ID: 1000029735

View in Genome Browser
Species Human (GRCh38)
Location 5:157391191-157391213
Sequence CAGTGACAGCAGAGGCACTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 511
Summary {0: 1, 1: 0, 2: 4, 3: 56, 4: 450}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000029727_1000029735 25 Left 1000029727 5:157391143-157391165 CCAAGCAGCAAAGGTGGTATGGG 0: 1
1: 0
2: 0
3: 12
4: 123
Right 1000029735 5:157391191-157391213 CAGTGACAGCAGAGGCACTGAGG 0: 1
1: 0
2: 4
3: 56
4: 450

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000029735 Original CRISPR CAGTGACAGCAGAGGCACTG AGG Intronic
900281509 1:1872592-1872614 CAGTGATTGCAGAGGCCCTGCGG - Intronic
900980074 1:6041232-6041254 CAGTGAGAGCTGAGCCTCTGGGG + Intronic
901152011 1:7109971-7109993 CATAGGCAGCAGAGCCACTGAGG - Intronic
901259252 1:7859553-7859575 CAGTGAGTGCAAAGGCCCTGGGG + Intergenic
901390971 1:8945894-8945916 CAGGGACAGCAGAAGCACCAGGG - Exonic
901740982 1:11341756-11341778 CAGTGATTGCAAAGGCCCTGAGG + Intergenic
901875326 1:12164163-12164185 CAGGGACAGCAGAGGCAGTGTGG - Intergenic
902097125 1:13955820-13955842 AAATGAAAGAAGAGGCACTGAGG + Intergenic
902306920 1:15547895-15547917 CAGTGACATGAGAGGTAGTGGGG - Intronic
903277609 1:22231837-22231859 CTGTGACAGCACAGGGTCTGCGG - Intergenic
903372275 1:22844381-22844403 CAGAGACAGCAGCAGCACTCTGG - Intronic
903587126 1:24424652-24424674 CAGTGGCAGGAAAGGCAATGGGG + Intronic
904021514 1:27470102-27470124 CAGTGTCAGCAGAAGCACAAAGG + Intronic
905295386 1:36951381-36951403 AAGGGACAGCAGATGCCCTGGGG + Intronic
905544823 1:38789379-38789401 AACTGAAACCAGAGGCACTGAGG + Intergenic
905688994 1:39928908-39928930 CAGTGGAAGCAGAGCCACGGGGG + Intergenic
905872119 1:41410716-41410738 CAGTGTGAGCAAAGGCACAGAGG + Intergenic
905872798 1:41414812-41414834 CAGGGACAGCACATGCAGTGTGG - Intergenic
906389075 1:45398194-45398216 CAGTGACAGGCCAGGCACAGTGG - Intronic
906536782 1:46555133-46555155 CAGATCCAGCAGATGCACTGAGG - Intergenic
906841555 1:49144873-49144895 CATTGAAAGCAAAGGCAATGGGG + Intronic
906879460 1:49574752-49574774 CATGGACAGCAGAGGCAAAGTGG + Intronic
907047961 1:51311538-51311560 CAGCAACATCAGATGCACTGTGG + Intronic
907568326 1:55458307-55458329 AAGTGACAGCAAAGGCACATTGG + Intergenic
907692674 1:56685275-56685297 CAGTGACAGTAGTAGCAATGGGG + Intronic
907773742 1:57491947-57491969 CAGGGACAGCAAAGGCTCAGAGG + Intronic
908516200 1:64895029-64895051 CAGTGGCTCCAGAGGCGCTGTGG - Intronic
908844271 1:68308893-68308915 CAGTGCCAGCAGATACACAGTGG - Intergenic
910135776 1:83967505-83967527 CAGTGTCTGCAGCTGCACTGTGG + Intronic
910366643 1:86472371-86472393 CAGTGCCTGCAGAGGAAATGAGG - Intronic
912170470 1:107093316-107093338 CAGTGACAGAACAGGAAATGAGG - Intergenic
912313336 1:108645029-108645051 CAGTGTCAGCAGTGGCAATGTGG - Intergenic
912323156 1:108733417-108733439 CAGTGACATCACAGAAACTGAGG - Exonic
914355671 1:146882231-146882253 CAGACAGAGCAGAAGCACTGGGG - Intergenic
914424548 1:147563023-147563045 CAGTGAATGCAAAGGCCCTGAGG - Intronic
916578691 1:166089040-166089062 CAGTGTCTGCCGAGGCTCTGAGG - Intronic
917717712 1:177754807-177754829 CAATGAGAGCAGCAGCACTGAGG - Intergenic
917741809 1:177968387-177968409 CACTTACAGCGGAGGCCCTGTGG + Intronic
917923736 1:179771726-179771748 CAGTAACAGCAGTGGAGCTGGGG - Intronic
917967519 1:180187810-180187832 CAGTAGCAGCAGAGGCATCGGGG + Intronic
917979741 1:180261358-180261380 TAATGACAGCAGAGGCAAAGGGG + Intronic
918428326 1:184433262-184433284 GAGTGCCAACAGTGGCACTGGGG + Intronic
919931195 1:202222435-202222457 GAGGGACATCAGAGGCTCTGCGG + Intronic
920246557 1:204592211-204592233 GAGTGACAGCCCAGCCACTGGGG + Intergenic
920976156 1:210787253-210787275 CAGGGACAGCAGTGGCTGTGGGG - Intronic
922024681 1:221739495-221739517 CAGTGCCAGCTGCTGCACTGTGG - Exonic
922605519 1:226887611-226887633 CAGTGATAGGAGACTCACTGGGG - Intronic
923377656 1:233380461-233380483 CAGTGACATCTGAGGGACAGAGG + Intronic
923843426 1:237700390-237700412 CATTGGCAGCAGGGCCACTGTGG - Exonic
923933136 1:238726510-238726532 CAGTGACACCAGAGGAAGGGAGG + Intergenic
924553419 1:245098916-245098938 AGGTAACTGCAGAGGCACTGGGG + Intronic
1062853710 10:767647-767669 CAGGGAAAGAAAAGGCACTGGGG + Intergenic
1062885326 10:1011738-1011760 AGGTGACAGCAGATGCCCTGAGG - Intronic
1063047568 10:2408666-2408688 CATTGCCCGCAGAAGCACTGTGG + Intergenic
1063554974 10:7069808-7069830 TGGTGACTGCAGAGGCCCTGAGG + Intergenic
1065694859 10:28370338-28370360 CAGTGAGTGCAAAGGCCCTGGGG + Intergenic
1067090074 10:43262013-43262035 CAGCCACAGCTGGGGCACTGGGG - Intronic
1069069288 10:63977093-63977115 CAGAAAAAGCAGAGGCACTGGGG - Intergenic
1069597018 10:69678705-69678727 GGGTGAGAGCAGGGGCACTGTGG + Intergenic
1070279399 10:75037803-75037825 CAGGGCCAGCAGAGGCACTTGGG - Intergenic
1070744282 10:78923468-78923490 CAGGGACAGCAGTGGCACGTGGG + Intergenic
1070950647 10:80428320-80428342 CAGTGTCAGCAGAGGCCAGGAGG + Intronic
1072269585 10:93763017-93763039 CAGTGAAAGCAGTGGTGCTGTGG - Intronic
1072317861 10:94221245-94221267 CACTGACATCAGAAGCACTGGGG - Intronic
1072716461 10:97755828-97755850 CCATGACAGCAGGGGCACTAAGG - Intronic
1074034658 10:109726101-109726123 CAGTGAGAGCAGAAGCTTTGAGG - Intergenic
1074263677 10:111879703-111879725 CAGTGAAAGCTGAGATACTGTGG + Intergenic
1074472448 10:113739812-113739834 CAGTGAATGCAAAGGCCCTGGGG + Intergenic
1074881946 10:117666479-117666501 CAGGGACAGCAGAGGGTGTGTGG + Intergenic
1075069037 10:119308704-119308726 CAATGGCTGCACAGGCACTGTGG + Intronic
1075153519 10:119955825-119955847 CAGTTGCAGCAGAGGCCCAGTGG + Intergenic
1075717021 10:124561649-124561671 CAGTGTCAGCAGAGGCCAAGTGG + Intronic
1075805950 10:125188963-125188985 CAGTGCCAACAGAGCCACTGGGG - Intergenic
1076501020 10:130936159-130936181 CAGTGTCAGCAGAGGCATATGGG - Intergenic
1076537185 10:131187190-131187212 CAGTGCCAGCAGAGGCACGTCGG + Intronic
1076682342 10:132179610-132179632 CAGTGAAAGCAGATGTTCTGGGG + Intronic
1077266874 11:1655267-1655289 CAGGGACAGTGGGGGCACTGCGG + Intergenic
1077273285 11:1691821-1691843 CAGTGGCTGCAGGGGCCCTGGGG - Intergenic
1077278416 11:1729357-1729379 GACTGACAGCAGGTGCACTGGGG + Intergenic
1078339608 11:10489361-10489383 CAGTGCCAGCACAGCCAGTGAGG - Intronic
1079246003 11:18752786-18752808 AGCTGACAGCAGAGGCCCTGCGG + Intronic
1080740462 11:35059163-35059185 CAGTGAGAGCAGTTGCAGTGAGG + Intergenic
1080874503 11:36263824-36263846 CAGTGAGTGCACAGGCATTGCGG + Intergenic
1083610870 11:64003725-64003747 CAGAGGAAGCAGAGCCACTGAGG - Intronic
1083737879 11:64691990-64692012 CAGTGACAGCAGAGGGCTAGAGG + Intronic
1083902832 11:65652028-65652050 CAGTGATAGCAGTGACAGTGGGG + Intergenic
1083932546 11:65853832-65853854 CAGTGACAGCAGGCTCCCTGTGG + Intronic
1084606453 11:70175161-70175183 CAATGCCTGCAGAGGGACTGCGG - Intronic
1084961190 11:72717521-72717543 CAGTGATGGGAGATGCACTGTGG - Intronic
1085509717 11:77082145-77082167 CAGTGTGTGCAGAGGCCCTGAGG + Intronic
1085527156 11:77170891-77170913 ATGTGACAGAAGAGGCACTGAGG + Intronic
1085757692 11:79215365-79215387 GAGTGAGATCAGAGGCACAGTGG - Intronic
1086608160 11:88722379-88722401 CAGTCACAGCAAGGGCCCTGAGG - Intronic
1086728016 11:90212907-90212929 CAGTGAGAGGCCAGGCACTGTGG - Intronic
1087222582 11:95562478-95562500 CATTGACAGGAGATGCAGTGTGG + Intergenic
1087816753 11:102666259-102666281 CAGTGAGAGCAAAGACTCTGCGG + Intergenic
1088554223 11:111045297-111045319 GACTGACAGCAGAGGCAGTGGGG - Intergenic
1088648683 11:111938165-111938187 ATGTGAGAGCAGAGGAACTGGGG + Intronic
1088808847 11:113375838-113375860 CAGTGACAGCCCAGGCATAGCGG - Intronic
1089326820 11:117663229-117663251 CCGTGAGATCAGAAGCACTGTGG - Intronic
1089556738 11:119319356-119319378 CAGGGCCAGAAGAGGCCCTGGGG + Intronic
1089671884 11:120062429-120062451 CAGTGACAGAGGAGGCCCGGAGG + Intergenic
1090588158 11:128236568-128236590 CAGGGATAGCAGAGGCAAAGTGG + Intergenic
1090763012 11:129853695-129853717 CTGTGACAGCAGCGGCTGTGTGG - Intronic
1090795141 11:130128955-130128977 CACTGACAGGAGAAGCACTGGGG + Intronic
1092006625 12:5075656-5075678 CACTGAATGCAGAGGGACTGGGG + Intergenic
1092112098 12:5971116-5971138 CAGAAATAGCAGAGGGACTGTGG + Intronic
1093113962 12:15186783-15186805 CAGTGACAGTTGCAGCACTGGGG + Intronic
1095301849 12:40593527-40593549 CAGTGATGGCAGAGGCACAAGGG + Intergenic
1095929377 12:47610359-47610381 CAGTGTGTGCATAGGCACTGAGG - Intergenic
1101006638 12:100407368-100407390 GAGAAACAGCAGAGGTACTGGGG - Intronic
1101426267 12:104591097-104591119 CAGTGAGTGCAAAGGCCCTGAGG + Intronic
1101434022 12:104649918-104649940 CAGAGCCACCAGGGGCACTGAGG - Intronic
1102738942 12:115188800-115188822 CAAAGACAGCACAGGCACTTGGG - Intergenic
1102891162 12:116559567-116559589 TAGTGAAAGCAGAGGCTGTGGGG - Intergenic
1103701968 12:122852971-122852993 CAGTGACAGGAGAGAGCCTGGGG - Intronic
1103796413 12:123506227-123506249 CAGTGAGTGCAAAGGCCCTGGGG + Intronic
1104476514 12:129074735-129074757 CAGTGACAGCAGACACACAGGGG - Exonic
1104991401 12:132625733-132625755 CAGTTGGAGCAGAGCCACTGAGG + Exonic
1105522946 13:21147780-21147802 AAGTGGCAGCAGAGGCAGTTTGG + Exonic
1105914670 13:24902059-24902081 CAGTGCCAGCCTAGGCAGTGTGG - Intronic
1108041360 13:46342087-46342109 CAGTTCTGGCAGAGGCACTGCGG + Exonic
1108286757 13:48916335-48916357 AAGTGACAGCAGAGGTAATGGGG + Intergenic
1112847488 13:103662097-103662119 TAGTGACAGCAAAGGATCTGTGG + Intergenic
1113702285 13:112396537-112396559 CAGACACTGCACAGGCACTGGGG - Intronic
1113787713 13:113011357-113011379 CAGAGAGTCCAGAGGCACTGCGG + Intronic
1114050048 14:18914762-18914784 CAGAGACAGCAGGGACTCTGGGG - Intergenic
1114112510 14:19487169-19487191 CAGAGACAGCAGGGACTCTGGGG + Intergenic
1114191690 14:20444014-20444036 CAGTGGCAGCAGTGGAAGTGAGG + Intergenic
1114443206 14:22767373-22767395 AAGAGATAGCAGAGGTACTGAGG - Exonic
1114459433 14:22877295-22877317 CAGTGAGGGCAGTGGCCCTGGGG - Exonic
1115642248 14:35342109-35342131 GAGGGACAGCGGAGGCCCTGTGG - Intergenic
1115765328 14:36617454-36617476 GAGACACACCAGAGGCACTGGGG - Intergenic
1117675638 14:58152284-58152306 CAGTGCCAGCAGAGCCAGGGCGG - Intronic
1118522143 14:66596897-66596919 CAATGACACCAGATGCAGTGGGG - Intronic
1119379936 14:74222050-74222072 CAGTGATAGCAGAGCCTCTGAGG + Intergenic
1119577169 14:75735352-75735374 CTGTGGGAGCAGAAGCACTGTGG + Intronic
1119652248 14:76392179-76392201 CAGTGGAAGCAGAGACACTGCGG + Intronic
1119730561 14:76948392-76948414 CAGCTACAGCACAGGCACTCCGG + Intergenic
1120929515 14:89834713-89834735 CAGTTTCAGCAGAGTTACTGGGG + Intronic
1121108536 14:91296450-91296472 CTGTGACAGCACAGCCCCTGGGG + Intronic
1121176125 14:91892049-91892071 CAGGGAAAGCGGCGGCACTGTGG + Intronic
1121303792 14:92892206-92892228 CAGTGAAAGGAGAGACACTGAGG + Intergenic
1121598662 14:95186247-95186269 GAGGGAAGGCAGAGGCACTGGGG - Exonic
1121853963 14:97249293-97249315 AAGTCACAGCAGTGGCACTGTGG - Intergenic
1122157299 14:99757394-99757416 CAGTGACAGCACAGGTTGTGTGG + Intronic
1122162942 14:99799481-99799503 CAGTGACAGAAGACTGACTGAGG + Intronic
1122548032 14:102535522-102535544 CAGGGAGGGGAGAGGCACTGGGG + Intergenic
1123072283 14:105647706-105647728 CAGGGACAGGGGAGGCACAGGGG - Intergenic
1123092290 14:105747224-105747246 CAGGGACAGGGGAGGCACAGGGG - Intergenic
1123097868 14:105774925-105774947 CAGGGACAGGGGAGGCACAGGGG - Intergenic
1123627950 15:22240157-22240179 TAGTGACAACAGTGGCACTGAGG + Intergenic
1123906376 15:24925507-24925529 AAATGAGAGCAGAGGAACTGGGG - Intronic
1124129967 15:26974571-26974593 CAGAGACAGCAGAGGGAGGGAGG + Intronic
1124135465 15:27031858-27031880 AAGTGACAGCTGAAGCACCGTGG + Intronic
1124601609 15:31137136-31137158 CAGTGACTGAGGAGTCACTGTGG + Intronic
1125485980 15:40111130-40111152 CTGGGACAGCACAGGCCCTGAGG + Intergenic
1125766071 15:42137410-42137432 CAAGGACAGCAGAAGCGCTGAGG + Intergenic
1126703370 15:51386492-51386514 CAGAGGCAGCAGGGCCACTGAGG + Intronic
1127258814 15:57312973-57312995 CAGAAACACCAGAGGCACCGGGG + Intergenic
1127280877 15:57491373-57491395 CGGAGAAAGCAGTGGCACTGTGG - Intronic
1127500629 15:59550730-59550752 CAGCAAGAACAGAGGCACTGGGG - Intergenic
1128812268 15:70581189-70581211 CTGTGACAGAGGAGGGACTGGGG - Intergenic
1128850888 15:70954858-70954880 CAGGGGCAGCAGGGGCACTGTGG + Intronic
1129824502 15:78625721-78625743 CAGTGAGAGCAGAGAAACCGGGG + Intronic
1129892512 15:79080996-79081018 CAGTAACTGCAGGGTCACTGTGG + Intronic
1130058554 15:80551871-80551893 CAGTGAAAGAAGAGTAACTGAGG - Intronic
1130858998 15:87869257-87869279 CAGAGAAAGCAGAGTCAGTGGGG + Intronic
1131092511 15:89633161-89633183 CAGTGGCAGCAACGGCTCTGTGG - Exonic
1131152997 15:90058574-90058596 CAGTGACTGCAGAGGAACAGAGG - Intronic
1131442077 15:92466959-92466981 CAGTTACAGCAGAGGATCTCGGG - Exonic
1132087237 15:98918340-98918362 CTGTAAGAGCAGAGTCACTGTGG - Intronic
1132412867 15:101597824-101597846 AAATGAAAGCAGAGACACTGGGG - Intergenic
1132413078 15:101600205-101600227 CAGTGTCAGCAGAGGCCACGTGG - Intergenic
1132752446 16:1465016-1465038 CAGTGACAGCATGGGCAGCGAGG - Intronic
1133061901 16:3180318-3180340 CCTTGATAGCAGAGGCCCTGGGG - Intergenic
1133588992 16:7224514-7224536 TAGTTAAATCAGAGGCACTGAGG - Intronic
1134402828 16:13926187-13926209 CAGTGAGGGCACAGGCCCTGGGG - Intronic
1135839432 16:25861197-25861219 CAGTCACAGCAGAAGCAGTGAGG + Intronic
1135962892 16:27012480-27012502 CAGTGACTGCAAAGGCCCTGAGG - Intergenic
1136371022 16:29836150-29836172 CAGTTACTCCAGAGGCGCTGAGG + Intronic
1136567429 16:31078742-31078764 CAGTGACAGCATTGGCAGAGTGG - Exonic
1136630028 16:31484681-31484703 CAGAACCAACAGAGGCACTGTGG + Exonic
1138096853 16:54218708-54218730 CAGAGACAGCAGGTGCAGTGGGG + Intergenic
1139292499 16:65871270-65871292 CAGAGGCAGCAGAATCACTGGGG + Intergenic
1139738112 16:69010553-69010575 CTGTGACAGCAGAGGCAAGGTGG - Intronic
1139829193 16:69782956-69782978 TAGTTACAGGAGAGGCACAGTGG - Intronic
1139883505 16:70192776-70192798 CTGTGCCAGCAGAGGCTGTGGGG - Intergenic
1139978346 16:70833212-70833234 CAGACAGAGCAGAAGCACTGGGG + Intronic
1140369005 16:74402743-74402765 CTGTGCCAGCAGAGGCTGTGGGG + Intergenic
1140411886 16:74746085-74746107 CAGTGACAGGCCAGGCACTGTGG - Intronic
1140636244 16:76918018-76918040 GAGTGACTGCATAGGCAGTGTGG + Intergenic
1140992568 16:80228154-80228176 CAGTGACAGATGAGGCATTTGGG - Intergenic
1141447319 16:84069475-84069497 CAGCAACAGCAGTGGCACTCAGG + Intronic
1142467485 17:144650-144672 CAGGGGCAGCACAGGCACTCGGG - Intergenic
1142502317 17:339969-339991 CTGGGACAACAGTGGCACTGAGG - Intronic
1143371186 17:6440609-6440631 CTGTGACATGACAGGCACTGGGG + Intergenic
1144648123 17:16989227-16989249 CAGTGAAGGCAGAAGCACTTTGG - Intergenic
1144752959 17:17662706-17662728 CAGTAAGTGCAGAGGCCCTGAGG - Intergenic
1145796641 17:27659328-27659350 CAGTCACAGCACAGACCCTGGGG + Intergenic
1145973999 17:28973840-28973862 CAGTGACAGGAGGGGACCTGGGG + Intronic
1148088231 17:45007187-45007209 CAGCGACAGAAGAGGAGCTGGGG + Intergenic
1148484463 17:47981883-47981905 CAGTGACAGCTGATGGCCTGGGG - Intergenic
1150271876 17:63872072-63872094 CAGGGCCAGGAGAGGCACTGGGG + Exonic
1150275425 17:63894972-63894994 CAGGGCCAGGAGAGGCACTGGGG + Exonic
1150277556 17:63909661-63909683 CAGGGCCAGGAGAGGCACTGGGG + Intronic
1150278848 17:63917258-63917280 CAGGGCCAGGAGAGGCACTGGGG + Exonic
1150533728 17:66013806-66013828 CAGTGGCAGCAGTGGCACCATGG + Intronic
1151158116 17:72141644-72141666 GAGTGTCAGCAGAGCAACTGTGG - Intergenic
1152473921 17:80505292-80505314 CAGTGTCTGGAGAGGCAGTGAGG + Intergenic
1153484474 18:5582866-5582888 GAGCGTCAGCAGAGGCAGTGAGG + Intronic
1153947544 18:10030955-10030977 CAATCACAGCAGAGCCTCTGCGG - Intergenic
1154387776 18:13911178-13911200 CAGGGACAGGAGAGGAGCTGAGG + Intronic
1156477992 18:37418382-37418404 AAGAGAGAGCAGAGCCACTGGGG - Intronic
1157484659 18:48078386-48078408 CAGAGGCAGCAGAGGTCCTGGGG - Intronic
1157622921 18:49026562-49026584 CAGTGACAGCCCAGGCACACAGG + Intergenic
1160151150 18:76395223-76395245 CAGCGAGCGCAGAGGCCCTGCGG - Intronic
1160740559 19:683555-683577 CACTGCCTGGAGAGGCACTGAGG - Intergenic
1161010088 19:1955726-1955748 CGGTGACAGCAGTGGCACGGGGG - Intronic
1161056280 19:2192054-2192076 CAGGGACAGCCTAGACACTGTGG - Intronic
1161194110 19:2976818-2976840 GCGGGACAGCAGAGGCCCTGAGG - Intergenic
1161506687 19:4648020-4648042 AAGAGACCACAGAGGCACTGGGG - Intronic
1162705462 19:12551604-12551626 GAGTGACAGGAGAAGCAATGCGG + Intronic
1162910873 19:13847321-13847343 CAGTGACGTCAGAGGGGCTGGGG - Intergenic
1163782953 19:19260011-19260033 AAGTGAAAGCCTAGGCACTGTGG + Intronic
1164582589 19:29443549-29443571 CAGTGACAGGAGAGTGACTTGGG - Intergenic
1165120760 19:33556963-33556985 CAGTGGCAGCAGAGGGAAGGAGG - Intergenic
1165226659 19:34359730-34359752 GAGTGAAGGCAGAGGGACTGGGG - Intronic
1166018885 19:40006571-40006593 CAGTGACATCAGTGTCATTGTGG + Intronic
1167881080 19:52457881-52457903 AAGTGACATCAGAGGGCCTGAGG - Intronic
1168467861 19:56618683-56618705 CAGTGGATGCAGAGGCCCTGAGG + Intronic
924971162 2:128198-128220 CAGGGGCAGCAGAGGCCCTGGGG + Intergenic
925078470 2:1040231-1040253 CAGTGACACCAGAGTCCCTGTGG + Intronic
925117194 2:1389667-1389689 CAGTGGCAGGAGTGGCTCTGGGG - Intronic
925560679 2:5190820-5190842 CAGGCACACGAGAGGCACTGCGG - Intergenic
926156173 2:10455131-10455153 GAGAAACAGCAGAGGCACAGTGG + Intergenic
926168250 2:10534906-10534928 CAGTCACACGGGAGGCACTGTGG - Intergenic
926227762 2:10980590-10980612 CAGTTTCAGCTCAGGCACTGGGG + Intergenic
926282619 2:11462722-11462744 CAGTGACAGCATGGGAACTCTGG + Intronic
926297504 2:11579252-11579274 CCATGATGGCAGAGGCACTGGGG - Intronic
926583317 2:14656273-14656295 CAGTAACAGAAAAGGCCCTGAGG + Intergenic
927940836 2:27101889-27101911 CTGTGGAAGCAGAGTCACTGTGG + Intronic
929110402 2:38401787-38401809 CAGTGACAGAACAGGGACTTAGG - Intergenic
931513795 2:63029213-63029235 CAGGGTCAGCAGTGTCACTGTGG - Intronic
931595203 2:63934505-63934527 AGGAAACAGCAGAGGCACTGAGG - Intronic
932245255 2:70191123-70191145 CAGAGACCGCTGAGACACTGGGG + Intronic
932765269 2:74465197-74465219 CAGTGCCGGCAGAGGGAGTGCGG - Exonic
933606991 2:84393629-84393651 CACAGACAGCAGAGGCAGAGTGG - Intergenic
934533237 2:95110022-95110044 CAGTGACTGCAGATGAGCTGTGG - Exonic
934569712 2:95361530-95361552 CAGTGACAGCAGGTGAACTGGGG - Intronic
934941049 2:98502227-98502249 CACTGACAGTGGAGCCACTGTGG - Intronic
935043833 2:99461316-99461338 CAGTCACTGTAGAGGCACTAAGG + Intronic
935290865 2:101610020-101610042 CAGTCACATCTGAGGTACTGTGG - Intergenic
936930928 2:117788039-117788061 CAATGACAGCAGAATCACTTGGG - Intergenic
937182753 2:120011359-120011381 CAGTGAAAACAGAAGCTCTGAGG - Intergenic
937337673 2:121071787-121071809 CAGTGAATGCAAAGGCCCTGGGG - Intergenic
937710106 2:124970791-124970813 CAATTACATCAGAGGCTCTGAGG + Intergenic
937913738 2:127088906-127088928 CAGTGAGTGCAAAGGCCCTGAGG + Intronic
937928052 2:127182978-127183000 CAGAGACAGCAGAGCCATTTAGG - Intergenic
938021674 2:127910905-127910927 CAGTGACATGAGAGGGACAGGGG - Intergenic
938139021 2:128781643-128781665 GAAGAACAGCAGAGGCACTGAGG + Intergenic
939215916 2:139238286-139238308 AAGAAACAGGAGAGGCACTGGGG - Intergenic
939959590 2:148554589-148554611 CAGTGACAGCAAAGGCCCCAGGG - Intergenic
940627888 2:156198790-156198812 CAGTGACAGCAGAATCACTTTGG - Intergenic
941501804 2:166288368-166288390 CGGTTACAACAGAGGCTCTGCGG - Intronic
942967574 2:181915532-181915554 CAGAGACAGTAGAGCTACTGAGG + Exonic
942982911 2:182103921-182103943 CAGTAACAGGAGAATCACTGAGG + Intronic
944961889 2:204884194-204884216 CAGTGAGAGAAGAGCCAATGGGG + Intronic
945565267 2:211390214-211390236 CAGTGAAAGCACAGGCACTGTGG + Intronic
947011912 2:225575267-225575289 CAGTGACAGCAGAGGCCTGAAGG - Intronic
947567799 2:231205937-231205959 CAGTCACAGCAGAGGGAGGGGGG - Intronic
947708997 2:232299480-232299502 CAGTGAGTGCAGAAGCCCTGGGG - Intronic
947949358 2:234134385-234134407 CAGGGACATCAGAGGAACTCCGG - Intergenic
948107472 2:235427238-235427260 CAGAGACAGGGGAGGCAGTGCGG - Intergenic
948431768 2:237923317-237923339 ACGTGACAGCAGGGGCAGTGGGG - Intergenic
948470215 2:238172757-238172779 CAGAGACACTAGTGGCACTGTGG - Intronic
948562939 2:238866077-238866099 CAGTAACACCAGATGCAGTGTGG - Intronic
1170552275 20:17488424-17488446 TAGTTACAGCAGAGGCTGTGTGG + Intergenic
1170705830 20:18744201-18744223 CAGTGCCAGCAGCGGGGCTGAGG + Exonic
1170838427 20:19904591-19904613 GAGTGACATCTGAGGCTCTGAGG + Intronic
1170945757 20:20889701-20889723 AGTTCACAGCAGAGGCACTGAGG - Intergenic
1172388235 20:34548592-34548614 CAGTGAAAGCAGAGGATCTGTGG + Intronic
1173250709 20:41362899-41362921 CAGGGACAGCAGGAGCCCTGGGG + Exonic
1173371940 20:42444206-42444228 CAGTGAGTGCAAAGGCCCTGAGG - Intronic
1173610225 20:44361809-44361831 TAAGGACAGCAAAGGCACTGTGG + Intronic
1173720691 20:45255113-45255135 CAGGCACAGAACAGGCACTGGGG - Intergenic
1173763233 20:45583598-45583620 CACTGACAGCACACGCATTGGGG - Intergenic
1173865791 20:46312025-46312047 CAGAGAGACCAGAGACACTGAGG - Intergenic
1174220972 20:48955248-48955270 CAGTAAGTGCAAAGGCACTGAGG - Intronic
1175141943 20:56867264-56867286 CCGAGACAGCCAAGGCACTGTGG - Intergenic
1175379980 20:58556231-58556253 CAGTGAGAGCAGAGGGCCAGAGG + Intergenic
1175456722 20:59120999-59121021 AAGTGACTGCTGATGCACTGTGG + Intergenic
1175786822 20:61717195-61717217 CTGTGACAGCAGCAGCAGTGGGG - Intronic
1175842723 20:62040426-62040448 CAGTGACAGCAGCAGCTCAGTGG + Intronic
1175969652 20:62678008-62678030 TACTGACAGCAGAGGCCCTCAGG - Intronic
1177076487 21:16582021-16582043 CAGTTATGGCATAGGCACTGGGG - Intergenic
1178639058 21:34331283-34331305 CAGTGGAATCACAGGCACTGTGG - Intergenic
1178854636 21:36240017-36240039 CAGTGATAGCTGAGAGACTGAGG + Intronic
1179515342 21:41902721-41902743 CGGTGACAACAGTGACACTGGGG + Intronic
1179622926 21:42630737-42630759 CAGTGCCAGCAGAGGTGCGGAGG + Intergenic
1179826428 21:43968649-43968671 CGGGGACAGCTGAGGCCCTGCGG - Intronic
1179911459 21:44451220-44451242 CACTGACAGCAGAGTCGCTGCGG + Intergenic
1180468528 22:15637137-15637159 CAGAGACAGCAGGGACTCTGGGG - Intergenic
1180740853 22:18052400-18052422 CAGCAGCAGCAGAGGCACCGGGG + Intergenic
1180972489 22:19822691-19822713 CACAGCCAGCAGAGGGACTGGGG + Intronic
1181148040 22:20862645-20862667 CAGTGAGAGCTGAGGCAGAGTGG + Intronic
1181165570 22:20981216-20981238 CAGTGGCAGCAGAGGCCTTGAGG - Exonic
1181303875 22:21903074-21903096 CAGTGATAGCAGTGGCACTGGGG - Intergenic
1181492739 22:23270693-23270715 CAGAGACAGAAGAGGTTCTGAGG - Intronic
1182102438 22:27667589-27667611 CAGTCTCTGCAGAGGGACTGTGG + Intergenic
1182866214 22:33606743-33606765 CCATGACAGCAGGGGCAGTGTGG - Intronic
1183283949 22:36951212-36951234 CAGAGGCAGCAGAGCCACTCGGG + Intergenic
1183395158 22:37567281-37567303 CAGTGCCAGGAGAGGCGCAGGGG + Intronic
1184111532 22:42398314-42398336 CAGTGACAGCAGAGGAAGACTGG - Intronic
1184288093 22:43483321-43483343 CAGTGACAGCTGGGGGAGTGGGG - Intronic
1184926324 22:47642291-47642313 CAGTGCCAGCAGAGACCATGTGG + Intergenic
950093331 3:10312760-10312782 TAGTGCCTGCAGAGGCACTGTGG - Intronic
950126547 3:10513390-10513412 AAGGGACAGGAGAGGCAGTGGGG + Intronic
950231756 3:11282156-11282178 CAGTGACAGCTGAGAAAATGTGG - Intronic
950374588 3:12560408-12560430 TTGTGACAGCAGATCCACTGAGG - Intronic
950672161 3:14533748-14533770 CAGTGACAGCTTAGGGACAGCGG + Intronic
951159587 3:19401195-19401217 CAGTGACACCAGCATCACTGTGG - Intronic
951499476 3:23367966-23367988 GTGTGAGAGCAGAGGAACTGTGG + Intronic
953410961 3:42690330-42690352 CAGTCACTGCACACGCACTGAGG - Intronic
953487731 3:43317967-43317989 CAGTGACATCTGATGGACTGAGG - Intronic
953875950 3:46667010-46667032 GAGTGACAGCTGAGGTCCTGGGG + Intergenic
954306109 3:49726340-49726362 CAGAGCCACCAGAGGCCCTGAGG + Exonic
954652088 3:52171290-52171312 CAGTGGAAGCAGAGGCAGAGAGG - Intergenic
955865355 3:63376548-63376570 CAGCAACTGCAAAGGCACTGGGG - Intronic
956473738 3:69596768-69596790 CAGTTATAGGACAGGCACTGTGG - Intergenic
957247761 3:77735074-77735096 AAGGGACAGCAGAGGCAAAGTGG - Intergenic
961365757 3:126398259-126398281 CAGTTCCAGGAGAGGCACTGGGG + Intronic
961504022 3:127358271-127358293 CAGTGCCAGCAGAGGAACAGAGG - Intergenic
962458020 3:135583108-135583130 CAGTGACAGCAGAGGCTGGGTGG - Intergenic
962847576 3:139285550-139285572 CAGTGAGAGCAGAGGTCCCGAGG - Intronic
964432053 3:156617582-156617604 CAGTTAGAGCAAAGGCTCTGTGG + Intergenic
965894950 3:173564132-173564154 CAGTGAGTGCAGAGGCCCTATGG - Intronic
967237377 3:187399083-187399105 CACTGACTGCAGAGCCATTGTGG - Intergenic
967546938 3:190741593-190741615 CAGTGACAGGCTAGGCACTGTGG + Intergenic
968163953 3:196449228-196449250 AAATGACAGCAGAGGGACCGAGG + Intergenic
968832114 4:2937870-2937892 CTGTTCCAGCAGAGGGACTGTGG + Intergenic
969079581 4:4608081-4608103 CAGGGACTGCGGAGGCACAGAGG + Intergenic
969091128 4:4694732-4694754 CAGTCACAGGAGAGGTAATGAGG - Intergenic
969335124 4:6503252-6503274 CAGTGGCTGCAAAGGCCCTGAGG - Intronic
969638592 4:8383471-8383493 CAGAGACAGCAAAGTCACAGAGG + Intronic
969684829 4:8665591-8665613 CAGGCAGAGCAGAGGCTCTGGGG - Intergenic
970049340 4:11896337-11896359 CAGTGAGGCCAGAGGCACTGGGG + Intergenic
970907445 4:21232877-21232899 CAGGGACAGCAGAGAGAATGAGG + Intronic
972342793 4:38167051-38167073 CAGTGACAGGAAAGGAAGTGAGG + Intergenic
975511117 4:75194415-75194437 CAGCGGCAGCAGTGGCAGTGTGG - Intergenic
975558323 4:75686383-75686405 CAGTGAGAACAGAGGAAATGGGG + Intronic
975619002 4:76276760-76276782 CAGTGTGTGTAGAGGCACTGAGG + Intronic
976854714 4:89590160-89590182 CTGCAAAAGCAGAGGCACTGGGG - Intergenic
979766026 4:124464788-124464810 AAGTGACAGCAGAGCAATTGTGG - Intergenic
980095694 4:128488133-128488155 CAGTGATAACAGTGGTACTGGGG + Intergenic
980905430 4:138944081-138944103 CAGTAAGAGCAAAGGCACAGAGG + Intergenic
981309019 4:143277889-143277911 CAGTGTCAGCAGACACATTGGGG - Intergenic
981495371 4:145385769-145385791 CAGTGTCAGCAGAGACCATGTGG - Intergenic
981748409 4:148072089-148072111 CAGGGTCAGCAGGGGCTCTGAGG - Exonic
981752224 4:148103362-148103384 CAGGCACAGCACAGGCACTATGG - Intronic
983546396 4:168969048-168969070 CATTAACATCAGAGCCACTGTGG + Intronic
984818206 4:183857720-183857742 CAGGGACACCAGCAGCACTGGGG - Intronic
985261616 4:188119840-188119862 CAGATAGAGAAGAGGCACTGTGG + Intergenic
985710379 5:1424461-1424483 CAGTGACACCATGGGCAGTGAGG - Intronic
986224293 5:5798897-5798919 CAGTGTGAGCAAAGGCACTGAGG + Intergenic
986241832 5:5967158-5967180 CAGTGAGAGCAGGATCACTGTGG + Intergenic
986737108 5:10675958-10675980 CATTGACAGCAGAGGTCCCGGGG - Intergenic
988854079 5:35210105-35210127 CAGTACCTGCAAAGGCACTGAGG - Intronic
989112760 5:37923238-37923260 TAGTGTCAGGAAAGGCACTGTGG - Intergenic
990288912 5:54329009-54329031 ATGTGACAGCAGAGGCAGAGTGG - Intergenic
990294434 5:54386253-54386275 GAGTGACAGCAGAGGCATCTGGG - Intergenic
991478281 5:67047405-67047427 CAGCAAGAGCAGAGGCCCTGAGG - Intronic
992202701 5:74399952-74399974 CAGTGACAGAAGTGAGACTGAGG + Intergenic
992207527 5:74445422-74445444 GAGTGACTGCAGAGTCAATGTGG + Intergenic
992553938 5:77885205-77885227 CAGTGACTTCATGGGCACTGGGG + Intergenic
993822720 5:92639695-92639717 AAGTGACAACAGAGGCTCTTTGG + Intergenic
995274104 5:110258606-110258628 CCTTCACATCAGAGGCACTGAGG - Intergenic
995657150 5:114439543-114439565 CAGTGAAATCAGAATCACTGAGG - Intronic
997284152 5:132666400-132666422 CAGTGAAAGGAGAGGCTTTGGGG + Intergenic
997369365 5:133348312-133348334 GAGTCTAAGCAGAGGCACTGGGG + Intronic
998728054 5:145041734-145041756 CTGTGACAGCAGAGACCTTGTGG - Intergenic
999131811 5:149289368-149289390 GAGGGACGGCAGAGGCAGTGAGG - Intronic
999187307 5:149721318-149721340 TAGTCAGAGCAGAGGCCCTGGGG + Intergenic
999616618 5:153431863-153431885 CAGAGGCAGGAGAGGCACAGAGG - Intergenic
999988949 5:157031967-157031989 CAGGGAGTGCAAAGGCACTGAGG - Intronic
1000029735 5:157391191-157391213 CAGTGACAGCAGAGGCACTGAGG + Intronic
1000265630 5:159633570-159633592 CAGTGACACGAGAGATACTGTGG - Intergenic
1000286783 5:159833705-159833727 CAGCAAGAGCAAAGGCACTGAGG + Intergenic
1001086176 5:168701542-168701564 CAGTGAGGGCAGCGGCCCTGAGG + Intronic
1001641375 5:173246313-173246335 CAGTCACAGCAAAGGCCCTGTGG + Intergenic
1002094856 5:176824741-176824763 CAGGGAGTGCACAGGCACTGGGG - Intronic
1002662163 5:180798594-180798616 CAGTTACAGTTGAGGAACTGTGG - Intronic
1002759755 6:192302-192324 CAGTGACAGCAGAGCAAGCGTGG + Intergenic
1002902661 6:1423076-1423098 AAGTGAAGGCAGAGGCACAGAGG + Intergenic
1003246120 6:4383824-4383846 TGTTGACAGCAGTGGCACTGTGG - Intergenic
1003265979 6:4565400-4565422 CAGAGTCAGCAGGGGCCCTGGGG + Intergenic
1003345758 6:5265030-5265052 CCAAGACAGGAGAGGCACTGAGG - Intronic
1003362353 6:5440378-5440400 CAGTGGCTGCACAGCCACTGTGG + Intronic
1003875568 6:10433501-10433523 CAGTGAGTGCAAAGGCCCTGAGG + Intergenic
1003950531 6:11111536-11111558 CAGGGGGAGCAGAGCCACTGTGG + Intronic
1003960132 6:11201201-11201223 CAGCGGCAGCAGAGGCCATGTGG + Intronic
1005504294 6:26456753-26456775 CTGTCACAGCAGAGACACAGTGG + Intergenic
1006824942 6:36928011-36928033 CAGGGAAACCAGAGACACTGAGG - Intronic
1007842804 6:44730586-44730608 CTGAGTCAGCAAAGGCACTGGGG - Intergenic
1008467454 6:51846688-51846710 CTGTGACTGCAGAGTCACAGAGG - Intronic
1010301101 6:74261034-74261056 CAGTGACAGTTTTGGCACTGAGG + Intergenic
1012310045 6:97712437-97712459 CTGTCACAGCAGAGGCCATGGGG + Intergenic
1012840836 6:104326989-104327011 CAGTAAGAGCAAAGGCCCTGAGG - Intergenic
1015344363 6:132138473-132138495 CAGCCACAGCTGTGGCACTGGGG + Intergenic
1015922492 6:138279920-138279942 AAGAGGCAGCAGAGGCACTTAGG + Intronic
1017115039 6:150968136-150968158 CAATGACAGCAGAGGGACGGGGG - Intronic
1017363357 6:153603464-153603486 CAGTTGCAGCAGAGGCTCTGGGG + Intergenic
1017817897 6:158028328-158028350 CAGTGGCTGAGGAGGCACTGGGG + Intronic
1017957947 6:159194795-159194817 CACTCAGAGCTGAGGCACTGCGG + Intronic
1018309314 6:162491960-162491982 CAGAGACAGCAGAGGCACCGAGG - Intronic
1018441232 6:163815278-163815300 CAGTCACTGCAGAGGCAATGAGG + Intergenic
1018595829 6:165479406-165479428 CAGGAACTGCAGAGGCCCTGAGG - Intronic
1018744372 6:166750542-166750564 CAGAGTCAGAAGAGGCACGGAGG - Intronic
1018849652 6:167577893-167577915 CAGTCTCAGGAGAGGCACCGTGG + Intergenic
1019256448 7:55400-55422 GAGGGACCACAGAGGCACTGCGG + Intergenic
1019515202 7:1436840-1436862 CAGTGACTTCAGAGCCTCTGTGG + Exonic
1019665359 7:2249537-2249559 CAGTGACAGCCCAGGCCCAGTGG - Intronic
1019715861 7:2539029-2539051 CAGTGACTGCCGAGGCCCTGGGG - Intronic
1020196446 7:6043245-6043267 CAGTTACAGCAGAGTCCCAGAGG - Intronic
1020250934 7:6467865-6467887 CAGGGAAAGAAGAGGCACTCAGG + Intronic
1020553819 7:9643479-9643501 CAATTAAATCAGAGGCACTGAGG + Intergenic
1021100783 7:16584800-16584822 CACAGACAGCAGAGGCTTTGTGG + Intergenic
1021524397 7:21571038-21571060 CAGAGACAGAAGAGGCATTCAGG - Intronic
1022817635 7:33928782-33928804 ACGTGCCAGCAGAGGCAATGGGG - Intronic
1022844737 7:34198608-34198630 CAGTCACAGCAGTGGCAAAGCGG + Intergenic
1023085203 7:36563282-36563304 CAGTGACAGCAGAAATAGTGGGG - Intronic
1024119767 7:46225077-46225099 CAGTGGCAGCAGTGACACTGGGG + Intergenic
1024924680 7:54600423-54600445 CAGTCACATCAGAGGCACTTGGG + Intergenic
1025241427 7:57279493-57279515 TAGTGCCAGCAGAGGCACCAAGG - Intergenic
1026166124 7:67911325-67911347 CAGTGCCAGCAGAGGCACCAAGG - Intergenic
1026271120 7:68837884-68837906 CAGGGACAGCAGAGGAAATTGGG + Intergenic
1026916327 7:74122065-74122087 CAGTGAGAGGATAGGCACAGTGG + Exonic
1027230333 7:76268366-76268388 CAGTGCTGGCAGGGGCACTGGGG + Intronic
1027231277 7:76274137-76274159 CAGTGACAGAGGAGCCAGTGCGG + Intronic
1027558372 7:79695074-79695096 AAGTCACATCTGAGGCACTGTGG + Intergenic
1028157682 7:87450018-87450040 CCGTGGCAGAAGAGGCTCTGGGG - Exonic
1030064458 7:105648722-105648744 AGGTGACAGCAGAGGAAGTGAGG - Intronic
1030080145 7:105770582-105770604 GAGGGACAGCAGAGGAAATGGGG + Intronic
1030350365 7:108478251-108478273 CAGCAACTGCAGAGGCCCTGAGG + Intronic
1031294350 7:119983336-119983358 CACTGACAGCAGTGGCATGGTGG - Intergenic
1032657759 7:133950478-133950500 CAATGACAGAAGATGCCCTGAGG - Intronic
1032709003 7:134446521-134446543 CAGTGAGAACAGAGGCTCTTGGG + Intronic
1032883959 7:136117585-136117607 CAGTGCTGACAGAGGCACTGTGG + Intergenic
1034104281 7:148477184-148477206 TAGTCACAGCTGAGGTACTGGGG - Intergenic
1034373391 7:150621578-150621600 CAGTGACAGCAAAGACACAATGG + Intergenic
1034994567 7:155569936-155569958 CAGGGCCAGCGGAGGCACTGGGG + Intergenic
1035829029 8:2674802-2674824 CAGTGACAGCAGAGAGACCCAGG - Intergenic
1036086596 8:5619224-5619246 CAGTGAAAGCAGAGACATTTTGG - Intergenic
1037360726 8:18070731-18070753 AAGTGACAGCAGAGGAAAAGAGG - Intronic
1037765986 8:21772584-21772606 CAGAGTCAACAGAGGCAATGAGG + Intronic
1038414870 8:27387594-27387616 CAGTGAAAGCTGAGGGCCTGGGG - Intronic
1038584941 8:28779834-28779856 CAGTTACACCAGAAGCACTGGGG - Intronic
1039297653 8:36174267-36174289 CAGAGAAAACAGAGGCAATGTGG - Intergenic
1039880303 8:41621425-41621447 AAGGCACAGCTGAGGCACTGTGG + Exonic
1040489185 8:47904099-47904121 CACTGAGGGCAGAGGCAGTGAGG - Intronic
1041222195 8:55663165-55663187 CAGAACAAGCAGAGGCACTGTGG - Intergenic
1041260084 8:56013705-56013727 CAGTGACATCAGAAGAGCTGGGG - Intergenic
1041393298 8:57367049-57367071 CAGCGGGAGCAGAGGCAGTGTGG - Intergenic
1042513035 8:69631149-69631171 CAGTGCAAGCAGAGGTCCTGAGG + Intronic
1044318948 8:90780609-90780631 CAGAGATGGCAGAAGCACTGTGG + Intronic
1044891899 8:96845025-96845047 CAGTGAGTGCAAAGGCCCTGAGG - Intronic
1046400565 8:113698653-113698675 CAGTGGGTGCAGAGCCACTGTGG + Intergenic
1048332802 8:133482547-133482569 AAGTGAAAGCAGATGCAGTGGGG - Intronic
1049110224 8:140637594-140637616 CAGTGACTGCATGGGCCCTGGGG - Intergenic
1049483906 8:142841494-142841516 CAGGGACAGTAGAGGCTCTGAGG - Intronic
1049495090 8:142926328-142926350 CAGGGACAGCAAAGGCATAGAGG - Intergenic
1050881011 9:10700704-10700726 CAGTGTGAGCAGCAGCACTGTGG - Intergenic
1053161318 9:35815128-35815150 AAGTGGCTGCAGAGGCAATGGGG - Intronic
1053329498 9:37190210-37190232 CAGTGACAGCAGCAGCAGTGGGG - Intronic
1056139954 9:83666511-83666533 AAGTGCCAGCTGAGGCACTTGGG - Intronic
1056733832 9:89187506-89187528 CAGTGATAGCAGAGGGCCTAAGG - Intergenic
1057294564 9:93827717-93827739 CAGAGAGGGCAGAGGCACGGTGG - Intergenic
1058453023 9:105114494-105114516 AAGTCCCACCAGAGGCACTGAGG + Intergenic
1058897569 9:109413492-109413514 CAGCGACAGAGGAGGCACTAGGG - Intronic
1058951781 9:109910738-109910760 CGGTGAGGGCAGAGGGACTGAGG + Intronic
1058951790 9:109910799-109910821 CGGTGAGTGCAGAGGGACTGAGG + Intronic
1059561669 9:115340573-115340595 CAGTAACAGCAGGGGGACAGGGG + Intronic
1060381731 9:123181507-123181529 CAGTGACAGGCCAGGCACGGTGG + Intronic
1060559701 9:124532959-124532981 CAGTAACAGCAGAAGTAGTGAGG - Intronic
1060657352 9:125381059-125381081 CTGTCACAGCAGAGGGTCTGTGG + Intergenic
1060861347 9:126957251-126957273 CAGTGACAGAAGAGGGCCTGAGG + Intronic
1061120530 9:128639532-128639554 CAGTGAAACCAGAGAGACTGGGG + Intronic
1061805135 9:133133532-133133554 CATGGACAGCCGAGGCGCTGGGG + Intronic
1061939465 9:133876339-133876361 CGCTGCCAGCAGAGGCGCTGTGG + Intronic
1062074199 9:134575624-134575646 CATTGACTGCTGGGGCACTGAGG - Intergenic
1186798167 X:13066694-13066716 CAGGAAGAGCAGAGGCACAGAGG - Intergenic
1186839428 X:13470200-13470222 CAGTGACTGCACAGCCACTCAGG - Intergenic
1187005038 X:15224469-15224491 CAGTGTCCACAGAGGGACTGTGG + Intergenic
1188771327 X:34157905-34157927 CACTGGCAGCAGTGGCACAGCGG + Intergenic
1189131498 X:38502742-38502764 TAGAGACAGCAGCAGCACTGGGG + Intronic
1189558047 X:42165718-42165740 CAGTGGCAGCAGCAGCACGGTGG + Intergenic
1190028151 X:46945493-46945515 CAGTGGTAGCAGCAGCACTGGGG - Intronic
1190311529 X:49120296-49120318 TAGTAACAGCAAAGGCCCTGAGG + Intronic
1190605795 X:52140229-52140251 CAGTGTCAGCAGATCCCCTGTGG + Intergenic
1192158782 X:68767441-68767463 CAATGACATCAGAGTCTCTGGGG - Intergenic
1192158904 X:68768320-68768342 CAGTGACAGAACAGGAGCTGGGG - Intergenic
1192180328 X:68912141-68912163 GGGTGAGAGCAGAGGCGCTGCGG + Intergenic
1192190948 X:68990860-68990882 CACTGACAGGAGGGGGACTGGGG + Intergenic
1193352268 X:80477370-80477392 CAGTGCATGCAGAGGGACTGTGG + Intergenic
1194573640 X:95584268-95584290 TAGTGACTGGGGAGGCACTGAGG + Intergenic
1195528637 X:105924872-105924894 CAGTGAAAGAAGAGGCAGTGAGG + Exonic
1195767473 X:108311584-108311606 CAGCGAGGGCAGAGGCCCTGAGG - Intronic
1196937794 X:120746829-120746851 CTGCTACAGCTGAGGCACTGGGG - Intergenic
1197767985 X:130071378-130071400 CAGTGACAGGTGAGGTACTTCGG + Exonic
1199575341 X:149308152-149308174 CAGTGCCAGCAGAGCAGCTGTGG - Intergenic
1200850175 Y:7875101-7875123 CACTGGCAGGAGAGACACTGGGG + Intergenic