ID: 1000040535

View in Genome Browser
Species Human (GRCh38)
Location 5:157481535-157481557
Sequence CCCTCCCCAGGTCAGGTGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 325
Summary {0: 1, 1: 0, 2: 4, 3: 38, 4: 282}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000040526_1000040535 24 Left 1000040526 5:157481488-157481510 CCTCTGTACAAATGAGGAAACAG 0: 1
1: 7
2: 122
3: 1018
4: 4553
Right 1000040535 5:157481535-157481557 CCCTCCCCAGGTCAGGTGCAGGG 0: 1
1: 0
2: 4
3: 38
4: 282

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000040535 Original CRISPR CCCTCCCCAGGTCAGGTGCA GGG Intronic
900229842 1:1551059-1551081 GCTTCCCCAGGCCAGCTGCACGG + Intronic
900485420 1:2920476-2920498 TCCTCCCCAGGTCCTGAGCACGG - Intergenic
900507543 1:3037210-3037232 CCCTCCCCAGCACAGGAGGACGG + Intergenic
900601558 1:3504942-3504964 CCCTCCCCAGGTCAGGCCCTGGG + Intronic
900941320 1:5800393-5800415 GCATCCCCAGGTTAGGTGAAAGG + Intergenic
902546995 1:17196319-17196341 CCCTTCCCGGGTCAGTTGCAAGG + Intergenic
904328811 1:29744910-29744932 CCCTACCCAGGTCAGCAGCCAGG + Intergenic
904495023 1:30881695-30881717 CCTGCCCCAGGCCAGGTGCTGGG + Intronic
905416799 1:37809105-37809127 CCCTCCCCAGGGCCGGTGGCTGG + Exonic
911520788 1:98927535-98927557 CCCTCCCAAGCTCTGCTGCAAGG + Intronic
913969419 1:143403278-143403300 CTCTCCCCAGTTCAGGAGCAAGG - Intergenic
914063796 1:144228877-144228899 CTCTCCCCAGTTCAGGAGCAAGG - Intergenic
914115354 1:144737477-144737499 CTCTCCCCAGTTCAGGAGCAAGG + Intergenic
914139890 1:144936581-144936603 TCCTCCCCAGGTTAGATGTAAGG - Intronic
914393584 1:147243075-147243097 CCCTCCACAGGCCAGGGGCCAGG - Intronic
915859026 1:159422483-159422505 CCCTCCGCAGGTGAGATGCAGGG + Intergenic
916641296 1:166730683-166730705 CCCTCACCAGGTCTGCTGCTGGG - Intergenic
917638448 1:176959318-176959340 CCCTCCCCACTTAATGTGCAGGG + Intronic
917718987 1:177768035-177768057 CCCTCCCCAGTTCTCATGCATGG + Intergenic
918740704 1:188127745-188127767 CCCTCCCCAGGTGAGCTCCAGGG - Intergenic
920059043 1:203215035-203215057 CCCACCCCAGTTCAGTTGCTGGG - Intronic
920440863 1:205979549-205979571 CCCTCCCCAGTTCAGGGGTTGGG + Intronic
920485058 1:206362120-206362142 TCCTCCCCAGGTTAGATGTAAGG + Intronic
920860080 1:209698818-209698840 CCCTCACGAGGTCACGAGCATGG - Intronic
922744455 1:228036462-228036484 CCAGCCCCAGGCCAGGTGGACGG - Intronic
1063133973 10:3200590-3200612 CCCTCCCCAGGTCAGTGATAGGG - Intergenic
1063664901 10:8055279-8055301 CCCTCCTCGGGTCACCTGCAAGG - Exonic
1065686785 10:28293650-28293672 CCCTCCCCAGCTCAGGGGCTCGG - Intronic
1067551865 10:47242035-47242057 CCCTCCCCAGGGTACGTGAAGGG - Intergenic
1067698992 10:48555394-48555416 CCCTTCCCAGGCCAGGGGCATGG + Intronic
1068309879 10:55263466-55263488 CCCTTCCCAGTTCAGGTGCCTGG + Intronic
1070733698 10:78849267-78849289 CTCTCCCCAGGTCTGTTCCAAGG + Intergenic
1070761796 10:79028586-79028608 CTGTCCCTAGCTCAGGTGCAGGG + Intergenic
1071552979 10:86581565-86581587 CCCTCCCCAGGTCAGGGAGGAGG - Intergenic
1071929334 10:90449830-90449852 CCCTCCCCTGCTCAATTGCAAGG + Intergenic
1073140505 10:101244032-101244054 CTCTCTCCTGGTCAGGTGGAAGG + Intergenic
1073458613 10:103652694-103652716 CCCTCCCCGGCTGAAGTGCAGGG - Intronic
1073540422 10:104312983-104313005 CCGTCTCCAGGTCTGGTTCAGGG - Exonic
1074030101 10:109678446-109678468 TTGTCCCCAGGTCAGGTGAAGGG + Intergenic
1074051000 10:109881328-109881350 CACTCATCAGGTCATGTGCATGG - Intronic
1074449586 10:113548357-113548379 CCCTTCCCAGCTCTGCTGCAAGG - Intergenic
1074696445 10:116053948-116053970 CCATCCCCAGGCTTGGTGCATGG + Intergenic
1074711052 10:116177844-116177866 CCCTTTCCAGCTCAGGTGCTGGG - Intronic
1075654616 10:124152854-124152876 CCCTCCGCGGGGCTGGTGCATGG - Intergenic
1076469749 10:130710181-130710203 CCCTCCCCAGGTGGGGTTGAGGG + Intergenic
1077091970 11:782683-782705 CCCTCCCCTGGACACGGGCAGGG - Intronic
1077154014 11:1083541-1083563 GCCTCCCAGGGGCAGGTGCAGGG + Intergenic
1077192824 11:1262578-1262600 TGCCCCCCAGGGCAGGTGCACGG + Intergenic
1077247345 11:1546195-1546217 CCTCCCCCAGCCCAGGTGCAGGG - Intergenic
1077302722 11:1854689-1854711 CCCTGCCCAGGCCGTGTGCAGGG + Intronic
1077448234 11:2613491-2613513 CCCACCCAAGCTCAGGGGCACGG - Intronic
1077464619 11:2727796-2727818 CCCACACCAGGCCAGGTGCTTGG - Intronic
1077541443 11:3148336-3148358 GCCTCCCCAGGTCAGGGGTGGGG - Intronic
1078647895 11:13159125-13159147 CCCACCCCACTTCTGGTGCAAGG - Intergenic
1081234951 11:40636121-40636143 CCTGCCCCAGGTGAAGTGCAAGG + Intronic
1081493163 11:43582310-43582332 CCCTCCCCAGGACCGGCGCCTGG - Intronic
1083656419 11:64231969-64231991 CCCTCCCCACCTCAGGGGTACGG - Intronic
1084167981 11:67385568-67385590 CCCTCCCCAGCTCAGGAGACCGG + Intronic
1084473419 11:69375976-69375998 CCCTCCCCAGGCGAAGAGCAAGG + Intergenic
1085409451 11:76282572-76282594 CCCATCCCGGGGCAGGTGCAGGG + Intergenic
1085515529 11:77109729-77109751 CCCACCCCGTGCCAGGTGCAGGG + Intronic
1088796343 11:113269517-113269539 GCCTCCCCAGGCCATGGGCAAGG - Intronic
1094067978 12:26381750-26381772 CCCTCCCCATGTCATGGCCATGG - Intronic
1094452841 12:30600801-30600823 TCCTCCCCAGGTTGGCTGCAAGG - Intergenic
1095779906 12:46048240-46048262 CTCTCCCCAAGTTAGCTGCAGGG - Intergenic
1095946933 12:47758933-47758955 CCCTCCCCAGGACTGGCGGAGGG + Intronic
1096577373 12:52561380-52561402 CCTTCCCCAGGGCAGGAGGATGG + Intergenic
1096580286 12:52580718-52580740 CACTCCCCAGGGACGGTGCAGGG - Intergenic
1096875869 12:54630044-54630066 CCCTCCCCAGGCCAGGCACAGGG - Intergenic
1097268086 12:57757075-57757097 CCCACTGCAGGTGAGGTGCAAGG + Exonic
1098032083 12:66265492-66265514 ACCTCTCCAGGTCAGGTTCTTGG + Intergenic
1098535405 12:71588752-71588774 CCCTCCCCACTTCACTTGCAAGG - Intergenic
1102305322 12:111800255-111800277 GCCTGCCAAGTTCAGGTGCAGGG - Intronic
1102791401 12:115649416-115649438 CCCTCCCCCAGTCATGTCCAAGG + Intergenic
1111856295 13:93641626-93641648 CCCTCCTCTGGTGAGGTGAAGGG - Intronic
1113169773 13:107487490-107487512 CACTCCACAGGTCTTGTGCATGG - Intronic
1113961758 13:114130251-114130273 CCCTCCAGAGGTCACCTGCAGGG - Intronic
1114323072 14:21563140-21563162 GCATCCCCAGGCCAGGCGCAGGG - Intergenic
1119728610 14:76937277-76937299 CCTTTCCCAGGGCCGGTGCAGGG + Intergenic
1122053425 14:99075613-99075635 CCTTCCCCAGGGAAGGTGCCTGG + Intergenic
1122088274 14:99321806-99321828 CCCTCCCCAGTTCAGGCCCCAGG + Intergenic
1122130415 14:99601978-99602000 CCCTCCCCAGCTCAGGCTGAGGG + Intronic
1122363300 14:101180105-101180127 CCCTACTCAGTTGAGGTGCAGGG + Intergenic
1122923912 14:104891215-104891237 CCCTCTCCAGGCCAGGCGCTGGG + Intronic
1122946066 14:105010287-105010309 CCTCACCCAGGGCAGGTGCATGG + Exonic
1123058910 14:105585688-105585710 CCCTCCCCAGGCCAGGTCCTGGG + Intergenic
1123223412 14:106877715-106877737 ACCTCCCCAGCACAGCTGCAAGG + Intergenic
1124079058 15:26474529-26474551 CCCTGCCCATCTCAGCTGCAAGG + Intergenic
1125609273 15:40959872-40959894 CCCTTCCCAGGCCAGGTGCGGGG - Intergenic
1127811875 15:62572195-62572217 CCCTCCCAAGGGCAGGCACAGGG - Intronic
1128599565 15:68984364-68984386 ACCTCCCCAGCACAGCTGCAAGG + Intronic
1128765884 15:70250886-70250908 CCCTCCCCAGCCCAAGTTCAAGG + Intergenic
1129850985 15:78793817-78793839 CCCTCTCCAGGGCAGGTTAAGGG + Intronic
1131151468 15:90049885-90049907 CCCTCCGCAGCTCAACTGCAGGG + Intronic
1132550417 16:551742-551764 CCCACCCCAGGTCAGCAGGAGGG - Intronic
1134626996 16:15729337-15729359 CTCTGCCCATCTCAGGTGCAGGG - Intronic
1134889554 16:17827655-17827677 CCCATCTCAGGTCAGTTGCAAGG - Intergenic
1136926990 16:34383474-34383496 CCCTCCAAAGGTCAGGTGTGGGG + Intergenic
1136977584 16:35028333-35028355 CCCTCCAAAGGTCAGGTGTGGGG - Intergenic
1137676692 16:50307138-50307160 TCATGCCCAGGTCAGTTGCAGGG + Exonic
1138455071 16:57116398-57116420 GCCTTCCCAGGCCAGGTGCATGG + Intronic
1139233331 16:65308410-65308432 CTCTTCCCAGATCAGCTGCATGG + Intergenic
1140041332 16:71410241-71410263 CACTCTCCTGGCCAGGTGCATGG + Intergenic
1141005964 16:80351908-80351930 CCCTCCCCTGTACAGGTGCTGGG + Intergenic
1141484509 16:84329971-84329993 CCCTCCCAAGGTCTGCTTCAGGG - Intergenic
1141633570 16:85302038-85302060 CCCTCCCCGGCTGAGCTGCAGGG + Intergenic
1141716184 16:85728431-85728453 CCTTCCCCAGGACAGTTGCTGGG + Intronic
1142888550 17:2928535-2928557 CCCTCCCCAGGTGACCTGCCTGG + Intronic
1143183717 17:4998619-4998641 CCCTCCCCTGGTCAGGGTCTAGG + Intronic
1143484229 17:7244152-7244174 CCCACCCCAACTCAGGTGGAGGG + Exonic
1144075929 17:11719357-11719379 CCCACTCATGGTCAGGTGCAGGG - Exonic
1144814161 17:18021651-18021673 CCCTCCCCAGGTCCTGTGAGTGG - Intronic
1145916478 17:28576968-28576990 CCCTCCCCAGGACTGGTGTCCGG + Exonic
1145941887 17:28747013-28747035 CCCTTCCCAGGACAGGGGCTGGG + Intronic
1148850285 17:50551337-50551359 CCCGCCCAAGGTCACGCGCAAGG + Intronic
1150471068 17:65438227-65438249 CCCTCCCCAGGTCTGGGGCTGGG - Intergenic
1151269150 17:72979657-72979679 CCCTACCCAGCTGAGCTGCAAGG + Intronic
1151740591 17:75979324-75979346 GCCTCCCCTGGCCAGGAGCAGGG - Exonic
1151974088 17:77474657-77474679 CCCTCCCCAGGCCAGGTCTTCGG - Intronic
1152366538 17:79859902-79859924 CCCTTGCCAGGTCTGGTGCCAGG - Intergenic
1152425621 17:80217019-80217041 CCTGCCCCAGGTGAGGTGCAAGG - Exonic
1152578769 17:81156899-81156921 CCCTCCCCAACTCAGAAGCAGGG + Intronic
1152812628 17:82389149-82389171 CCACCGCCAGGTCAGGAGCACGG + Intergenic
1152888601 17:82867116-82867138 CCCTACCGAGGTCAGGTCCTGGG + Intronic
1153480610 18:5543450-5543472 CCCTCCCCCGGGGAGGTGCGGGG - Intronic
1153778186 18:8472013-8472035 ACCAGCCCAGGTCAGATGCAGGG + Intergenic
1154002395 18:10493622-10493644 CTCTCCCCAAGTCAGGAGCCAGG - Intergenic
1155322377 18:24632025-24632047 GCCACCCCAGGTCAAGGGCAGGG - Intergenic
1158993877 18:62897422-62897444 CCCTCCTCAGCTCAGGAGCCAGG - Intronic
1159045313 18:63364373-63364395 CCCTCCCCAGGCTAAGTGCTAGG - Intronic
1159353599 18:67306342-67306364 ACCTCCCCAAGCCAGGTTCAAGG - Intergenic
1159937864 18:74382892-74382914 CACTCCCCTGGGGAGGTGCAGGG + Intergenic
1160917542 19:1504370-1504392 CCCTCCCCAGGTGAGGAGGCAGG - Intergenic
1161022490 19:2016581-2016603 CCCTCTCCAGGCCAGGTGTGGGG + Intronic
1161723961 19:5917968-5917990 CCCTTCCCAGGCCAGCTCCAAGG - Exonic
1161937654 19:7382054-7382076 CCATCCCCAGGTCACTGGCATGG - Intronic
1162475214 19:10895695-10895717 CCCTCCCCGGGATAGGGGCAGGG - Intronic
1164143217 19:22492949-22492971 CCCCTCCCAGCTCAGGTGCCTGG + Intronic
1165108882 19:33489743-33489765 CCCTGGCCAGGGCAGGGGCAGGG - Intronic
1165396946 19:35569620-35569642 GCCTCTCCAGGCCAGGTGCAGGG + Intergenic
1166920775 19:46227539-46227561 CCTTCCCCAGGGCAGGGGCAAGG - Intergenic
1166921340 19:46230992-46231014 GCCTCCTCAGGGCAGCTGCAGGG - Exonic
1167056000 19:47112095-47112117 CCCTCCCCAGGACAGGCGGACGG + Intronic
1167435038 19:49474376-49474398 CCCTCCCCAGGTTAGGGACCCGG - Intronic
1168439992 19:56356420-56356442 ACCTCCCCAGCACAGCTGCAAGG - Intronic
926197521 2:10772816-10772838 GCCTTCCCAGGGCAGGGGCAGGG - Intronic
927871546 2:26627454-26627476 CCCTCCCCTGGGTGGGTGCAGGG - Intronic
927889189 2:26737956-26737978 CCATGCCCAGGTCAGGAGCTAGG - Intergenic
928433827 2:31240914-31240936 CACTCACTAGGTCAGGTGCCTGG + Intronic
929436463 2:41932357-41932379 CCCACCCCACGTCAGCTGCAAGG - Intergenic
929609916 2:43263341-43263363 CCTTGGCCAGGTCAGGTACATGG - Intronic
929812309 2:45200960-45200982 CCATCCCCAGGTAAAGTGCCTGG - Intergenic
931219580 2:60277135-60277157 CCCTCTCCAGCTCAGGTTCCAGG + Intergenic
931317745 2:61148472-61148494 TCCTTTCCAGGCCAGGTGCATGG - Intronic
931643423 2:64400972-64400994 CCCTGCCCAGATCAGGTGGCCGG - Intergenic
932977729 2:76624881-76624903 TCCTCCCCAGCTCATGTGCCAGG + Intergenic
933777622 2:85780461-85780483 CAGGCCCCAGGTCAGGAGCAAGG - Intronic
933969348 2:87457618-87457640 GCCTCCACAAGTCAGGTGCCAGG + Intergenic
934174112 2:89564181-89564203 CTCTCCCCAGTTCAGGAGCAAGG - Intergenic
934284427 2:91638530-91638552 CTCTCCCCAGTTCAGGAGCAAGG - Intergenic
936008466 2:108909964-108909986 CCCTCCACAGCCCAGGAGCAAGG - Intronic
936073405 2:109386177-109386199 CCCTCCCCAGCTCTGTTGAAAGG - Intronic
936324439 2:111492876-111492898 GCCTCCACAAGTCAGGTGCCAGG - Intergenic
937074139 2:119088774-119088796 TCCTCCTCAGTTCAGTTGCAGGG + Intergenic
937153941 2:119705117-119705139 CCCTCCCCAGGCCAGGTCCCAGG + Intergenic
940160549 2:150708071-150708093 CCACCCCCAGGTCATGTACATGG - Intergenic
947611661 2:231528504-231528526 CCCACTCCAGGCCAGGTCCATGG - Exonic
948045479 2:234940519-234940541 CCCTCCCCAGGTAACGGGCATGG - Intergenic
948307717 2:236961992-236962014 CCATCCCCAGGTCACGAGCCAGG - Intergenic
948797059 2:240410868-240410890 CCCCCACCATGGCAGGTGCAAGG + Intergenic
948894793 2:240923072-240923094 CGCTCCACAGGCCAGGAGCAGGG + Intronic
948915136 2:241030578-241030600 CCCTCCCCAGGACAAGTGCCTGG - Intronic
1168875724 20:1171038-1171060 TCCTCTCTAGGTGAGGTGCATGG + Intronic
1169234952 20:3923289-3923311 CCCTCCCCAGGTAATGATCACGG - Exonic
1170784265 20:19453783-19453805 CTCTCCCCAGATCACTTGCAGGG + Intronic
1171188721 20:23142684-23142706 CTCGATCCAGGTCAGGTGCACGG + Intergenic
1171373598 20:24676821-24676843 GCCTCCCCTGGTGAGGTCCAGGG + Intergenic
1171943454 20:31353513-31353535 CCCTTCCCAGGGTAGGTGAAGGG - Intergenic
1174078251 20:47953044-47953066 CTCTCCCAAAGTCAGGTGCCTGG - Intergenic
1174151406 20:48488936-48488958 CCCTCCTCTGTTCAGGAGCAGGG + Intergenic
1175404021 20:58715635-58715657 CCAGCCCCAGGTCCTGTGCAGGG + Exonic
1176386068 21:6139073-6139095 CCAGCCCCAGGACCGGTGCACGG + Intergenic
1177916803 21:27099010-27099032 ACGACCCCAGGTCAGGTGCCAGG - Intergenic
1178095569 21:29211832-29211854 CCCCCCACAGCTCAGGTGCCTGG + Intronic
1179737405 21:43399179-43399201 CCAGCCCCAGGACCGGTGCACGG - Intergenic
1180088804 21:45523566-45523588 CCCTCCACAGGGCAGCTACAGGG + Intronic
1180623961 22:17181669-17181691 CTCTCCCCAGGCCAGCAGCAAGG + Intronic
1181461430 22:23088412-23088434 CCCTCCCCAGACCAGCTGCTGGG + Intronic
1181472719 22:23150822-23150844 CCCTCCCCAGTCCAGGGGCAAGG - Intronic
1181811112 22:25404627-25404649 CCCTCCCCGGGTCGGCTGCCCGG - Intronic
1182558571 22:31141979-31142001 GCCTCCCCAGGTGATGGGCAGGG - Intergenic
1182927495 22:34139289-34139311 CCATCCCAAGGTCATGTACATGG - Intergenic
1183063363 22:35348606-35348628 TGGGCCCCAGGTCAGGTGCAGGG + Intergenic
1183263591 22:36811947-36811969 CCCTATCCAGGTCAAATGCAGGG - Intronic
1183703188 22:39461355-39461377 CTCACCCCAGGGCTGGTGCAGGG - Intronic
1184066496 22:42124651-42124673 CCCTCCCCAGGTCAGGAAGGTGG - Intergenic
1184068964 22:42136803-42136825 CCCTCCCCAGGTCAGGAAGGTGG - Intergenic
1184241396 22:43212870-43212892 CCCTTCCCAGCTCAGCAGCAAGG - Intronic
1184427753 22:44423207-44423229 CGTTCCCCAGGCCTGGTGCAGGG + Intergenic
1184429223 22:44431480-44431502 CCCTCCCCAGTGAAGCTGCAGGG + Intergenic
1184788702 22:46685709-46685731 CCCCACCCAGATCAGGTGAAAGG - Exonic
1184811133 22:46832930-46832952 CCATCCCCAGCTAAGCTGCATGG + Intronic
1185129761 22:49032316-49032338 CCCTCCCTGGCTCAGGTCCAGGG - Intergenic
950441940 3:13015548-13015570 CCCTCCCCGGGCCAGGTGGGTGG + Intronic
951063971 3:18242678-18242700 CCCTGCCCAGGTCAAGCACATGG - Intronic
953018064 3:39097305-39097327 CCGTCCCCAGGTGGAGTGCAGGG + Exonic
954005979 3:47590825-47590847 CCCTCCACAGGTCAGATACCAGG - Exonic
954279286 3:49564566-49564588 CCCACTCCAGGTCAGATGCAGGG - Intronic
954381341 3:50220783-50220805 GCCTCCCCAGGACTGGTGAAGGG - Exonic
956478287 3:69646816-69646838 ACCTCCACTGGTCAGCTGCAGGG - Intergenic
957906983 3:86569921-86569943 CTCTCCCCAGGTTAGGTCCAGGG - Intergenic
960561128 3:119084889-119084911 TCCTCCCCAGCTCAAGTGCCGGG - Intronic
961365061 3:126394557-126394579 CCCTCCCCAGGAAAGAAGCAGGG + Intergenic
962826285 3:139103069-139103091 CCATCTCAAGGTCAGGTGGAGGG - Intronic
963874348 3:150457542-150457564 CCCACCTCAGCTCAGGTGCTGGG - Intronic
965340908 3:167489956-167489978 CCCACCCCAGATCTGTTGCATGG - Intronic
967102394 3:186226475-186226497 CCCACCCAAGTTCAGGGGCAAGG + Intronic
967452836 3:189646262-189646284 CCCTCCCCTTGTCAGTTGTATGG - Intronic
968944082 4:3654549-3654571 CCCTCCCCAGGCCAGGTCCCGGG + Intergenic
968950658 4:3689808-3689830 CCCTTCTCAGGACAGATGCAGGG + Intergenic
969258949 4:6021741-6021763 CCCTTCCCTGGTCAGGGGCAAGG - Intergenic
969574037 4:8025966-8025988 CCCTCCCCAGAACAGAAGCATGG - Intronic
969601610 4:8179728-8179750 CCCTCTGCAGGTCAGGAGCCTGG - Intergenic
969827964 4:9773125-9773147 CTCTTCCCAGTTCAGGAGCAAGG - Intronic
971453156 4:26818938-26818960 CCTTCCTAATGTCAGGTGCAAGG + Intergenic
972323098 4:37991039-37991061 CCCGCCCCAGGTCAGCAGCTGGG - Intronic
973230867 4:47837633-47837655 CCCTCCCAGGGTCATGGGCAGGG - Intronic
974088348 4:57284746-57284768 CCCTCCCCTAGTCAGGGGCTTGG + Intergenic
975064064 4:70039408-70039430 CTCTCCCCAGGTTAGCTTCAAGG + Intergenic
979566255 4:122157397-122157419 CCCCACCCCTGTCAGGTGCACGG - Intronic
979962341 4:127036161-127036183 CTCTCCCCAGGTAAGCTCCAGGG - Intergenic
980041764 4:127948184-127948206 CACTCCCCATGTGAGGGGCAGGG - Intronic
982268284 4:153560267-153560289 TGCTTCCCAGGTGAGGTGCAGGG - Intronic
985961593 5:3306896-3306918 CCTTCCCCAGGTCAGATGCCAGG - Intergenic
986365209 5:7022247-7022269 CCCCTCCCAGCTCAGGTGCCTGG - Intergenic
996900789 5:128538984-128539006 CCCATCCCAGGTCAGGGGCCGGG - Intronic
997649903 5:135508811-135508833 GCCTCGCAAGGGCAGGTGCAAGG + Intergenic
997783589 5:136685300-136685322 CTCTCCCCAGGTTAGCTTCAGGG - Intergenic
997820590 5:137062321-137062343 CCCTTCTCAGATGAGGTGCAGGG + Intronic
998130172 5:139647902-139647924 CGCCCCCCAGCTCAGGTGCGCGG - Intronic
998626284 5:143850061-143850083 GTTTCCCTAGGTCAGGTGCAGGG + Intergenic
1000040535 5:157481535-157481557 CCCTCCCCAGGTCAGGTGCAGGG + Intronic
1001116880 5:168947556-168947578 CTGTGCCCAGGTCAGGGGCAGGG + Intronic
1002134715 5:177100518-177100540 CCTTCCCAAGGTCAGGTCCAAGG - Intergenic
1002256056 5:177959219-177959241 CCCACCCTAGGTCAGGGACATGG - Intergenic
1002616923 5:180461727-180461749 GGCTCCCCAGGCCAGGTGCGGGG + Intergenic
1002640004 5:180626258-180626280 CCCTTCCCTGGCCAGGTACAAGG - Exonic
1004367172 6:15022112-15022134 CCTTCCCCAGGCCTGGTGGATGG - Intergenic
1004782013 6:18920012-18920034 CCCCCCCGAGTTCAGGTACATGG + Intergenic
1005118002 6:22359494-22359516 CCGTCCCCATCTCATGTGCATGG - Intergenic
1005503846 6:26452837-26452859 TCCTTCCCAGGACAGCTGCAGGG + Exonic
1005522732 6:26614398-26614420 CCCTCTCCAGGTCAAATGCTCGG + Intergenic
1006011551 6:31046584-31046606 CCCTGCCCAGGACAGTTGCTGGG - Intergenic
1006496885 6:34430045-34430067 CATCCCCCTGGTCAGGTGCAAGG - Intergenic
1007421689 6:41723600-41723622 TCCTCTCCAGCTGAGGTGCAGGG - Intronic
1007498675 6:42279367-42279389 CCCTGCCCAGGACAGCTGCAGGG - Intronic
1010564604 6:77394455-77394477 CCATCCCCAGTACAGTTGCATGG - Intergenic
1011134618 6:84086772-84086794 CCCTCCCCAGGACAGTGCCAAGG - Intronic
1011354731 6:86462315-86462337 CCCTCCCCAGGTGAGAGGCAGGG - Intergenic
1011954903 6:93015121-93015143 CTCTCCCCAGGTTAGCTCCAGGG - Intergenic
1016641961 6:146359692-146359714 TTCTCCCCAGTTCAGGGGCAAGG + Intronic
1016988906 6:149916159-149916181 CCATCCCCTGGTCAGGTGCAGGG - Intergenic
1016994086 6:149948504-149948526 CCATCCCCTGGTCAGGTGCAGGG + Intronic
1017004254 6:150019052-150019074 CCATCCCCTGGTCAGGTGCAGGG - Intronic
1019476150 7:1245386-1245408 GGCTCCCCAGCTCAGGTGCTGGG + Intergenic
1020111194 7:5448656-5448678 TCCACCCCTGGACAGGTGCAAGG + Intronic
1023141802 7:37109524-37109546 CCCTCCCCAGATAAGGCCCAGGG + Intronic
1023995749 7:45157986-45158008 CCCTCCCGAGCTCCGGGGCAAGG - Intronic
1024443035 7:49443614-49443636 CCCCACCCCGGTCAGGTGTATGG - Intergenic
1024598063 7:50956343-50956365 CCTGCCCCAGGTCAGCTGGATGG - Intergenic
1025953657 7:66165981-66166003 CTCTCCTTAGGTCGGGTGCAGGG - Intergenic
1026387381 7:69863746-69863768 GCCTCCCCAGCTCTGGGGCAGGG - Intronic
1026830136 7:73605654-73605676 CCCTCCCCAGGTCGGGTGGACGG - Intronic
1029088828 7:98032379-98032401 CTGTCCCCAGGTCCAGTGCATGG - Intergenic
1029424038 7:100485689-100485711 CCCTTCCAAGGTCAGGTGACAGG - Intronic
1029646419 7:101859226-101859248 TCTCCCCCAGCTCAGGTGCAGGG - Intronic
1034864451 7:154628926-154628948 CTCTCCTCATGTCAGGTGAAAGG + Intronic
1035857952 8:2997015-2997037 CCCTCCTCTGGTCAGGGGCTGGG + Intronic
1035996719 8:4555395-4555417 TCCTCTCCAGCGCAGGTGCATGG + Intronic
1038722045 8:30046009-30046031 TCCTCCCCAGCTCAGTTGCTGGG - Intergenic
1039448031 8:37648237-37648259 CCCTCTCCAGGACACATGCACGG + Intergenic
1040111072 8:43567451-43567473 CCTCCCCCAGGTCCGGTGCGGGG + Intergenic
1042906528 8:73777586-73777608 GTCTCCCCAGGTCAGGAGGATGG + Intronic
1044751735 8:95422902-95422924 CCCTCCCAAGATCAGGTGCTTGG + Intergenic
1046138446 8:110061028-110061050 CCCCTCCCAGCTCAGGTGCCTGG + Intergenic
1046658969 8:116927974-116927996 CCCTGCCCAGAACAGGTTCAGGG + Intergenic
1047203156 8:122782694-122782716 CTCACCCCCGCTCAGGTGCAGGG + Intronic
1047344714 8:124015959-124015981 CCCTCTCCTGGTGAGGGGCAAGG - Intronic
1048288851 8:133164232-133164254 CCCTCTCCAAGTGGGGTGCAGGG + Intergenic
1048310864 8:133321578-133321600 ACCTCCCTAGGGCAGGAGCAAGG - Intergenic
1048867441 8:138771196-138771218 TCATCCCCTGGTGAGGTGCAGGG - Intronic
1049252412 8:141596371-141596393 CCACCCCCAGATCAGCTGCAGGG - Intergenic
1049276566 8:141723019-141723041 CCCTCCTCAGGTCCAGCGCAGGG + Intergenic
1049366190 8:142238004-142238026 GCCTCCCTAAGTCAGATGCATGG - Intronic
1049438161 8:142597200-142597222 CCCTCTCATGCTCAGGTGCAGGG + Intergenic
1049529741 8:143148303-143148325 CCCTCCCCAGGCCAGGTCCTGGG + Intergenic
1049573841 8:143381621-143381643 CTCTCCTCGGGTCAGGTGGACGG - Exonic
1049747243 8:144268219-144268241 CCTTGCCCAGCTCAGGTCCAAGG - Exonic
1053113187 9:35479942-35479964 CCCTCACCAGGTCTGCTGCCAGG - Intergenic
1054443125 9:65284415-65284437 CCCGCCCCAGGCCAGGTGATCGG - Exonic
1054487156 9:65737086-65737108 CCCGCCCCAGGCCAGGTGATCGG + Exonic
1054688189 9:68302892-68302914 CCCGCCCCAGGCCAGGTGATCGG + Exonic
1055207548 9:73751162-73751184 CCCTCACCAGGTCAGCTCCTGGG + Intergenic
1055637880 9:78296231-78296253 CCCTAGCCAGGCCAGGCGCAGGG - Intergenic
1056257606 9:84816265-84816287 CTATCCTCAGGTCAGCTGCATGG + Intronic
1056365415 9:85899702-85899724 CCCTCACCAGCGCAGCTGCAGGG - Intergenic
1056935973 9:90914916-90914938 CCCACCCCATGTCAGGGACATGG - Intergenic
1059248617 9:112868333-112868355 CCCGCTCCAAGTCAGGTGCCTGG + Intronic
1059413672 9:114149963-114149985 CTCTCCCCAGGGCAGGTGGCTGG - Intergenic
1061098344 9:128473069-128473091 CCCTCCCGAGGCCAGTTCCATGG - Intronic
1062374103 9:136254300-136254322 CCCTCCCCAGGCCATGGGGACGG + Intergenic
1062383515 9:136299045-136299067 CCTGCCCCAGGTCAAGTTCAGGG - Intronic
1062688454 9:137828311-137828333 CCCACCCCAGGGCATGTCCAGGG - Intronic
1185963794 X:4576941-4576963 CACTCACCAGGCTAGGTGCAGGG + Intergenic
1187391353 X:18888400-18888422 CCCTCCTCACCCCAGGTGCATGG - Intergenic
1188787821 X:34370286-34370308 CCTTCCCCTGGACAAGTGCAAGG - Intergenic
1190316905 X:49157079-49157101 CCCTCCCCTGCTCTGGTGCGCGG + Intergenic
1190317858 X:49163140-49163162 CCCTCCCCTGCTCTGGTGCGCGG - Intronic
1190322485 X:49187079-49187101 CCTTCCCCAGCTCAGTTCCAGGG + Intergenic
1190369369 X:49726748-49726770 CCCTCCCCACCACAGCTGCAAGG + Intergenic
1191253796 X:58271235-58271257 CCCCCCCCGGGTCAGGCGCAGGG + Intergenic
1196172954 X:112610104-112610126 CCCTCCCCACATCAGGTAGATGG + Intergenic
1196371359 X:114983099-114983121 CCTTCCCCAGGTCCGGAGCCAGG - Intergenic
1196999078 X:121418027-121418049 CCCTGCCCAGGTCACTAGCAAGG + Intergenic
1198736553 X:139792090-139792112 CCTTCCCCAGGTCAGGTGTGGGG - Intronic