ID: 1000036760

View in Genome Browser
Species Human (GRCh38)
Location 5:157454602-157454624
Sequence TCTTATCCAGGTTGGATGTA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000036754_1000036760 26 Left 1000036754 5:157454553-157454575 CCAGCTCAGCAGGGCTGGGAAGG 0: 1
1: 0
2: 5
3: 77
4: 478
Right 1000036760 5:157454602-157454624 TCTTATCCAGGTTGGATGTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000036760 Original CRISPR TCTTATCCAGGTTGGATGTA AGG Intronic
No off target data available for this crispr