ID: 1000036754

View in Genome Browser
Species Human (GRCh38)
Location 5:157454553-157454575
Sequence CCTTCCCAGCCCTGCTGAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 561
Summary {0: 1, 1: 0, 2: 5, 3: 77, 4: 478}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000036754_1000036756 0 Left 1000036754 5:157454553-157454575 CCAGCTCAGCAGGGCTGGGAAGG 0: 1
1: 0
2: 5
3: 77
4: 478
Right 1000036756 5:157454576-157454598 ACTTCAGACTATATCTTGCGCGG 0: 1
1: 0
2: 0
3: 8
4: 46
1000036754_1000036757 14 Left 1000036754 5:157454553-157454575 CCAGCTCAGCAGGGCTGGGAAGG 0: 1
1: 0
2: 5
3: 77
4: 478
Right 1000036757 5:157454590-157454612 CTTGCGCGGTCCTCTTATCCAGG 0: 1
1: 0
2: 0
3: 1
4: 29
1000036754_1000036760 26 Left 1000036754 5:157454553-157454575 CCAGCTCAGCAGGGCTGGGAAGG 0: 1
1: 0
2: 5
3: 77
4: 478
Right 1000036760 5:157454602-157454624 TCTTATCCAGGTTGGATGTAAGG No data
1000036754_1000036758 18 Left 1000036754 5:157454553-157454575 CCAGCTCAGCAGGGCTGGGAAGG 0: 1
1: 0
2: 5
3: 77
4: 478
Right 1000036758 5:157454594-157454616 CGCGGTCCTCTTATCCAGGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000036754 Original CRISPR CCTTCCCAGCCCTGCTGAGC TGG (reversed) Intronic
900461670 1:2804872-2804894 GCTTCCCCGCCCTCCTGACCCGG + Intergenic
900518330 1:3093813-3093835 CCTTCCCTGCGCTTCGGAGCTGG - Intronic
900520317 1:3102232-3102254 CCCTCCCAGCCCCGCTGGGGAGG - Intronic
900922815 1:5684459-5684481 CCCACCCAGACCTGCTGAGGCGG + Intergenic
901672180 1:10862407-10862429 CCTCCTCAGCCCTGCTAAGGAGG - Intergenic
901827187 1:11869889-11869911 CCTTCCCAGCCTGGCTGCTCTGG + Intergenic
902755086 1:18543787-18543809 TCTTCCCAGCTCTGCAAAGCTGG - Intergenic
903019718 1:20385648-20385670 CTTTCCCAGACCTGCTGACTTGG + Intergenic
903390955 1:22963315-22963337 CCTCCCCAGCCGAGCCGAGCCGG + Intronic
903738276 1:25543917-25543939 CTTTCCCGGCCCTGCGGGGCAGG + Intronic
904418665 1:30377718-30377740 CCTTCCCAGCTCCCCTGAGTGGG + Intergenic
904425159 1:30418129-30418151 CCTCCCCAGCCAGGCAGAGCTGG + Intergenic
904575365 1:31501950-31501972 CCTTCCCAGCCTTCATGTGCAGG - Intergenic
904809184 1:33152263-33152285 CCTCCCCAGTCTTGCTGAACAGG - Intronic
905954570 1:41981471-41981493 CCTCCCCACCTCTGCTGAGCTGG + Intronic
906670736 1:47652595-47652617 GCTTCCCTTCCCAGCTGAGCTGG + Intergenic
906681099 1:47725852-47725874 CCTTCAGGGCACTGCTGAGCGGG + Intergenic
907213390 1:52842529-52842551 CCTTCCCAGCCCTGCACCTCAGG - Intronic
907474154 1:54694448-54694470 CCATCCCAGACCTACTAAGCAGG - Intronic
907561978 1:55399550-55399572 CATTCCCAGGTCTGCTGAGCAGG - Intergenic
907924897 1:58946202-58946224 CCTTCCCAGCCATGCTGAACTGG - Intergenic
908453846 1:64282501-64282523 CTCTTCCAGCCCTGCTGACCTGG + Intergenic
909312975 1:74176778-74176800 CCTGCCCCTCCCTGCTGAGGTGG - Intronic
910674282 1:89801188-89801210 CATGCCCAGCCCTGCTGTGATGG + Intronic
911970976 1:104437354-104437376 TCTTCTGAGCCCTGTTGAGCAGG + Intergenic
912527860 1:110298041-110298063 CCTTCCAAGCTCTGCTGGACTGG + Intergenic
912698914 1:111861667-111861689 CATTCCCAGCCTGGCAGAGCAGG + Intronic
914003284 1:143710692-143710714 CCTTCCCAGCCCTTCTCAACTGG + Intergenic
914094500 1:144533182-144533204 TCTTCCCAGCCCTTCTCAACTGG + Intergenic
914304021 1:146400705-146400727 TCTTCCCAGCCCTTCTCAACTGG - Intergenic
914515729 1:148372488-148372510 TCTTCCCAGCCCTTCTCAACTGG + Intergenic
914857787 1:151364990-151365012 GCTTCCCATCCAGGCTGAGCTGG + Exonic
915580184 1:156808790-156808812 CCTTCACGGCCCTGCTGTCCTGG - Intronic
915849559 1:159306666-159306688 CTTTCCCAGCCCTCCTAAGCTGG - Intronic
916188107 1:162152514-162152536 CCTTCTGAGCTCTGCTGAGGCGG - Intronic
916194699 1:162212196-162212218 CCTTCCCAGCCTTGCAGAGGGGG - Intronic
917631417 1:176894627-176894649 CCCTGACACCCCTGCTGAGCCGG - Exonic
918074787 1:181161760-181161782 CCTTCCCAGCCCAGCTCGTCTGG - Intergenic
918076313 1:181173899-181173921 CCTGCCCCACCCTGCTGAGGTGG - Intergenic
918303526 1:183225490-183225512 CCTTCCCAGTCCTGCTTAGAAGG - Intronic
918626262 1:186659146-186659168 CCATCCCAGCCCTGAGGAGAAGG - Intergenic
919307842 1:195866841-195866863 CCTTCCCAGCCATGTGGAACTGG - Intergenic
919749879 1:201030873-201030895 CCTTCCCAGACCTGGTGATGAGG + Intergenic
919929869 1:202214283-202214305 CCTCCGCAGCCCTGGGGAGCAGG + Intronic
920441877 1:205986149-205986171 CTTCCCCAGCCCAGCTAAGCAGG + Intronic
920504484 1:206506861-206506883 CCTTCGCAGCCCTGCCGGGTAGG - Intergenic
922614622 1:226954485-226954507 CCACCCCAGACCTGCTGAGACGG + Intronic
922725480 1:227921053-227921075 CCTGGCCAACCCTGCTGTGCAGG - Exonic
922725567 1:227921486-227921508 CCCTGCCAGCCCTGCTGCACAGG - Exonic
923160643 1:231311846-231311868 CCTTGCCAATCATGCTGAGCAGG + Intergenic
923311621 1:232741115-232741137 CCTACACAGCACTCCTGAGCAGG - Intergenic
923629309 1:235639473-235639495 CCTTCCCTGTCCTTCTGGGCCGG + Intronic
924063047 1:240196445-240196467 CCTACCCAGACCTACTGAACTGG + Intronic
924738639 1:246781404-246781426 CCTTCCCAGCCCAGCATGGCAGG + Intergenic
1062768431 10:82204-82226 CCCTCCCCTCCCTGCTGGGCTGG - Intergenic
1063015318 10:2070877-2070899 CCCTCCCAGCCCTGCTCAGCAGG - Intergenic
1063085969 10:2817974-2817996 CCTTCCCTGACCTGCTGCCCCGG + Intergenic
1064408224 10:15083296-15083318 CCATCCCAGCCATGATGAGCTGG + Intronic
1064686612 10:17868275-17868297 CCTCCCCAGCCATGTGGAGCTGG - Intronic
1065260251 10:23916375-23916397 CCTTCACAGCCCGGCTCAGTTGG + Intronic
1067281535 10:44877052-44877074 TCTTTCCAGGCCTGCTGAGGGGG + Intergenic
1067415199 10:46097359-46097381 TCTGCCCAGCCTTGCTGTGCAGG - Intergenic
1067711644 10:48655581-48655603 CCTTCCCAGCGCTGCCCGGCAGG - Intronic
1068963882 10:62892723-62892745 CCTTCACATCCCTGCTGGGAAGG + Intronic
1069829743 10:71275546-71275568 TCTTCCGAGCTCTGCTGAACTGG - Intronic
1070494620 10:77010315-77010337 CCATCCCAGCCATGCTTAGTTGG - Intronic
1070592127 10:77808757-77808779 CCTGCCAAGCCCTTCTGAGGAGG - Intronic
1070834262 10:79438093-79438115 CCTTCTCAGGCCTGGGGAGCAGG - Intronic
1070850506 10:79558867-79558889 CCTGCCCCGCCCTGCTCACCTGG + Exonic
1070963823 10:80517417-80517439 CCATCCCAACCTTGGTGAGCAGG - Intronic
1071490578 10:86133840-86133862 CCTGCCCAGCCCTGATGTCCAGG - Intronic
1071527866 10:86368243-86368265 CTGTCCCTGCCCAGCTGAGCTGG - Intergenic
1071715332 10:88089657-88089679 TCTTCCCAGCACAGCTGGGCTGG + Intergenic
1072066835 10:91879577-91879599 TCTTCCCAGCCCTTCTGGGTGGG - Intergenic
1072428613 10:95351716-95351738 CATTCCCAACCATGCTGGGCTGG + Intronic
1072539214 10:96385513-96385535 CCTCCCCACCCCAGCTGAGCTGG - Intronic
1072720605 10:97778596-97778618 CCTACCCAGCGATGCTGAGCAGG - Intergenic
1073656910 10:105426211-105426233 CCTTCCCAGCTGAGATGAGCAGG + Intergenic
1075006695 10:118835812-118835834 CCTGGCCAGCCCTGCAGAGATGG + Intergenic
1075425654 10:122339848-122339870 TCTTCCCATCCCTGCCGGGCGGG + Intergenic
1075488882 10:122849314-122849336 CCTTCACAGCACTGCAGGGCAGG + Exonic
1075914716 10:126157372-126157394 CCTTCCCTGCCATACTGATCAGG - Intronic
1076012750 10:127003628-127003650 CCTTCCTAGCCCTGCTCAGCTGG + Intronic
1076036464 10:127202425-127202447 CCTTCCCAGGCCTTCTGCCCCGG + Intronic
1076096620 10:127738334-127738356 TCTTCCCAGTCCTGCTGTGGAGG + Intronic
1076290197 10:129340145-129340167 ACATCCCAACCCTGATGAGCAGG - Intergenic
1076895270 10:133308549-133308571 CCCTCCCAGCCCTGGGAAGCCGG - Exonic
1077093583 11:790128-790150 CCCTCCCCGCCCTCCTGCGCCGG - Intergenic
1077122085 11:914285-914307 CATTCCCAGCCCTCCTTACCCGG + Intronic
1078352531 11:10606296-10606318 GCTTCCCGGCTCCGCTGAGCTGG + Intronic
1080053719 11:27883781-27883803 GCCTCCCAGCCATGCTGAACTGG - Intergenic
1080611565 11:33908690-33908712 ACTACTCAGCTCTGCTGAGCAGG + Intergenic
1080878384 11:36297210-36297232 CCCGCCCAGCCCTGCTGGTCTGG + Intronic
1081262029 11:40972581-40972603 CCTCCCAAGCCATGCTGAACTGG - Intronic
1083253043 11:61480939-61480961 TCTTCCCAGCCCTGTGGAGGAGG + Intronic
1083301192 11:61740355-61740377 CCATGCCAGCTCTGCTGAGCAGG + Intronic
1083311360 11:61785537-61785559 CCTTCCCAGTCCTGTTGTGCTGG - Intronic
1083696219 11:64444539-64444561 CCTTTCAAGCCCAGCTGAGGTGG - Intergenic
1083768256 11:64852588-64852610 CCTGCCCAGTCCTGCTCTGCTGG - Exonic
1084162027 11:67355259-67355281 CCTTCCCAGCCCTGGTAGACAGG - Intronic
1084203623 11:67578179-67578201 GCTTCCGTGCCCTGCTGAGCTGG + Intergenic
1084649445 11:70480149-70480171 CCTGCCCAGCCCTCCTCATCTGG + Intronic
1084653739 11:70503463-70503485 CCTTCCCAGGCCTCTGGAGCGGG - Intronic
1084694952 11:70747309-70747331 CCCTCCCATCCCTGCTGCCCAGG - Intronic
1085508655 11:77074322-77074344 CATCCCCAGCCCTGCAGAGCTGG + Intronic
1086135590 11:83441176-83441198 CCTCCCCAGCCATGCTAAACTGG - Intergenic
1087163347 11:94973234-94973256 CCTTCGCACCCCTGCAGTGCTGG - Intronic
1088817318 11:113430509-113430531 CCTTCCCAGCATTTCTAAGCTGG + Intronic
1089076890 11:115745541-115745563 TCTTCCCAGCCCTGGTGATGGGG - Intergenic
1089684082 11:120135781-120135803 CCTGCCCAGCCTTCCTGACCAGG - Intronic
1090164653 11:124534352-124534374 CCTTCTTAGCCTTGCTGAGAGGG - Intergenic
1090255188 11:125278964-125278986 TTTTCCCAGCCTGGCTGAGCCGG + Intronic
1091165171 11:133469018-133469040 CCTACCCTGCCCTGAGGAGCTGG + Intronic
1091640252 12:2230587-2230609 CCGTCCCCGCCCTGCTGACCGGG + Intronic
1092381022 12:7997205-7997227 CCTTCCCAGCCGGGATGAGTAGG - Intergenic
1093665789 12:21811262-21811284 CCTCCCCAGCCATGAAGAGCTGG + Intronic
1095608833 12:44103009-44103031 CCTCCCCAGCCATGCTGAACTGG + Intronic
1095841851 12:46702087-46702109 CCTCCCCAGCTCTTATGAGCAGG - Intergenic
1096078790 12:48820308-48820330 TCTTCCCATCCCTGGTGAGAAGG + Intronic
1096789020 12:54033890-54033912 CCCTCCCTCCCCTGCGGAGCCGG + Intronic
1096830096 12:54307196-54307218 CCATCCCAGCACTACTGGGCGGG + Intronic
1097199241 12:57264262-57264284 GCTTCCCAGCCCAGCTGGGAAGG - Intronic
1098855678 12:75650802-75650824 CCTTCCCTGTTCTTCTGAGCAGG + Intergenic
1101292909 12:103389237-103389259 TCTTCTCAGTCCTGCTGAGTAGG - Intronic
1101728475 12:107407192-107407214 CCTGCCAAACCCTGGTGAGCTGG - Intronic
1101866885 12:108526883-108526905 CTATCCCAACCCTGCTGATCTGG - Intronic
1104860586 12:131921389-131921411 CCTGCCGAGCCCTGCAGAGTGGG + Exonic
1105068474 12:133219354-133219376 CTTTTCCAGCCCTCCAGAGCTGG - Exonic
1106496749 13:30285523-30285545 CCTCCCCAGCCATGCAGAACTGG + Intronic
1107444688 13:40459576-40459598 GCTTCCAAGTCCTGCTTAGCTGG - Intergenic
1108068297 13:46601707-46601729 CCTTCCAAGCCCTGCTCTGTTGG + Intronic
1108548363 13:51519038-51519060 CCTACCCAGCCATCCTGAACGGG + Intergenic
1109525170 13:63566177-63566199 CATTCCCAGCACTGCTCAGCAGG + Intergenic
1111531418 13:89541921-89541943 CTCTCCCAGCCCAGCTCAGCAGG + Intergenic
1112465016 13:99636443-99636465 CCTGCCCAGCCCAGATGTGCTGG - Intronic
1112507719 13:99985175-99985197 CCCTCCCAGGCCGGCTGAGGTGG - Intronic
1112576346 13:100640029-100640051 CCTCCCCAGGCCTGCTGAGTCGG - Intronic
1113167217 13:107455199-107455221 CCTCCCCAGCCATGCAGAACTGG + Intronic
1113249379 13:108434712-108434734 CCTTCCCAGTCATGCTAAACTGG + Intergenic
1113404617 13:110026736-110026758 CACCCCCAGCCCTGCCGAGCAGG + Intergenic
1113436008 13:110291520-110291542 CCTTCTCAGCCCTGCGAGGCTGG + Intronic
1113496210 13:110731267-110731289 CCTTCCCAGCCCTGCCCAAATGG + Intergenic
1113649771 13:112027268-112027290 TGTCCCCAGCCCTGCTGATCTGG - Intergenic
1113776051 13:112945607-112945629 CAGTTCCTGCCCTGCTGAGCAGG + Intronic
1114050493 14:18916734-18916756 CCTTCCCATGCCAGCTGGGCGGG + Intergenic
1114112064 14:19485198-19485220 CCTTCCCATGCCAGCTGGGCGGG - Intergenic
1114673725 14:24428238-24428260 CCCTCCCCACCCTCCTGAGCCGG + Intronic
1115203016 14:30874246-30874268 CCTCGCCAGCCCTGCTCTGCCGG - Intergenic
1116669873 14:47828023-47828045 ACTTCCCAGCCCTGCAGAACTGG - Intergenic
1116963741 14:50993217-50993239 CCCTCCCATCCCAGGTGAGCAGG - Intronic
1118900760 14:69983530-69983552 CCTTCCCTCCCCTGCAGAGGTGG - Intronic
1119059959 14:71464138-71464160 CCTTCCCAGCTGTGATGAGTAGG + Intronic
1119132988 14:72191843-72191865 TCTTCACATCTCTGCTGAGCTGG + Intronic
1119379041 14:74217199-74217221 CCTCCCAAGCCCAGCAGAGCAGG - Intergenic
1119767010 14:77196452-77196474 CCTTCCCAGGCCTCATGGGCAGG - Intronic
1119963258 14:78883107-78883129 CCTTTCCAGCCCTGGTGAACTGG + Intronic
1121299471 14:92859169-92859191 TCCTCCCACCCCAGCTGAGCTGG + Intergenic
1121383499 14:93495238-93495260 CCTCCCCAGCCATGCGGAACTGG - Intronic
1121948988 14:98152675-98152697 CCTTCCCTTCCCTGCCTAGCTGG + Intergenic
1122044816 14:99015998-99016020 CCCGCCCAGCCATGGTGAGCAGG + Intergenic
1122258538 14:100498764-100498786 CATTCCAAGCCCTGCTGGCCAGG + Intronic
1122271058 14:100568634-100568656 CCTGCCCAGCCCCGCTCAGCCGG + Intronic
1122329943 14:100905188-100905210 CCTTCCCAGCATGACTGAGCCGG + Intergenic
1122619301 14:103045456-103045478 CCCTCCCAGCCCCGAGGAGCAGG + Intronic
1122629667 14:103101818-103101840 CCTTCCACTCCCGGCTGAGCCGG - Intronic
1123738971 15:23216469-23216491 CCTTCCAGCCTCTGCTGAGCTGG + Intergenic
1124290191 15:28445439-28445461 CCTTCCAGCCTCTGCTGAGCTGG + Intergenic
1124293047 15:28472129-28472151 CCTTCCAGCCTCTGCTGAGCTGG - Intergenic
1124693821 15:31847001-31847023 CCTTCCCTGCCCTGCCTAGCAGG - Intronic
1125476971 15:40054298-40054320 GCGTCCCAGCCTTGGTGAGCTGG + Intergenic
1125793497 15:42387429-42387451 CTGCCCCAGACCTGCTGAGCAGG + Intronic
1126526511 15:49661886-49661908 CCTTCTAAGCACTGCTGAGAAGG + Intergenic
1128676649 15:69614855-69614877 CCTCCCCAGCCCCACTGTGCTGG + Intergenic
1128731971 15:70027286-70027308 CCTTCCCTTCCCTGCCCAGCCGG + Intergenic
1129858296 15:78840815-78840837 CCTGCCCTGCCCTGCTGGGTGGG + Intronic
1130547560 15:84868134-84868156 GCTTCCCTGCCCTGCTGGACCGG + Exonic
1131183881 15:90258694-90258716 CTTTCCCAGACCACCTGAGCAGG - Intronic
1131234480 15:90684060-90684082 CCCTCCCAGCCCTGCATAGGTGG + Intergenic
1131377728 15:91939480-91939502 TCTGCCCAGCCCTGCAAAGCTGG - Intronic
1132595495 16:747226-747248 CCTCCCCAGCCCTGTGGAACTGG + Intronic
1132764246 16:1526344-1526366 CGTGCTCAGCCCTGCTGACCTGG + Intronic
1132841113 16:1978958-1978980 CCCTCCCATCCCTGCTGGCCAGG + Exonic
1132924664 16:2422825-2422847 TCTTCCCAGACCTGGAGAGCAGG + Intergenic
1133028064 16:2997229-2997251 CCCTCCCAGGCCTCCAGAGCAGG + Intergenic
1133269225 16:4602449-4602471 CCCTCCCAGCTCAGCAGAGCGGG - Intergenic
1134083855 16:11343037-11343059 GCCTCCCAGCCCTGCGGAACTGG - Intronic
1134110858 16:11514656-11514678 CCTCCCCAGCCTCGCTGAGTGGG - Intronic
1135019081 16:18948579-18948601 CCTACCCAGACCTGATGAGTCGG - Intergenic
1135355262 16:21763709-21763731 CCTTCACAGCCCTCCTCAGCTGG + Intergenic
1135453747 16:22579851-22579873 CCTTCACAGCCCTCCTCAGCTGG + Intergenic
1135625765 16:23993498-23993520 CCTTCCCAGCATGGGTGAGCGGG - Intronic
1135889693 16:26346061-26346083 CCTTCACAGCCATGCAAAGCTGG + Intergenic
1136173403 16:28502072-28502094 CCTTCCATGCCCTGCTGGGAGGG - Exonic
1136412359 16:30084861-30084883 CCATCCCAGCCCGGCCCAGCCGG - Intronic
1139429056 16:66901320-66901342 CATTCCCAGCCCTGCTGCCCAGG - Intergenic
1139532336 16:67548508-67548530 CCTTCCCAGCATTGGAGAGCAGG - Intergenic
1139693481 16:68656402-68656424 CCTTGCCAGCCCTGCTGCCTGGG - Intronic
1140078460 16:71723395-71723417 CCCTCCGAGCCCTCCGGAGCCGG + Intronic
1141021647 16:80502381-80502403 CTTCCCCAGCCCTGCAGAACTGG - Intergenic
1141162930 16:81641110-81641132 CTCGCCCAGCTCTGCTGAGCTGG + Intronic
1141479949 16:84299811-84299833 CCCTCCCAGCCCCCCTCAGCAGG - Intronic
1141820449 16:86442047-86442069 CCCACCCAGCCTTGCAGAGCAGG + Intergenic
1141842317 16:86580999-86581021 CCCTCCCAGCCCTGCCAGGCAGG + Exonic
1141900236 16:86986239-86986261 CCTTTCCAGCCCTGAAGAGGTGG + Intergenic
1142177093 16:88650394-88650416 CCTGCCCAGCCCAGCTGCACAGG - Intronic
1142820222 17:2460293-2460315 CCATCCCAGCTCTGGAGAGCTGG - Intronic
1142887635 17:2922648-2922670 TCTTCCCATCCCTGCTGCCCCGG + Intronic
1142889092 17:2931445-2931467 CCTTCCCGGCCCCGCTGTCCTGG - Intronic
1142905323 17:3037266-3037288 CCTTACCAGCCCTGGGGAGGGGG + Exonic
1143018727 17:3905211-3905233 TCTTCCCAGCCCAGGTGAGCTGG - Exonic
1143095388 17:4476041-4476063 CCCACCCTGCCTTGCTGAGCGGG - Intronic
1143200882 17:5112264-5112286 TCTTCCCAGACCTGATGAGAGGG + Exonic
1143434591 17:6914258-6914280 CCTTCCCTGTCCTGCAAAGCCGG - Intronic
1143445485 17:7006660-7006682 CCTTCCCAGCCCTGCCCTTCTGG + Intronic
1144508195 17:15851547-15851569 CCTTCCCAGCCATGCTTGCCAGG + Intergenic
1145119831 17:20248179-20248201 CCTTCCCAGCCATGTTTACCAGG + Intronic
1145121795 17:20266971-20266993 ACTTCCCAGTGCTGCTGACCTGG - Intronic
1145172317 17:20669181-20669203 CCTTCCCAGCCATGCTTGCCAGG + Intergenic
1145868637 17:28256376-28256398 CCTCCCCACCTCTCCTGAGCGGG + Intergenic
1145960614 17:28884672-28884694 TCCTCCCGGCCCTGCTGTGCAGG + Intronic
1147445782 17:40474536-40474558 CCCTCCCACCCCTGCCGGGCTGG + Intergenic
1147473929 17:40691719-40691741 CATTCACAGCACTGTTGAGCTGG - Intergenic
1148452609 17:47789910-47789932 CCTCCCCAGCACTGCTGGACCGG - Intergenic
1148794550 17:50190754-50190776 CGTGCCCAGGCCTGCTGAGGAGG + Intronic
1148907930 17:50923005-50923027 GCTTCCCAGCCTGGCTGGGCCGG - Intergenic
1149607713 17:57936467-57936489 CCTTCCCTGCCATCCTGGGCTGG - Intronic
1151337638 17:73449447-73449469 CTCTCCCAGCCCGGCTGTGCTGG + Intronic
1151380744 17:73724205-73724227 CTCTCCTAGCACTGCTGAGCAGG - Intergenic
1151499816 17:74481544-74481566 CCCTCCCAGCCAAGCTGACCTGG + Intronic
1151724234 17:75875340-75875362 CCCTCCCAGGGCTGCTGGGCTGG - Intronic
1151929830 17:77225363-77225385 CCTCCCAAGCCATGCTGAACTGG - Intergenic
1152069116 17:78126430-78126452 CCATCCCAGGCCTGCAGAGCTGG + Intronic
1152109795 17:78351691-78351713 CCCTCCCAGCTGTGCTGTGCTGG - Intergenic
1152699186 17:81810808-81810830 CCTACCCTACCCTGCAGAGCTGG + Exonic
1153229121 18:2920129-2920151 CCTTCCCAGGCCAGCTGCTCAGG - Exonic
1154309213 18:13254440-13254462 CCGCGCCAGCCCTGCTCAGCTGG - Intronic
1154411845 18:14145920-14145942 CTTTCCCAGCCATCCTGAGTAGG - Intergenic
1155224623 18:23718604-23718626 CCCCCGCAGCCCTGCAGAGCAGG - Intronic
1155428070 18:25726617-25726639 CCTTCCCCACTCTGGTGAGCAGG + Intergenic
1155810265 18:30224473-30224495 CCTTCACATCCCTGGTAAGCTGG + Intergenic
1156238577 18:35228926-35228948 CCTCCCCAGCCATGCGGAACTGG + Intergenic
1156457819 18:37304655-37304677 CCTCCAGAGCTCTGCTGAGCTGG - Intronic
1157107967 18:44792594-44792616 CGTTCCTCCCCCTGCTGAGCAGG + Intronic
1157618570 18:49002244-49002266 CCTCCCTGGCCCAGCTGAGCAGG + Intergenic
1160218988 18:76958741-76958763 CCTTCCCAGCACTGCAGACCAGG - Intronic
1161316515 19:3619942-3619964 CCTGCCCTCCCCTGCTGGGCAGG - Intronic
1161469272 19:4448202-4448224 CCTTCCCAACCCACCTCAGCAGG + Intronic
1162514995 19:11142523-11142545 TCAGCCCAGCCCTGCTGAGGTGG - Intronic
1163188175 19:15654160-15654182 CCTTCCCAGGACTGCTGTGCTGG - Intronic
1163829187 19:19539756-19539778 CCTTCCCAGTCCTCCAGGGCTGG - Exonic
1163835571 19:19571452-19571474 CCGTCCCAGCTCTGCAGAGAGGG + Intronic
1164050922 19:21585546-21585568 CTTTCCCTGCCCTGTTGAGGCGG + Intergenic
1164654204 19:29909086-29909108 CCTTACCACCCCTGCTGTGCAGG + Intergenic
1164836504 19:31358287-31358309 AACTCCAAGCCCTGCTGAGCTGG - Intergenic
1164919584 19:32078932-32078954 TCTTCCTGGCCCTGCTGTGCTGG - Intergenic
1165789594 19:38483529-38483551 CCTGCCCACCCCTGCATAGCTGG - Intronic
1165913550 19:39244366-39244388 CCCTCCCAGCCCTGCTCACCTGG - Intronic
1165942612 19:39422799-39422821 CATTCCAAGCCCTGCCCAGCCGG + Exonic
1166219924 19:41357718-41357740 CCTTCCCAGGCCTGCTCAATAGG - Intronic
1167153799 19:47725818-47725840 ACTTCCCGGCCGTGCTGCGCTGG + Exonic
1167158635 19:47754311-47754333 CCTTCACAGACGTGCAGAGCAGG + Intronic
1167492032 19:49798614-49798636 TCTTCCCAGCCCAGCAGAGATGG - Intronic
1167712786 19:51122792-51122814 CCAACCCCGCCCGGCTGAGCTGG + Intergenic
925277693 2:2662101-2662123 GTTTTGCAGCCCTGCTGAGCTGG + Intergenic
925390137 2:3488964-3488986 CTTCCCCAGCCCTGCTGACCTGG + Intergenic
926205738 2:10833353-10833375 GCCTCCCAGGCCTGCTGATCGGG - Intronic
926337783 2:11877138-11877160 CCTTCCCAGACCTGCTGGACGGG + Intergenic
926750001 2:16191111-16191133 CCTTCCCGGCCTTGCTTAGCTGG - Intergenic
926773580 2:16400285-16400307 ACTTCCCAGCCACGCTAAGCAGG - Intergenic
927145752 2:20164577-20164599 CCTCCCTGGCCATGCTGAGCAGG + Intergenic
927810496 2:26177970-26177992 CCTTCCCAGCCTTGGTGAGGGGG - Intronic
928438693 2:31273364-31273386 CCTTCCCAGCCATCATGATCTGG + Intergenic
929599878 2:43198350-43198372 CCCTCCCAGCACCTCTGAGCCGG - Intergenic
932219094 2:69986517-69986539 CCTGCTCAGCACTGCTGGGCTGG - Intergenic
932219095 2:69986517-69986539 CCAGCCCAGCAGTGCTGAGCAGG + Intergenic
932332401 2:70905127-70905149 CAGGCCTAGCCCTGCTGAGCAGG + Intronic
932397260 2:71456519-71456541 CCTTCCCTCCCCAGCTGGGCTGG + Intronic
933652373 2:84859752-84859774 CCATCCCAGACCTCCTGAACTGG - Intronic
933750016 2:85597249-85597271 CCTACCCAGTCCTGCTGAGGTGG - Intronic
933983882 2:87574883-87574905 CCTTCCCAGCCCTGGGCAGTGGG - Intergenic
934857377 2:97737748-97737770 CCTCCCCAGGCCCGCTCAGCAGG + Exonic
935032756 2:99337817-99337839 CCTTCCCCGGCCTGAGGAGCGGG + Intronic
936056346 2:109264736-109264758 CCTTCCCAGGCCCACTGGGCGGG + Intronic
936309972 2:111375911-111375933 CCTTCCCAGCCCTGGGCAGTGGG + Intergenic
936372383 2:111912911-111912933 CCTTCCTAGCCATGGAGAGCTGG + Intronic
936985925 2:118311233-118311255 CCTTCCCAGGCCTCCTGGGCGGG - Intergenic
937070042 2:119056453-119056475 GGATCCCAGCCCTCCTGAGCGGG - Intergenic
937322913 2:120971608-120971630 ACTTCTCAGCCCTCCAGAGCAGG - Intronic
938092591 2:128443134-128443156 CCTTCCCTTCTCTGCTGAGGTGG + Intergenic
938096208 2:128465770-128465792 CCTTCCCCACCCTGCAGGGCAGG - Intergenic
938228100 2:129635159-129635181 CCTTCCCTGCCCTGCAGTGATGG - Intergenic
938725554 2:134105862-134105884 AGTTCCCAGCCCAGCTGAGCTGG + Intergenic
939803789 2:146747992-146748014 CCTACTCAGCCATGCTGAACTGG - Intergenic
939839790 2:147173130-147173152 CCTGCCCAGCCCTGCCTTGCTGG + Intergenic
940698384 2:157009571-157009593 CCTCCCCAGCCATGCAGAACTGG + Intergenic
944546621 2:200805207-200805229 CCTTCTCAGCCCTGTGGAGTTGG + Intergenic
946106180 2:217371917-217371939 TCCTGCCAGCCCTGCAGAGCTGG + Intronic
947289945 2:228561882-228561904 CCTCCTCACCCCTGCTGAACTGG - Intergenic
947728771 2:232416934-232416956 CCTTCTCAGCCATGCTCAGGAGG - Intergenic
947841608 2:233211304-233211326 TCATCCAAGCCCTGCAGAGCAGG + Intronic
948541993 2:238697677-238697699 CCATCGCAGCCCTGCTGTGCTGG + Intergenic
948754099 2:240149268-240149290 CCTGCCCAGGCCTTCTGAGTGGG - Intergenic
948802608 2:240439698-240439720 GCTTCTCAGTCCTGCTCAGCGGG + Intronic
948811488 2:240480677-240480699 CCACCCCATCCCTGCAGAGCTGG - Intronic
1169143879 20:3240173-3240195 CCGTCCCAGCGCGGCTGAGCCGG - Intergenic
1170568508 20:17620055-17620077 CCTGCCCAGCCCTGGTGAACAGG - Intronic
1170850472 20:19999495-19999517 CCTTCCCTTCACTGCTGAGCAGG + Intronic
1171104739 20:22421617-22421639 CCATCACAGCTCTGCTGACCAGG - Intergenic
1172170723 20:32930356-32930378 GGCTCACAGCCCTGCTGAGCCGG + Intronic
1172357876 20:34292339-34292361 CCTGCCCCGCCCTGCTCACCTGG + Exonic
1172640019 20:36435364-36435386 CCTTCCCTGTCCTTCTGAGCCGG - Intronic
1175231937 20:57479397-57479419 CTGTCCCAGCCCTCCTTAGCAGG - Intergenic
1175322789 20:58101171-58101193 CCAGCCCAGCCCAGCTGAGTCGG - Intergenic
1175520034 20:59596727-59596749 CCTTCCAAGCTCTGCTCAGCAGG + Intronic
1175923886 20:62462655-62462677 CCTGCCCTGCCCTGCTCATCTGG - Intergenic
1175940914 20:62537219-62537241 CCTTCCCAGGGCTGCCAAGCCGG - Intergenic
1176146520 20:63567945-63567967 CCTTCCCATCCCTGCCCAGTGGG - Intronic
1176369542 21:6054027-6054049 CCTGCCCAGCCCTGGGGAGGAGG - Intergenic
1176861191 21:14012418-14012440 CTTTCCCAGCCATCCTGAGTAGG + Intergenic
1177856242 21:26403800-26403822 CCTTCCCAGTGTTGCTGATCAGG - Intergenic
1179155491 21:38847434-38847456 CCTGCACAGTCCTGCGGAGCTGG - Intergenic
1179472805 21:41622802-41622824 CCTGCCCATCCTGGCTGAGCAGG - Intergenic
1179753977 21:43484514-43484536 CCTGCCCAGCCCTGGGGAGGAGG + Intergenic
1179780340 21:43696137-43696159 TCTTCCCAACTCTGCTGTGCTGG - Intergenic
1179807657 21:43850112-43850134 CCTTCCAAACCCTGGTGCGCTGG - Intergenic
1180468969 22:15639108-15639130 CCTTCCCATGCCAGCTGGGCGGG + Intergenic
1180600268 22:17010797-17010819 CCCTCCCCTCCCTGCTGAGCTGG + Intergenic
1180763000 22:18223275-18223297 CCTTCCCACCCTGGCTGAGCAGG - Intergenic
1180772643 22:18401272-18401294 CCTTCCCACCCTGGCTGAGCAGG + Intergenic
1180804023 22:18650888-18650910 CCTTCCCACCCTGGCTGAGCAGG + Intergenic
1180806740 22:18718561-18718583 CCTTCCCACCCTGGCTGAGCAGG - Intergenic
1180833827 22:18919905-18919927 CCCTCCCAGCCCTGCACAGACGG - Intronic
1181217696 22:21344371-21344393 CCTTCCCACCCTGGCTGAGCAGG - Intergenic
1181357067 22:22304604-22304626 CCTGCCCAGGGGTGCTGAGCAGG + Intergenic
1181474386 22:23159383-23159405 GCATCACAGCCCTGCTGTGCTGG + Intronic
1181756691 22:25029204-25029226 CCTTCCCAGCCTGGGTGAGGGGG - Exonic
1181983351 22:26782040-26782062 CCTTCCCTGCCCTGGGGTGCTGG + Intergenic
1182119723 22:27778997-27779019 CCTACCCACCCCTGCAGAGATGG + Intronic
1182151365 22:28029360-28029382 GCTTGGCAGCCCTGCTGTGCAGG - Intronic
1182444066 22:30380124-30380146 CCTGCGCTGCCCTGCTCAGCCGG + Exonic
1182511620 22:30824233-30824255 CCTCCCCAGGCTTGCTGTGCAGG - Intronic
1183044542 22:35209238-35209260 CCTCCCTAGCCATGCTGAACTGG - Intergenic
1183697039 22:39429294-39429316 CCTTGCCCGCCCTGCTGAGTAGG + Intronic
1183704361 22:39467974-39467996 CATTGGCAGCTCTGCTGAGCTGG + Intronic
1183751541 22:39723757-39723779 CCTTCCGAATCCAGCTGAGCAGG + Intergenic
1184130237 22:42513122-42513144 CCCTCCCAGCTCTGCTGTGGGGG + Intronic
1184140413 22:42574945-42574967 CCCTCCCAGCTCTGCTGTGGGGG + Intergenic
1184690086 22:46113586-46113608 CCTGCCCAGCCCTCCTGCTCTGG + Intronic
1185243367 22:49759029-49759051 CCTTCCCTGCCCTGCGCTGCTGG - Intergenic
1185285521 22:49998107-49998129 CACCCCCATCCCTGCTGAGCAGG + Intronic
1185341569 22:50293496-50293518 CCCTCCCAGCCCCGCTCACCCGG + Intronic
1203234481 22_KI270731v1_random:142260-142282 CCTTCCCACCCTGGCTGAGCAGG + Intergenic
1203283913 22_KI270734v1_random:145203-145225 CCCTCCCAGCCCTGCACAGACGG - Intergenic
950025294 3:9815989-9816011 CTCTCCCTGCCCTGCTGAGCAGG - Intronic
950465162 3:13149197-13149219 ACCTCACAGCCCTGCTGTGCTGG - Intergenic
950509038 3:13414600-13414622 CCCTCCCAGCCCTGCTGCCCTGG + Intronic
950716795 3:14853464-14853486 CCTTCCCCTCCCTGCTGGGCTGG + Intronic
950946643 3:16955737-16955759 CCTTCCCATCCCTTGTAAGCTGG + Intronic
950947584 3:16965730-16965752 CCTTCCCATCCCTTGTAAGCTGG + Intronic
951117788 3:18885792-18885814 CAGGCCCAGCCCAGCTGAGCTGG - Intergenic
953025728 3:39143846-39143868 CCCACCCAGCCCTGGTGAGGAGG - Exonic
953383579 3:42492278-42492300 CCTTCCCAGCCCTGCGCAGGTGG + Intronic
954199530 3:49016030-49016052 CCTTTCCGGATCTGCTGAGCCGG - Exonic
954639283 3:52088529-52088551 CCTTCCTGGCCCTGCTGTGGTGG + Intronic
954704697 3:52473228-52473250 CCGACCCAGCCCTGCCAAGCAGG + Intronic
954948963 3:54452167-54452189 CCTCTCCAGCCATGCTGAACTGG - Intronic
955204893 3:56886954-56886976 CCTTCCTAGACCTTCTGTGCAGG - Intronic
955778864 3:62462564-62462586 CCTTGGCAGCTCTGCTGAGGTGG + Intronic
957757688 3:84510929-84510951 CCTCCCCAGCCCTACAGAACTGG + Intergenic
959476650 3:106820916-106820938 CCTGCCCTGCCCTGCTGACTCGG - Intergenic
962063803 3:131958401-131958423 CCATCCCAGACCTGCTGATTTGG + Intronic
962256517 3:133873471-133873493 CTCTCCCAGCCCAGCTGTGCTGG - Intronic
962344332 3:134608452-134608474 CCTTCCCTGCCCTGATGGCCTGG + Intronic
962702357 3:138012003-138012025 CCTTCAGAGCCCTGCTGGGGAGG - Intronic
963052285 3:141152334-141152356 CCTTTCCAGCGATGCCGAGCTGG + Intergenic
964390456 3:156191303-156191325 CCTTGCCAGCCTTGCAGAGTAGG - Intronic
964746941 3:160021240-160021262 CCTTGCCAATCATGCTGAGCAGG - Intronic
965062539 3:163802750-163802772 CCCTCCCACCCCTGCTGCGATGG - Intergenic
966320201 3:178694076-178694098 CCTCCCCAGCTATGCTGAACTGG - Intronic
966734279 3:183176615-183176637 CCTTCCCAGCTCTGGGGTGCAGG + Intergenic
966783035 3:183601446-183601468 CTTTCCCAGCCCTGGAGAGATGG - Intergenic
966851746 3:184169032-184169054 CTTTCCCAGTGCTGCTGGGCAGG - Intronic
968644192 4:1730781-1730803 CTTTCCCTGCACTGCTGTGCCGG - Intronic
968648076 4:1749683-1749705 CCTACCCAACCCTGCCCAGCTGG + Intergenic
969135618 4:5026382-5026404 CCTCCCCAGCCATGCAGAACTGG - Intergenic
969912843 4:10461265-10461287 CCTTTCCCGCCCTGCGGCGCAGG + Intergenic
970195197 4:13544872-13544894 CCTCCCCTTCCCTGCTGGGCAGG + Exonic
970559171 4:17266214-17266236 TCTTCCCAGCCATGGTGAGGAGG + Intergenic
971332614 4:25694723-25694745 GCTTCCCAGGTCTGCAGAGCAGG + Intergenic
971535466 4:27743023-27743045 CTTTCCCAGCCCAGCTGGGCTGG + Intergenic
971561108 4:28080621-28080643 CCTTCACATCCCTGGTAAGCTGG - Intergenic
972017508 4:34264482-34264504 CCTCCCCAGCCCTGTGGAACTGG - Intergenic
972323545 4:37994091-37994113 CCTTCCAGGACCTCCTGAGCAGG - Intronic
972433283 4:39005482-39005504 CCTCCCCAGCCATGCAGAACTGG + Intronic
972621985 4:40756194-40756216 GCCACCCAGGCCTGCTGAGCAGG + Intronic
973111704 4:46405001-46405023 CCCTCCCAGCCTGGCTCAGCAGG + Intronic
975101851 4:70522554-70522576 CCATCCCACCCCTCCTGGGCTGG + Intronic
975137331 4:70887525-70887547 CCTCCCCAGCCATGTTGAACTGG + Intergenic
976034446 4:80797757-80797779 CCTTCCCAGCTGGGATGAGCAGG + Intronic
978616830 4:110605986-110606008 CCTTCCCTGCAGTGCTGACCAGG + Intergenic
978917779 4:114147495-114147517 CCCTCCCCTCCCTGCTGGGCTGG - Intergenic
979485653 4:121267111-121267133 ACTTCCAGGCCCTGCTGGGCTGG + Intergenic
979966768 4:127085722-127085744 CCTCCCCAGCCATGCTGAACTGG + Intergenic
980848230 4:138349847-138349869 GCTTCCCAGCGCTGCTTACCTGG - Intergenic
981322746 4:143411546-143411568 CCTTGCCAATCCTGCAGAGCAGG - Intronic
981713775 4:147733051-147733073 CCTCCCCTGCCGTGCTGAGGAGG + Intronic
985105625 4:186497101-186497123 CCTCCCCATCCCTGCGGAACTGG - Intronic
985656688 5:1135488-1135510 CGTCCCCAGCCCTGCTGCCCCGG + Intergenic
985676727 5:1235239-1235261 GTTTACGAGCCCTGCTGAGCCGG - Intronic
985761649 5:1752048-1752070 TCTTCCCAGTCCTGGTGAGGCGG + Intergenic
986195550 5:5534096-5534118 CCTCCCCAGCCCGCCTGAACTGG + Intergenic
986263052 5:6165460-6165482 CCTCCCCAGCCATGCAGAACTGG + Intergenic
986298216 5:6456869-6456891 CATGCCCAGCCCTGCTGGCCAGG - Intronic
986306771 5:6522196-6522218 CCTCCCCACTACTGCTGAGCTGG - Intergenic
986508535 5:8478374-8478396 CCTCCCCAGCCCTGGGGAACTGG - Intergenic
988319626 5:29676906-29676928 CCTACCAAGCCATGCTGAACTGG - Intergenic
989825734 5:45852294-45852316 CCTTCACACCCCTTGTGAGCTGG - Intergenic
991197231 5:63949683-63949705 ACTTCCCAGCCATGCTGAACTGG + Intergenic
994646730 5:102479308-102479330 CCTCCCCAGCCCTCCTGTACAGG + Intronic
995286600 5:110396070-110396092 CCTCCCCAGCCATGCAGAACTGG - Intronic
995372504 5:111434575-111434597 CCTAACCAGGCCTGTTGAGCTGG + Intronic
996868347 5:128156034-128156056 CCTCCCCAACCCTACTAAGCTGG - Intronic
997037599 5:130211905-130211927 CTTTCCCAGCCATGCAGAGCTGG - Intergenic
997476652 5:134146374-134146396 GCTTACTAGCCCTGCGGAGCCGG + Exonic
997530782 5:134579984-134580006 CCTTCCCAGAGCCGCTGGGCTGG - Exonic
997679631 5:135740777-135740799 GCCCCCCAGCCCTGCTCAGCTGG + Intergenic
998108343 5:139482434-139482456 CCCTCAAAGCCCTGATGAGCTGG + Intronic
998184511 5:139968221-139968243 CCTTCTCACCCCTTCTCAGCCGG - Intronic
998248247 5:140529613-140529635 TCTCCCCAGCCCTGGTTAGCTGG - Exonic
999837522 5:155390620-155390642 CCTTCCCAGTTCTTCTGAGGGGG - Intergenic
1000036754 5:157454553-157454575 CCTTCCCAGCCCTGCTGAGCTGG - Intronic
1001565238 5:172695800-172695822 CCGGCCCAGCCCTCCTAAGCAGG - Intergenic
1002044633 5:176535022-176535044 CCTTCCCTGCCCTGGGGAGTGGG - Intronic
1002260807 5:177992842-177992864 CCTTCCCAGCCCTCCACAGGAGG - Exonic
1002447408 5:179297919-179297941 CCCTCACAGCCCTTCTCAGCAGG + Intronic
1003194520 6:3903022-3903044 CAATCCTAGCCCAGCTGAGCAGG - Intergenic
1003465919 6:6379895-6379917 ACTTCCCAGCCCAGCTCATCAGG + Intergenic
1004294429 6:14397316-14397338 CCCTCACTGCCCTGCTGAGCAGG + Intergenic
1004786576 6:18974462-18974484 CCATTCCAGCCCCGCTGTGCCGG - Intergenic
1004990585 6:21133362-21133384 CTTTCCCAGCCCTGGTGCTCAGG + Intronic
1005687268 6:28267017-28267039 CCCTCCCAGCCGTCCTCAGCAGG + Exonic
1006383957 6:33718504-33718526 CCTTCCCATCTCTGTGGAGCAGG - Intergenic
1006935144 6:37712084-37712106 TCCTCCCAGGCCTGGTGAGCTGG + Intergenic
1011517774 6:88170707-88170729 CCTTCCCTGTGCTGCTCAGCTGG - Intergenic
1011791562 6:90904356-90904378 CCTCTCCAGCCATGCTGAACTGG + Intergenic
1013355332 6:109341402-109341424 GCTTCCAGGCCCAGCTGAGCAGG + Intergenic
1013355335 6:109341412-109341434 CCTTCTCTGTCCTGCTCAGCTGG - Intergenic
1016599683 6:145844062-145844084 CCTCCCAAGCCATGCTGAACTGG - Intergenic
1017822112 6:158057056-158057078 CCTTCCCCGCCCCGCTCTGCGGG + Intronic
1018847568 6:167566210-167566232 CCTTCCCAGTCCTCCTGAGTGGG + Intergenic
1018855928 6:167674978-167675000 CCTCCCCAGCCATGAGGAGCTGG - Intergenic
1019395066 7:813679-813701 TCTTCCCAGCACTGCAGAGCAGG - Intergenic
1019434831 7:1017310-1017332 CCTGCCGTGCCCTGCTGTGCGGG + Intronic
1019479521 7:1260115-1260137 ACAGCCCAGCCCTGCTGACCGGG - Intergenic
1019486783 7:1293081-1293103 CCCTCTCAGCCATGCTGTGCTGG + Intergenic
1019513303 7:1429137-1429159 CCTTCCCAGCCCTGGCGTGGAGG + Intronic
1019517324 7:1445826-1445848 CCACCCCAGCCTTGCAGAGCTGG + Intronic
1019575518 7:1735759-1735781 CCTTCCCTCCCCTACTGAGGAGG + Intronic
1019713470 7:2527841-2527863 CCCTCCCAGCTCTTCTGAGTGGG + Exonic
1019803475 7:3105385-3105407 CCTTCCCTGCCCTCCTGACCTGG + Intergenic
1019849695 7:3542309-3542331 CCTTTCCAGCCCTGCTGTTGGGG - Intronic
1020893394 7:13908654-13908676 ACTTACCAGCCCTTCTGAGAAGG + Intronic
1022049751 7:26654607-26654629 CCTTCACAGCCCTGCTCCACTGG + Intergenic
1023223367 7:37943982-37944004 CTTTCCCAGCACAGCTGTGCTGG + Intronic
1023873148 7:44273521-44273543 CCCTCCCAGCCCTGGTGCGATGG + Intronic
1024247997 7:47484980-47485002 CCCTCCCAGCCCTGCAGCGTTGG - Intronic
1024580075 7:50793702-50793724 CCTGCCCCGGGCTGCTGAGCGGG + Intergenic
1024963736 7:55004283-55004305 CCTTCCCGGCCCTGCAGCTCAGG + Intergenic
1024965529 7:55019669-55019691 CTTTCCCCGCCCAGCTGCGCAGG + Intronic
1026399299 7:69993156-69993178 CTCTCCCAGGACTGCTGAGCAGG - Intronic
1026806015 7:73430030-73430052 CCAGCCCAGCTCTGCTGGGCTGG + Intergenic
1027265911 7:76495203-76495225 CCTGCCCAGGACTGCTCAGCTGG + Intronic
1027317285 7:76993320-76993342 CCTGCCCAGGACTGCTCAGCTGG + Intergenic
1028259406 7:88642316-88642338 TCTACCAAGCCCTGGTGAGCAGG + Intergenic
1028490899 7:91410609-91410631 CCTTCCCAGGCGGGCAGAGCAGG - Intergenic
1029450659 7:100640526-100640548 CCTTCCCAGGACCGCTGAACAGG + Intronic
1029987044 7:104931729-104931751 CCTTCTGAGCCCTGCTGGGAAGG - Intergenic
1031793459 7:126139869-126139891 CCTCCCCAGCCATGCTGAACTGG - Intergenic
1033023393 7:137749938-137749960 CCTACCCAACCCCACTGAGCAGG - Intronic
1033264818 7:139875876-139875898 CCTTTGCAGCCTTGCTGGGCTGG + Intronic
1034321742 7:150190792-150190814 CCTCCCCAGCTGTGCTGAACTGG - Intergenic
1034771004 7:153776485-153776507 CCTCCCCAGCCATGCTGAACTGG + Intergenic
1034830677 7:154305076-154305098 CAGCCCCAGCCCGGCTGAGCGGG + Intronic
1035036771 7:155900717-155900739 CCTTCCAGGCCCAGCTGAGTTGG + Intergenic
1035263099 7:157674157-157674179 CCTTCCCTCCCCTGCTGTGTTGG - Intronic
1035673674 8:1439458-1439480 GCTGCCCAGCCTTGCTGACCAGG + Intergenic
1035999898 8:4590923-4590945 CCTTCTGAGCTCTGCTGAGTTGG + Intronic
1036279705 8:7390131-7390153 CCTTCCCAGCTCTCCAGACCAGG - Intergenic
1036341814 8:7921752-7921774 CCTTCCCAGCTCTCCAGACCAGG + Intergenic
1036662438 8:10716722-10716744 TCTTCTCAGCCCTGCTGTCCTGG + Intergenic
1037415124 8:18641308-18641330 CCTTCCCATCACTACTCAGCTGG - Intronic
1039592093 8:38757484-38757506 CCTTCCCAGCCTTTCTGGGACGG - Intronic
1040014467 8:42689684-42689706 CCTCCCGAGCCCTGCCCAGCGGG - Intergenic
1040428547 8:47314454-47314476 CCTCCCCAGCCATGCTGAACTGG - Intronic
1040495531 8:47961619-47961641 CCTGCAGAGCCCTGCTGCGCAGG + Exonic
1041810526 8:61903337-61903359 CCTTTCCCGCCCTGCTCAGGTGG + Intergenic
1041991621 8:63999514-63999536 CCACTTCAGCCCTGCTGAGCTGG + Intergenic
1043428747 8:80173989-80174011 CCTTCCCATTCCTGCTTAGAGGG + Intronic
1044668342 8:94653731-94653753 CCTTCCCTGCCCTGCTGTAAAGG + Intronic
1045289577 8:100821067-100821089 CCATCACAGCCTTGCTGAGGGGG - Intergenic
1045529050 8:102967188-102967210 CCTTCCCTGACCTGCTCAACTGG - Intronic
1045817129 8:106290005-106290027 CCTTCCCAGCCCTGCAGAACTGG + Intronic
1046264666 8:111815175-111815197 CCTTCCCAGCCATACAGAACTGG - Intergenic
1048532830 8:135265783-135265805 CCTCCCCAGCCATGCTGGGGAGG + Intergenic
1049203592 8:141353188-141353210 CCTGCCCAGCTCTGATGGGCAGG - Intergenic
1049206734 8:141367086-141367108 CCTTCCCACTCCTGCTTGGCTGG + Intronic
1049260305 8:141635433-141635455 GCAACCCAGCCCAGCTGAGCGGG - Intergenic
1049470036 8:142771128-142771150 CCTTTCCAGCCTGGCTGGGCTGG - Intronic
1049549925 8:143252507-143252529 CCTCCCCAGCGCAGGTGAGCAGG + Intronic
1049574417 8:143383776-143383798 GCCTCCCAGGGCTGCTGAGCGGG - Exonic
1051641856 9:19230891-19230913 CCCTCCCAGCCTTGCAGCGCAGG - Intronic
1051878187 9:21812574-21812596 CCTTGCCAGGCCTCCTGGGCAGG - Intronic
1056493279 9:87129268-87129290 CCTTCCCAGACCTGCTGCTTTGG + Intergenic
1057194334 9:93108433-93108455 CCCTCTCAGCAGTGCTGAGCGGG + Intronic
1057220378 9:93254490-93254512 CCTTCCCAGGCCTGCTCAGTCGG + Intronic
1057244273 9:93440940-93440962 CTTTCCCAGCCCTGCTGTGAGGG + Intergenic
1057846730 9:98531617-98531639 CCTACCCACCCCTGCAGAGTGGG - Intronic
1058083099 9:100719703-100719725 CCTCCCCAGCCATGCAGAACTGG - Intergenic
1058527817 9:105877968-105877990 CATTCCCAGCTCTGCTCAGTTGG - Intergenic
1058763052 9:108154984-108155006 AATTCCCACCACTGCTGAGCTGG - Intergenic
1060228277 9:121809339-121809361 CCTTCCCCGCTCTGCTGTGCTGG + Intergenic
1060789964 9:126479283-126479305 CCTTCCTAGTGCTGCTGAGATGG - Intronic
1061590462 9:131594486-131594508 CCTGCCAAGCCCTGCTTGGCAGG + Intronic
1061759374 9:132839581-132839603 CCTCCCCGGTGCTGCTGAGCAGG - Intronic
1062144668 9:134982430-134982452 CCCACCCAGCCCTGATGTGCAGG - Intergenic
1062385612 9:136310340-136310362 CCTTGCCTGCCCTGCAGACCCGG - Intergenic
1062610979 9:137373311-137373333 CCTTCCCTGGCTTGCTGAGCGGG + Intronic
1062707673 9:137954244-137954266 CCTTCCCAGCCTTGCTCTGTGGG + Intronic
1062736845 9:138142107-138142129 CCCTCCCCTCCCTGCTGGGCTGG + Intergenic
1203654165 Un_KI270752v1:7536-7558 CCTGCCCAGCACTGCTGCCCAGG - Intergenic
1185608254 X:1379592-1379614 CCTCCCCTGCCCTGCCCAGCGGG + Intronic
1185736611 X:2500798-2500820 CCTGCCCCGCCCCGCTGACCTGG + Exonic
1186439691 X:9575060-9575082 CCTCCCCAGCCATGCAGAACTGG - Intronic
1186512802 X:10143158-10143180 CCTTCCCAGCGCTGCTGGGCAGG + Exonic
1187244011 X:17537997-17538019 CCTCCACAGCCAGGCTGAGCAGG - Intronic
1189181248 X:39006651-39006673 CTTTCCCAGACCTACTGAGCCGG - Intergenic
1189467522 X:41288687-41288709 TCTTCCCAGGCCTGGTGAACTGG - Intergenic
1189649485 X:43174162-43174184 CCTCCCCAGCCGTGCTGAACGGG - Intergenic
1189939652 X:46108286-46108308 CCTTCACATCCCTGCTAAGTTGG - Intergenic
1190304980 X:49076740-49076762 CCTGCCCAGCAGTGCTGATCTGG - Exonic
1190502664 X:51095256-51095278 CCTTTCCAGCCCTGTTCAGAGGG + Intergenic
1190535069 X:51417827-51417849 CCTTCCCAGCCCAACTCAGCTGG + Intergenic
1191199255 X:57761825-57761847 CCTCCCAAGCCATGCTGAACTGG - Intergenic
1192510527 X:71718223-71718245 CCAGCCAAGCCCAGCTGAGCGGG + Intergenic
1192510700 X:71719048-71719070 CCTGCCAAGCCCGGCGGAGCGGG - Intergenic
1192515997 X:71762505-71762527 CCTGCCAAGCCCGGCGGAGCGGG + Intergenic
1192516170 X:71763330-71763352 CCAGCCAAGCCCAGCTGAGCGGG - Intergenic
1196276542 X:113772732-113772754 CCTCCCCAGCCATGCGGAACTGG - Intergenic
1196285089 X:113870730-113870752 CCTCCCCAGCCATGCAGAACTGG + Intergenic
1197925491 X:131642883-131642905 CCTCCACAGCTCTGCTGAGTTGG + Intergenic
1198131013 X:133695051-133695073 CCTCCCCAGCCATGCAGAGCTGG - Intronic
1198282319 X:135154317-135154339 CCCTCCCATCCCTGTAGAGCAGG + Intergenic
1198284608 X:135177290-135177312 CCCTCCCATCCCTGTAGAGCAGG + Intergenic
1198286992 X:135200751-135200773 CCCTCCCATCCCTGTAGAGCAGG + Intergenic
1198288640 X:135218205-135218227 CCCTCCCATCCCTGTAGAGCAGG - Intergenic
1199161222 X:144614401-144614423 CATTTCCAGCCTTGGTGAGCTGG - Intergenic
1199400855 X:147396466-147396488 CCTGGCCAGCCATGCTGAACTGG + Intergenic
1199808335 X:151324729-151324751 CTTTCCCAGCCCTGCTCAGAAGG + Intergenic
1199971772 X:152866873-152866895 CCTTCCCAGCCTACCTGAGAGGG - Intronic
1200230588 X:154441992-154442014 CCTCCCCAGCCCCGCAGAGCAGG - Intronic
1201257977 Y:12128503-12128525 CCTTCCCAGCCATGTAGAGCTGG - Intergenic