:40255515-40255537 TCGCTTCTGTCTGCAGCCCGGGG + Intergenic
973275225 4:48299944-48299966 TCCCCTCTCTCTGCAGCAGGAGG - Intergenic
975329505 4:73098797-73098819 TCCCTTCTCTAAGGAGCAGGTGG - Intronic
976211009 4:82669716-82669738 TCCCTTGTATTTCCACCAGGAGG + Intronic
976611786 4:87038011-87038033 TCACTTCTGTTTGCCACAGAAGG - Intronic
977176827 4:93828932-93828954 ACTCTTCTGCATGCAGCAGGCGG - Exonic
982220929 4:153124549-153124571 TCCCTCCTGTCAGGAGCAGGCGG - Intergenic
982939981 4:161538294-161538316 TCCCTTCTTTTTTCAGCAAATGG - Exonic
983041665 4:162935487-162935509 TGCATTCTGTTTGCAGCAAATGG + Intergenic
984832411 4:183987831-183987853 TCCCTCCTGTGTGTAACAGGCGG - Intronic
985064583 4:186107800-186107822 TTCCTACTGTCTGCAGCAGCAGG + Intronic
985947846 5:3200648-3200670 TCCCTTCTGTCTTCAGCAGGTGG + Intergenic
986537485 5:8805879-8805901 TCCCTTCTGTTTGCAGCCTAGGG + Intergenic
990349963 5:54905933-54905955 TTCCTTCTCATGGCAGCAGGAGG + Intergenic
990864723 5:60368193-60368215 AGCCTTCTGTCTGCAGGAGGAGG - Intronic
995106317 5:108381257-108381279 CCCCAACTCTTTGCAGCAGGAGG + Exonic
995523377 5:113031484-113031506 TCCCTGCTGTTTTTAGCTGGAGG - Intronic
999127036 5:149253447-149253469 TCACTTCTCTTGGCAGCATGGGG - Intronic
1000023857 5:157342191-157342213 TCCCTTCTGTTTGCAGCAGGAGG + Exonic
1000676588 5:164129572-164129594 TCCAGTTTATTTGCAGCAGGCGG + Intergenic
1001710884 5:173777047-173777069 TAGCTTCTATTTGTAGCAGGTGG + Intergenic
1002196323 5:177503628-177503650 TCCCGTCTGTCTGCTGCAGTGGG + Intronic
1004881505 6:20013047-20013069 TCTCTTCAGTGGGCAGCAGGAGG + Intergenic
1006473433 6:34240756-34240778 TCCCTTCTCTAAGGAGCAGGTGG - Exonic
1011410074 6:87058678-87058700 TCCCTTCTCTTTTAAGCAGCAGG - Intergenic
1012053553 6:94374934-94374956 TCCCTTCACTTTGCGGCATGAGG - Intergenic
1012100032 6:95071967-95071989 TCTCTTCTGTTTTCTGCAGAAGG + Intergenic
1012332604 6:98011635-98011657 TCCCTTGTGCTTCTAGCAGGAGG - Intergenic
1012426392 6:99119621-99119643 TTCCTTCTCTGTCCAGCAGGGGG - Intergenic
1012513001 6:100026203-100026225 TCCCTGCTGATTGCTGCAGAGGG + Intergenic
1013587450 6:111591965-111591987 TTCCTTATATTTGGAGCAGGTGG + Exonic
1015519436 6:134115496-134115518 TCCCTTCTGCACGGAGCAGGTGG + Intergenic
1015805685 6:137106138-137106160 TGGCTTCTCTTTGCAGCAGCTGG - Intergenic
1016101453 6:140106065-140106087 TCCCTCGTGTTTCCAGCAGGGGG - Intergenic
1018005809 6:159620540-159620562 TACCCTCTATTTACAGCAGGAGG + Intergenic
1018095326 6:160382372-160382394 TCCCTTATGTTTGCATAAGTTGG - Intronic
1018677871 6:166238107-166238129 TTCCTTGTGATTTCAGCAGGCGG - Intergenic
1019893352 7:3964157-3964179 CCCCTTCTGTTTACCTCAGGGGG - Intronic
1022271159 7:28809326-28809348 CCTCTTCTGTCTGCAGCGGGTGG - Exonic
1024169642 7:46770489-46770511 TCTCTTCTGTATCTAGCAGGGGG - Intergenic
1026152734 7:67802097-67802119 TCCGTTCTGTTTGAAGCCAGAGG - Intergenic
1026927974 7:74206962-74206984 TCCCTGGTGTCTCCAGCAGGTGG + Intronic
1030402527 7:109070124-109070146 TCCTTCATGTTTGGAGCAGGAGG + Intergenic
1031540880 7:122993126-122993148 TCCCCTCTGTGTGCAACAGTAGG + Intergenic
1031700249 7:124916786-124916808 TCCCCTGTGTTTGCAGCTTGGGG - Intronic
1031920231 7:127595032-127595054 TACCTTCTGTTAGCTGAAGGAGG + Intronic
1032794233 7:135264632-135264654 GCCCTTTTGATAGCAGCAGGAGG - Intergenic
1035710504 8:1709878-1709900 GCCCTTGTGTTTCCAGCAGGTGG + Intergenic
1035746380 8:1964385-1964407 TCCCTTTTGTTGCCAGCATGTGG + Intergenic
1035766338 8:2108851-2108873 TCCCCTCTGCTTGCAGCTGCTGG + Intronic
1036652424 8:10653961-10653983 TCCCTTCACTGTGCAGCAGCTGG + Intronic
1038131931 8:24742003-24742025 CCACTTCTTTTTGCAGCAGTTGG - Intergenic
1040489372 8:47905712-47905734 TCCCTCCTTTTGGCAGCAGTGGG - Intronic
1041768906 8:61451680-61451702 TCCCTTTTGTCTGCAGTTGGCGG + Intronic
1042146877 8:65739004-65739026 TCACTTCTGCATGCAGCAAGTGG - Intronic
1044839815 8:96328076-96328098 TGCCTGCTGTTTGCCGCTGGAGG + Intronic
1045062695 8:98423092-98423114 TCCCTTCTTGATGCATCAGGAGG + Intronic
1046280581 8:112024293-112024315 ATCCTTCTGTATGCATCAGGAGG + Intergenic
1046856729 8:119040753-119040775 TCCCTTCTGTTGATAGCTGGTGG - Intronic
1046893070 8:119444342-119444364 TCACTGCTATATGCAGCAGGTGG - Intergenic
1047426546 8:124751733-124751755 TGCCTTCTGTTGCCAGCAGGTGG - Intergenic
1053355065 9:37438568-37438590 TCCCTTCCATTTGGAGGAGGTGG - Exonic
1054723561 9:68627630-68627652 TCCTCTGTGTTTGCAACAGGTGG - Intergenic
1057353823 9:94319723-94319745 TTCCTTCTGTTTCCAGGTGGAGG - Exonic
1057653928 9:96937869-96937891 TTCCTTCTGTTTCCAGGTGGAGG + Exonic
1059404764 9:114092790-114092812 CGCCTTCTGTGTGCAGCAGATGG + Intronic
1059450220 9:114366976-114366998 TCACTTCTGTTTTCAGAATGTGG + Intronic
1059725640 9:117005895-117005917 TGCCTTCTGTTTGAAGAAGCAGG + Intronic
1186855739 X:13624440-13624462 TCCCTTCTGTTTGTTGCTTGAGG + Intronic
1195921853 X:109991603-109991625 TCCCTTGTTTTTGCAGAAGTTGG - Intergenic
1196313534 X:114196771-114196793 TCCCTGCTGTTTGCAGCCTTGGG - Intergenic
1197885601 X:131214577-131214599 TCCTTTCTTTTTGTAGCTGGTGG - Intergenic
1199360153 X:146907719-146907741 TGCCTTCTCTGTGGAGCAGGAGG + Intergenic