ID: 1000038561

View in Genome Browser
Species Human (GRCh38)
Location 5:157467577-157467599
Sequence TTTTCCACCTAAAAGAGTCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 325
Summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 302}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000038561 Original CRISPR TTTTCCACCTAAAAGAGTCA GGG (reversed) Intronic
901709398 1:11101717-11101739 TTTCCCAACTAAAAGAGAAAAGG + Intergenic
902423287 1:16298879-16298901 TTTCATAACTAAAAGAGTCAAGG + Intronic
902642532 1:17775934-17775956 TATTCTACCTGGAAGAGTCAGGG + Intronic
906155170 1:43609712-43609734 TTTGCCACCTAAGAGGGTCCTGG - Intronic
906353167 1:45080881-45080903 TAACCCACCTAAAAAAGTCAAGG + Intronic
906465526 1:46075124-46075146 TTTACCACCTATAAGAGGCAAGG - Intronic
906993186 1:50761201-50761223 TTACCAACCTAAAAGAGTCCAGG + Intronic
907341698 1:53739773-53739795 TTTTCCGCCGGAAAGAGTCCAGG + Intergenic
907951752 1:59189915-59189937 TTTTGCTCCTGAAGGAGTCAGGG - Intergenic
908168211 1:61479619-61479641 TTTTCCACCTAGAAAACTCTAGG + Intergenic
908266921 1:62388332-62388354 TTTTCCACCAAAAGCAGCCAGGG + Intergenic
908849280 1:68358336-68358358 TTCTTCACTTAAAAGATTCAGGG + Intergenic
908984275 1:69998029-69998051 TTATCAACCAAAAAGAGTCCAGG - Intronic
910569999 1:88689284-88689306 TTTTCCACCTAAAAGTCCCATGG + Intronic
911031285 1:93491394-93491416 TTTCCCACCCCAAAGAGACAGGG + Intronic
913337680 1:117724180-117724202 TTATCAACCAAAAAGAGTCCAGG + Intergenic
913434700 1:118834935-118834957 TTATCAACCAAAAAGAGTCCAGG + Intergenic
914339144 1:146743409-146743431 TTTTCCACGAGAGAGAGTCATGG - Intergenic
917358049 1:174146762-174146784 CTTTCAACCAAAAAGAGTCCAGG + Intergenic
918389607 1:184044794-184044816 TTTTAAAGATAAAAGAGTCATGG + Intergenic
918634721 1:186761783-186761805 TTTTCCACCTGAAAGACAGAGGG - Intergenic
918902077 1:190435007-190435029 TTCTCCATCTAAAATAATCAAGG - Intronic
919198052 1:194313954-194313976 TTACCCACCAAAAAGAGTCCAGG - Intergenic
922181700 1:223241041-223241063 TGTACCACCTAAGAGAGTGAAGG - Intronic
922299906 1:224289522-224289544 TTTGCCATCTAAAGGAGTCCAGG - Exonic
924867384 1:247999462-247999484 CTTTACACCTGAAAGAGTTATGG + Intronic
924892521 1:248298479-248298501 TTACCCACCAAAAAGAGTCCAGG - Intergenic
1063402249 10:5757428-5757450 TTTTCTATCCAAGAGAGTCAAGG - Intronic
1064794468 10:18995948-18995970 TTACCCACCAAAAAGAGTCCAGG + Intergenic
1065318700 10:24488740-24488762 TTTTCCTCATACCAGAGTCAGGG + Intronic
1066670234 10:37829387-37829409 TTTTCCACCAGAAAGAACCATGG + Exonic
1069366865 10:67703139-67703161 TTACCCACCAAAAAGAGTCCAGG + Intergenic
1069392461 10:67950896-67950918 TTTTCCACTTAAAGAAGACACGG + Intronic
1069897957 10:71690454-71690476 TTTTCCCCCTGAAGGAGCCACGG + Intronic
1071448580 10:85772836-85772858 TTATCAACCAAAAAGAGTCCAGG + Intronic
1071891498 10:90012945-90012967 TTTACCAACAAAAAGAGTCCAGG + Intergenic
1072665931 10:97392309-97392331 TTTTTCATCTTAAAGAATCAAGG + Intronic
1074029121 10:109666536-109666558 TATTCCATCTAAATGAGTCTAGG + Intergenic
1074692807 10:116021808-116021830 TCTTCCAGTGAAAAGAGTCAGGG + Intergenic
1075019931 10:118944375-118944397 AGTTCCCCCTAAAAGAGGCATGG + Intergenic
1075854900 10:125621511-125621533 TTTTCCACTTATATTAGTCAGGG + Intronic
1075890800 10:125948626-125948648 TTTCCAACCAAAAAGAGTCCAGG + Intronic
1077794851 11:5480871-5480893 TTACCAACCTAAAAGAGTCCAGG + Intronic
1078298706 11:10102571-10102593 GTCTCAACCTAAAAGAGTAATGG + Intronic
1080950004 11:37020492-37020514 TTATCAACCAAAAAGAGTCCAGG - Intergenic
1081018974 11:37919536-37919558 TTTTCCCCTGAAGAGAGTCATGG + Intergenic
1081301084 11:41452483-41452505 TCTTCCACTTAAAACTGTCAAGG - Intronic
1082563075 11:54642344-54642366 TTTTCCACATAAGAGAGCCCTGG + Intergenic
1082992690 11:59221788-59221810 TATTCCATCTCAATGAGTCATGG - Intergenic
1085557110 11:77434410-77434432 TTGTCCTCCTAAAAGAAACATGG - Intronic
1085910197 11:80815303-80815325 TTTGCAACATAAAAGACTCAGGG + Intergenic
1086524789 11:87712383-87712405 TTTTCCAAATAAAAAAGCCAGGG + Intergenic
1087028047 11:93671534-93671556 TTCTCCACTAAAAAGAATCAGGG - Intronic
1087883172 11:103443947-103443969 TCTTCCTCTTAAAAGACTCATGG + Intronic
1088767634 11:112999237-112999259 TTTTCCACTTAGAGGAGTGAAGG - Intronic
1090547256 11:127779325-127779347 TTATCAACCAAAAAGAGTCCAGG - Intergenic
1092031253 12:5287572-5287594 TTACCCACCAAAAAGAGTCCAGG - Intergenic
1092488151 12:8920724-8920746 TTTTCCACCTAAAAGAGAGTGGG + Intronic
1093749491 12:22781787-22781809 CTTTCCACTTAAATAAGTCAAGG + Intergenic
1095059273 12:37663214-37663236 TTATCAACCAAAAAGAGTCCAGG - Intergenic
1095251245 12:39981689-39981711 TTACCCACCAAAAAGAGTCCAGG + Intronic
1095384998 12:41640045-41640067 TTTCCAACCAAAAAGAGTCCAGG - Intergenic
1095387577 12:41668933-41668955 TTTCCAACCAAAAAGAGTCCAGG - Intergenic
1095388303 12:41675822-41675844 TTTCCAACCAAAAAGAGTCCAGG + Intergenic
1095422628 12:42040993-42041015 TTTTCAATCATAAAGAGTCAAGG - Intergenic
1096452415 12:51755488-51755510 TTTTTCCACTAAAAGACTCAGGG - Intronic
1098029782 12:66241962-66241984 TTTTGTACTTAAAAGATTCAGGG + Intronic
1099041291 12:77657470-77657492 TTACCCACCAAAAAGAGTCCAGG + Intergenic
1099895402 12:88639884-88639906 TTTAGGACCTAAGAGAGTCAGGG + Intergenic
1100437199 12:94582640-94582662 TTTTCGAACTACAAGTGTCACGG + Intronic
1100534383 12:95493140-95493162 TTTTCCTACTACAGGAGTCATGG + Intronic
1100864217 12:98838924-98838946 CTTTCCACCTGAAAGCATCAAGG + Intronic
1101180199 12:102208023-102208045 TGTTACCCCTAAAAGAGTCTTGG - Intergenic
1102694049 12:114784149-114784171 TTTTTCAGATAAAAGAGACAGGG - Intergenic
1105549749 13:21381987-21382009 TTTTCTAGCTAAAAGATCCAGGG + Intronic
1107292048 13:38865922-38865944 TTTGCCACCTGAAAGAAACATGG + Intronic
1108175189 13:47785265-47785287 TTTACCAACAAAAAGAGTCCAGG + Intergenic
1109650554 13:65319672-65319694 TTTTTTCCCTAAAAAAGTCATGG - Intergenic
1109797187 13:67331417-67331439 TTTTCTGCCTAAGACAGTCAGGG - Intergenic
1110613331 13:77513664-77513686 TTCTCCACTAAAAAGAATCAAGG - Intergenic
1112229615 13:97575418-97575440 TTTTCTACCTACAAAAGCCAAGG - Intergenic
1112786957 13:102961681-102961703 TTTTCCACCTAAAAGATGACTGG + Intergenic
1114364830 14:22014620-22014642 TTTTGTACCTAACAGAGACATGG - Intergenic
1114993248 14:28315141-28315163 TTATCAACCAAAAAGAGTCCAGG - Intergenic
1115465540 14:33710536-33710558 TTTTCCAGCCAAAAGGGTAAGGG - Intronic
1115758256 14:36551577-36551599 TTTTCAACCTTAAACTGTCAAGG + Intergenic
1115834226 14:37379724-37379746 CTTTCCATTTACAAGAGTCAAGG - Intronic
1115839205 14:37447423-37447445 TTTGCCTCCTAAAAGTGTGATGG - Intronic
1117597724 14:57340716-57340738 TTACCAACCAAAAAGAGTCAAGG - Intergenic
1118519122 14:66561367-66561389 TTATCAACCAAAAAGAGTCCAGG - Intronic
1121743880 14:96272927-96272949 TTTTAAACCACAAAGAGTCAAGG + Intergenic
1123700740 15:22913187-22913209 TTTTCCCCCCAACAGAGACAAGG - Intronic
1123950229 15:25264628-25264650 TTATTCACCTAAAAGAAACAAGG - Intergenic
1124510865 15:30323499-30323521 TTTTACTCATAAAAGAGTCAAGG + Intergenic
1124732023 15:32207032-32207054 TTTTACTCATAAAAGAGTCAAGG - Intergenic
1128602050 15:69003774-69003796 TTGTCCATCTAGAAGAGTGAAGG + Intronic
1128906370 15:71471365-71471387 TTTACCACCCCAGAGAGTCAGGG - Intronic
1129067549 15:72918963-72918985 TTTCCCATTAAAAAGAGTCAGGG - Intergenic
1129610909 15:77055976-77055998 TGTTCCAACTATAAGAGCCAAGG + Intronic
1136939563 16:34509509-34509531 TTTACCAACCAAAAGAGTCCAGG - Intergenic
1136960257 16:34839052-34839074 TTTACCAACCAAAAGAGTCCAGG + Intergenic
1137074672 16:35947199-35947221 TTACCAACCAAAAAGAGTCAAGG + Intergenic
1138080391 16:54085057-54085079 ATTTCCACCTAAAAGCATTAGGG - Intronic
1139344053 16:66290558-66290580 TTCTCCAGATAAAAGACTCATGG - Intergenic
1139995134 16:70973943-70973965 TTTTCCACGAGAGAGAGTCATGG + Exonic
1140289047 16:73633176-73633198 TTTTCCACCTAAATGGCTAAAGG + Intergenic
1140979044 16:80088698-80088720 TTTACCAACAAAAAGAGTCCAGG - Intergenic
1141073351 16:80978776-80978798 TTTTCTACTTAAAAGCTTCATGG + Intronic
1141143852 16:81515343-81515365 TTTTCCATCTAGAAGCGTGAGGG - Intronic
1141347192 16:83257536-83257558 TTTTCTTCCTAACAGATTCATGG - Intronic
1141525748 16:84610239-84610261 GTTTCCATCTAAAAGAGTCCTGG - Intronic
1142822305 17:2479879-2479901 TTCTCCACCTATAAAAGTAAAGG + Intronic
1146749264 17:35362988-35363010 TTTTCCTTCTCAAAGAGTCAGGG + Exonic
1146752805 17:35397304-35397326 TTATCAACCAAAAAGAGTCCAGG + Intergenic
1146862967 17:36321255-36321277 TTTGCCAACTTAAAGAGTCTGGG + Intronic
1147093296 17:38125338-38125360 TTTGCCAACTTAAAGAGTCTGGG + Intergenic
1147103911 17:38195150-38195172 TTTGCCAACTTAAAGAGTCTGGG - Intergenic
1148425581 17:47593259-47593281 TTTGCCAACTTAAAGAGTCTGGG + Intronic
1148811000 17:50291154-50291176 CTTTCCAGGTAAAAAAGTCAAGG - Intergenic
1148877379 17:50698152-50698174 TTCTCCACCAAAAAGAACCAGGG + Intronic
1149804578 17:59603393-59603415 TCTGCCACTTAAAGGAGTCAGGG + Intronic
1151005065 17:70425915-70425937 TTTTCCACCTTGAACATTCATGG - Intergenic
1152985380 18:316088-316110 TTTTCCAGGTAAAGGAGGCAGGG + Intergenic
1153565334 18:6413551-6413573 TATTCCACCTAAAAAGGTTAAGG - Intronic
1155324738 18:24654370-24654392 TATTTGACCTAAAAGAATCAAGG + Intergenic
1156983695 18:43324028-43324050 TTTACCAACAAAAAGAGTCCAGG + Intergenic
1157017364 18:43733204-43733226 TCTTCTAGCTAAAAGAGTAAGGG + Intergenic
1158040312 18:53085351-53085373 TTTTCCATCTAAAATAATTAAGG + Intronic
1159023743 18:63164503-63164525 CTTTCCCCCTAAAAGCCTCATGG - Intronic
1159792155 18:72795262-72795284 TTTTCCTCGTAATAGAGACAAGG + Intronic
1161050843 19:2163570-2163592 ATTTCCCCCCATAAGAGTCACGG - Intronic
1202658440 1_KI270708v1_random:46159-46181 TTACCCACCAAAAAGAGTCCAGG - Intergenic
926594019 2:14770382-14770404 TTCTCTCCCTAAAAGAGTAAAGG - Intergenic
930966028 2:57327650-57327672 CTTTCCCCCTAACACAGTCATGG - Intergenic
931018180 2:58010566-58010588 TATTCCAACCAAAAGAGTCACGG - Intronic
931724832 2:65099631-65099653 TTTTCCCCCTTAAAGGGACAGGG + Intronic
931945710 2:67304583-67304605 TTTTTGACCTAAATGAATCAGGG - Intergenic
939949325 2:148450058-148450080 TTTTTCACCTAACAAAATCATGG + Intronic
941546448 2:166857203-166857225 CTTACCAACTAAAAGAGTCCAGG + Intergenic
941562357 2:167062641-167062663 TTTTCCACAAAGAAGACTCAAGG - Intronic
942214167 2:173702009-173702031 TTATCAACCAAAAAGAGTCCAGG - Intergenic
943284200 2:185976353-185976375 TTTTGAACCAAAAAGAGTCCAGG - Intergenic
943560100 2:189451124-189451146 TTTTCCACTTATAAAAGACAAGG + Intronic
944819531 2:203416141-203416163 TTTTTCACTTAAATGAGTCCAGG - Intronic
947148307 2:227088608-227088630 CTTTCCAGTTAAAAGAGACATGG - Intronic
948586466 2:239023095-239023117 TTTTGTACCTCACAGAGTCACGG - Intergenic
1170455591 20:16530101-16530123 TTTTCCACTAAAATAAGTCAGGG + Intronic
1170941859 20:20854633-20854655 TTTTCCTCCTGACAGGGTCATGG - Intergenic
1172702250 20:36860943-36860965 TTTTCCCCTTTAAACAGTCATGG + Intronic
1173367062 20:42395875-42395897 TTTTCCACCTTAAAAATCCAAGG + Intronic
1175048687 20:56132482-56132504 TTTTCAACTTAAAAACGTCATGG - Intergenic
1175710413 20:61216251-61216273 TTCCCCACCAAAAGGAGTCAGGG - Intergenic
1178604647 21:34025255-34025277 TTTTCCAGCTAAGAGAGAAAAGG + Intergenic
1178783550 21:35630062-35630084 TTTCCCACCAAGAAGGGTCAGGG + Intronic
1179335446 21:40447308-40447330 TTTACAACCAAAATGAGTCATGG - Intronic
1179374595 21:40838651-40838673 TTTTAATACTAAAAGAGTCAAGG + Intronic
1179424936 21:41268596-41268618 TTTTATAATTAAAAGAGTCATGG - Intronic
1180306820 22:11133919-11133941 TTATCAACCTAAAACAGTCCAGG - Intergenic
1180401436 22:12432602-12432624 TTACCAACCTAAAAGAGTCCAGG - Intergenic
1180545339 22:16496102-16496124 TTATCAACCTAAAACAGTCCAGG - Intergenic
1180889314 22:19274362-19274384 TATTCCATCAAAAAGAGCCAAGG + Intronic
1184980598 22:48093254-48093276 TTTTCCACAAAAAAGCATCAAGG + Intergenic
949271504 3:2223196-2223218 TTGTCCACCTAGAACAGTAAAGG - Intronic
950318828 3:12030506-12030528 TTACCAACCAAAAAGAGTCAAGG - Intronic
950790264 3:15466013-15466035 TTTTCTAGATAAAAGTGTCATGG - Intronic
952821641 3:37491347-37491369 TTATCCACCTCAAAGAAGCAGGG - Intronic
953948625 3:47170422-47170444 TTATACACTTAAAAGAGTAAAGG - Intergenic
954931684 3:54288435-54288457 TTACCCACCAAAAAGAGTCCAGG + Intronic
955254955 3:57321635-57321657 TTATCCACCCAGAAGAGTAAAGG - Intronic
955468644 3:59263027-59263049 TGTCCCACCTAAAATATTCATGG - Intergenic
956094021 3:65697237-65697259 TTATCAACCAAAAAGAGTCCAGG + Intronic
957815595 3:85293301-85293323 TTACCCACCAAAAAGAGTCCAGG + Intronic
960538958 3:118843804-118843826 TTTTGCAGCTAAAAAAGTGAGGG + Intergenic
960919961 3:122736383-122736405 TTTACCAACAAAAAGAGTCCAGG + Intergenic
962635110 3:137323112-137323134 TTTTCCACCAAAAGGAACCAAGG - Intergenic
963175501 3:142293579-142293601 TTACCAACCAAAAAGAGTCAAGG + Intergenic
963484716 3:145921401-145921423 TTATCCACCAAAAAGAGTCCAGG + Intergenic
963628386 3:147702629-147702651 TTTGCCACCAAAAGGAGCCAAGG + Intergenic
964741668 3:159972815-159972837 TTTTCCATCTTAAAAAATCAAGG + Intergenic
965323906 3:167278613-167278635 TTATCAACCAAAAAGAGTCCAGG + Intronic
965744642 3:171912184-171912206 TTTTCCAATAAAAAGAGACATGG + Intronic
965905746 3:173703254-173703276 TTTTCTACTTAAAAGAGGCATGG + Intronic
966951307 3:184820674-184820696 TTTTCCAACTCAAAGAGACCTGG - Intronic
967214712 3:187200215-187200237 TTTTCCATCTATAAAACTCAGGG + Exonic
967744896 3:193044237-193044259 TTTTCTAACTAAAGGAGTAATGG - Intergenic
969183870 4:5461405-5461427 TTTTGCACCAAAAGGAGTGACGG - Intronic
970040918 4:11796080-11796102 TTACCAACCTAAAAGAGTCCAGG + Intergenic
970415788 4:15855693-15855715 TTTCCCACCTAAGAGAGAAATGG + Intergenic
970665909 4:18336358-18336380 TTATTCACCTAATAGAGGCAAGG + Intergenic
973025721 4:45267648-45267670 TTTTACAACAAAAAGAGTCCTGG - Intergenic
973252477 4:48075064-48075086 TTTTCCCCCAAAAAGAGGAATGG + Intronic
974672876 4:65054792-65054814 TTACCCACCAAAAAGAGTCCAGG - Intergenic
974975697 4:68888463-68888485 TTTACCACTTACAAGAGGCAGGG - Intergenic
975305516 4:72845426-72845448 TTTTCCACTTAAACCAATCAAGG + Intergenic
975338632 4:73211072-73211094 TTTTTTAACTTAAAGAGTCAGGG + Intronic
975523833 4:75328216-75328238 CTTTCCACCACAAAGAGCCAAGG + Intergenic
976317307 4:83672486-83672508 TATTACACCTGAAAGGGTCATGG - Intergenic
976524629 4:86073021-86073043 TTACCAACCAAAAAGAGTCAAGG - Intronic
976529744 4:86138048-86138070 TTACCAACCAAAAAGAGTCAAGG + Intronic
976976587 4:91172720-91172742 TTTTCCTCCTAGAAGAGTAGTGG + Intronic
977159036 4:93610942-93610964 TTACCAACCTAAAAGAGTCCAGG - Intronic
978163128 4:105573488-105573510 TTTTCCCCATAAAATAGTCTTGG + Intronic
978835148 4:113140615-113140637 TTTGCCACTTTAAAGACTCATGG + Intronic
979189468 4:117838308-117838330 TTTTCTACATATAAGAGTGAAGG - Intergenic
979474744 4:121141861-121141883 TTTTCCACCTGCAAGATCCATGG - Exonic
979950311 4:126884790-126884812 TTTTCTACTTAAAAAATTCAAGG - Intergenic
980373123 4:131905629-131905651 ATTTCCACCTATAAGTTTCAGGG - Intergenic
981613354 4:146620045-146620067 TTACCCACCAAAAAGAGTCCAGG - Intergenic
981659403 4:147148200-147148222 TTTTCCATGCAAAAGAGCCAGGG - Intergenic
982149449 4:152436593-152436615 CTGTCCAGCTAGAAGAGTCATGG - Intronic
982158899 4:152547726-152547748 TTTACCACTTAAAGGAATCAGGG - Intergenic
982400821 4:154966029-154966051 TTTTACAGCTAAGAGAGCCAAGG + Intergenic
982471957 4:155803290-155803312 ATTTCTACCTAAAACAGTGATGG - Intronic
983132669 4:164041903-164041925 TTTTTCCCCTAAAATACTCATGG - Intronic
984430294 4:179640032-179640054 TTATCAACCAAAAAGAGTCCAGG + Intergenic
986916978 5:12632635-12632657 TTTTCCACAAAAGGGAGTCAAGG + Intergenic
988444983 5:31275671-31275693 TGTTCTACCAAAAAGAGACATGG - Intronic
989383085 5:40828380-40828402 TTTTCCACTTAAAAGTTTCTGGG + Exonic
989627624 5:43446447-43446469 TTTTCAAGCTCAAAGACTCATGG - Exonic
989725523 5:44582302-44582324 TTTCCAACCAAAAAGAGTCCAGG + Intergenic
989814199 5:45716049-45716071 TTTTTCACCTAGAAGAGAAAGGG - Intergenic
991108203 5:62866650-62866672 TTTCCAACCAAAAAGAGTCCAGG + Intergenic
991653165 5:68876776-68876798 TTTTCCTTTTAAAAGAGACAGGG - Intergenic
993409689 5:87558531-87558553 TTTTCCACTTAAAGGAATAAGGG - Intergenic
993840156 5:92867489-92867511 TTTTCCACAGAACAGAGTTAGGG - Intergenic
997135229 5:131318400-131318422 TTTCCTACCTAAGACAGTCATGG + Intronic
997648120 5:135494600-135494622 TTTTACCCCTAAAGGAGGCAAGG - Intergenic
1000038561 5:157467577-157467599 TTTTCCACCTAAAAGAGTCAGGG - Intronic
1004715290 6:18210991-18211013 TTTTCCCCTTTAAAGAGACAGGG - Intronic
1006712953 6:36091440-36091462 TTTTCTACCTAAGAGAAACAGGG + Intronic
1008404433 6:51102822-51102844 TTATCAACCAAAAAGAGTCCAGG - Intergenic
1008406585 6:51124939-51124961 TTATCAACCAAAAAGAGTCCAGG + Intergenic
1008411936 6:51190295-51190317 TTATCAACCAAAAAGAGTCCAGG - Intergenic
1008800799 6:55366068-55366090 TTACCAACCAAAAAGAGTCAAGG - Intronic
1010798093 6:80140932-80140954 TTATCAACCAAAAAGAGTCCAGG - Intronic
1011155336 6:84324043-84324065 TTTTCCAGCCAACAGAGTCTGGG + Intergenic
1011633267 6:89347899-89347921 TTTTCAACCTTAATGACTCAGGG - Intronic
1012843949 6:104366056-104366078 TTTTCTACATAAAAGAGAAATGG + Intergenic
1013402733 6:109814833-109814855 TTTTCCACTAAAAATAATCAGGG - Intronic
1014185548 6:118430308-118430330 TTACCCACCAAAAAGAGTCCAGG + Intergenic
1014830815 6:126100703-126100725 TTTTCCACAGACAAGAGTCGGGG + Intergenic
1016102721 6:140122465-140122487 TTTTCCACAATAAGGAGTCAGGG - Intergenic
1016935381 6:149445787-149445809 CTTTCCAACTAAAGGACTCAAGG - Intergenic
1018603764 6:165576247-165576269 GTTGGCACCAAAAAGAGTCAAGG + Intronic
1019849178 7:3537544-3537566 TTTTCAACCCCAAAGAGTCATGG - Intronic
1020474240 7:8576933-8576955 TTTTCACCATAAAAGAGTAAAGG - Intronic
1021778512 7:24078401-24078423 TTTTCGAACTAAGAGAGTCTTGG + Intergenic
1023130335 7:36996766-36996788 TTTTTCACCGGAAAGAGTGAAGG + Intronic
1023501022 7:40849665-40849687 TTTTCACCCTAGAAGAATCATGG + Intronic
1023793947 7:43775768-43775790 TTATCAACCAAAAAGAGTCCAGG - Intronic
1023837715 7:44078161-44078183 TATTCCATCAAAAACAGTCAAGG + Intronic
1024446246 7:49483217-49483239 TTTTCCTCCTTATAGAGACATGG + Intergenic
1025921413 7:65916512-65916534 ATTTCCCCCTAAAAGAATCTAGG - Intronic
1027765993 7:82342491-82342513 TTTTAAACCTAAAAAAATCATGG + Intronic
1027816954 7:82987055-82987077 TTTTACACCTAAATGAATCATGG + Intronic
1028346641 7:89791617-89791639 TTACCAACCAAAAAGAGTCAGGG - Intergenic
1028453023 7:91006809-91006831 TTTGTCACCTAAATCAGTCACGG + Intronic
1032246909 7:130221134-130221156 TTTTCCAAATAACAGAGTAAGGG + Intergenic
1032684138 7:134213501-134213523 TTCTTCACCTAAATGAGACACGG - Intronic
1033111551 7:138582879-138582901 TTTTGTACCCAAAAGAGGCAGGG + Intronic
1035432452 7:158832283-158832305 TTTTCCAACAAAAGGAATCAGGG + Intergenic
1035488277 7:159248356-159248378 ATTTCCACCTATAACATTCAAGG - Intergenic
1035964697 8:4177943-4177965 TTATCAACCAAAAAGAGTCCAGG + Intronic
1036491731 8:9232876-9232898 TTTTCCCCCTAAAACAGTTGGGG + Intergenic
1036543093 8:9738031-9738053 TTACCCACCAAAAAGAGTCCAGG - Intronic
1036997989 8:13681626-13681648 TTTTTCTCCTAAAAGAGTTCTGG - Intergenic
1037066880 8:14592685-14592707 TTTTTCCACTAAAAGTGTCATGG - Intronic
1038031695 8:23647820-23647842 TTTACCAACAAAAAGAGTCCAGG - Intergenic
1038460423 8:27711556-27711578 TTTTCCACCAAAAGGAATTAGGG - Intergenic
1038660464 8:29492556-29492578 TTTGCCTCCTATAATAGTCAGGG + Intergenic
1038703254 8:29871017-29871039 TTATCCATCTACATGAGTCAGGG + Intergenic
1038922319 8:32098526-32098548 TATTTCACCTAATAGAGTCAAGG - Intronic
1039669438 8:39580167-39580189 TTTTCCTACTTAAAGATTCATGG - Intergenic
1040681715 8:49818852-49818874 TTTAGCACATAGAAGAGTCATGG - Intergenic
1041773374 8:61496942-61496964 TTTTCCATCTAAAAAACTAAGGG - Intronic
1042028105 8:64445305-64445327 TTTTCCACCTAAAGGAGAAAGGG - Intergenic
1042785463 8:72540982-72541004 TTTTCCCCCTAAAATATTCTTGG - Intronic
1043323519 8:79020907-79020929 TTTTCCACTTAAAAAAATTAAGG - Intergenic
1043519004 8:81024601-81024623 ATTTCTACCTAAAAGACTAAAGG + Intronic
1046003457 8:108449117-108449139 TTTTCAACCTTTAAGAGACAGGG + Intronic
1046084611 8:109416732-109416754 CTTGCCACCTAACAGAGGCAGGG - Intronic
1046122343 8:109862128-109862150 TTATCAACCAAAAAGAGTCCAGG + Intergenic
1046308980 8:112409155-112409177 TTTTCTACCTAAAAGAGGATAGG + Intronic
1046771158 8:118118061-118118083 CTTTCCAGCTGAAATAGTCAAGG + Intergenic
1046897134 8:119485293-119485315 TTTTCCACTAAAATGAGCCAGGG - Intergenic
1047308547 8:123673222-123673244 TTTTCCAATAAAAAGAGTCAGGG + Intergenic
1047360154 8:124161797-124161819 TATTGCACCAAAAAGAGTAAAGG - Intergenic
1047677832 8:127222388-127222410 TTTTCCAGCTAAGAAAATCAAGG + Intergenic
1047686970 8:127314957-127314979 TTACCCACCAAAAAGAGTCCAGG + Intergenic
1048219068 8:132524933-132524955 TTTTCTACCTAAGAAAATCATGG + Intergenic
1050217922 9:3348950-3348972 TTTTCCACTAAGAAGAGCCAGGG - Intronic
1051554044 9:18363077-18363099 TTTCACACCTAAAAGTGTTATGG + Intergenic
1052329068 9:27248657-27248679 TCTTCCACCCAGAAGACTCATGG - Intergenic
1052839084 9:33276075-33276097 TTTGCCACCAAAAATAGGCAAGG + Intronic
1053287488 9:36859350-36859372 TATTTCTCCTAACAGAGTCAGGG + Intronic
1053368281 9:37539392-37539414 TTTTTCAACTAAAGGAGACATGG - Intronic
1053566967 9:39263222-39263244 TTTTCCATCTCAAACAGTCATGG + Intronic
1053832742 9:42101064-42101086 TTTTCCATCTCAAACAGTCATGG + Intronic
1054130176 9:61355785-61355807 TTTTCCATCTCAAACAGTCATGG - Intergenic
1054597811 9:67086346-67086368 TTTTCCATCTCAAACAGTCATGG - Intergenic
1056032590 9:82568405-82568427 TTTTCCAAATAAGAGATTCAGGG - Intergenic
1059148506 9:111924762-111924784 TTTGCCACCTAAAAATGTAAAGG - Exonic
1059312557 9:113398648-113398670 TTTTCCACATTAAAGTGTAAGGG - Intronic
1060580681 9:124743385-124743407 TTCTCCACCTACAAATGTCATGG + Intronic
1061776323 9:132967402-132967424 TTTTCCCCCTAAAAGAGCCCAGG - Intronic
1062286812 9:135776931-135776953 TTTTCCACTAAAAGGAATCAGGG - Intronic
1203414207 Un_KI270589v1:35506-35528 TTTTCCACCATAAAGCCTCAAGG + Intergenic
1186076680 X:5887222-5887244 TTTGCAACCTAAAAGAGTTGGGG + Intronic
1190020574 X:46870279-46870301 TTTTTAACATAAAAGAGACAGGG + Intronic
1193015002 X:76722661-76722683 TTACCCACCAAAAAGAGTCCAGG - Intergenic
1193186253 X:78516362-78516384 TTTACTAGCTAAAAGTGTCATGG + Intergenic
1195836115 X:109116684-109116706 TTTACCAACAAAAAGAGTCCAGG + Intergenic
1195840934 X:109176290-109176312 TTTACCAACCAAAAGAGTCCAGG + Intergenic
1195874346 X:109523111-109523133 TTATCAACCAAAAAGAGTCCAGG + Intergenic
1196375403 X:115027398-115027420 TTTACCACTTAAAAGATTCCAGG + Intergenic
1197973136 X:132136107-132136129 TTTACCAACAAAAAGAGTCCAGG + Intergenic
1198790596 X:140341185-140341207 TTTTGCACCTAAAATAGTCCTGG - Intergenic
1200182006 X:154156279-154156301 TTTGCCACCTAAGGGAGACAGGG - Exonic
1200187655 X:154193393-154193415 TTTGCCACCTAAGGGAGACAGGG - Intergenic
1200193304 X:154230533-154230555 TTTGCCACCTAAGGGAGACAGGG - Exonic
1200199059 X:154268337-154268359 TTTGCCACCTAAGGGAGACAGGG - Exonic
1200581113 Y:4951544-4951566 TTTACCAACAAAAAGAGTCCAGG - Intergenic
1200815328 Y:7525537-7525559 CTTACCACCAAAAAGAGTCCAGG - Intergenic
1201413573 Y:13725445-13725467 TTACCAACCAAAAAGAGTCAAGG + Intergenic
1202072669 Y:21008543-21008565 TTATCAACCAAAAAGAGTCAAGG - Intergenic