ID: 1000040769

View in Genome Browser
Species Human (GRCh38)
Location 5:157483575-157483597
Sequence CCAAAGAGATTACACTGGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 189
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 175}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000040763_1000040769 19 Left 1000040763 5:157483533-157483555 CCTAATAGAAATGTCTGTAACAG 0: 1
1: 0
2: 2
3: 20
4: 237
Right 1000040769 5:157483575-157483597 CCAAAGAGATTACACTGGGATGG 0: 1
1: 0
2: 0
3: 13
4: 175
1000040762_1000040769 22 Left 1000040762 5:157483530-157483552 CCGCCTAATAGAAATGTCTGTAA 0: 1
1: 0
2: 0
3: 14
4: 180
Right 1000040769 5:157483575-157483597 CCAAAGAGATTACACTGGGATGG 0: 1
1: 0
2: 0
3: 13
4: 175

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000040769 Original CRISPR CCAAAGAGATTACACTGGGA TGG Intronic
900499455 1:2994075-2994097 CGAGAGAGATTAAACAGGGATGG - Intergenic
904380795 1:30109386-30109408 CCAGAGGGATAACAATGGGAGGG - Intergenic
904798876 1:33078946-33078968 CCTAAAAGATTATACTGAGAGGG - Intronic
905631187 1:39519442-39519464 CCAGAGAGAATCCACTGGGCAGG - Intronic
905666570 1:39766729-39766751 CCAGAGAGAATCCACTGGGCAGG + Intronic
911988115 1:104657483-104657505 CCAGAGACATTGCACTGGGGAGG - Intergenic
912148214 1:106820788-106820810 TCTAAGAGATGAGACTGGGAAGG - Intergenic
915567442 1:156723513-156723535 GTACAGAGAGTACACTGGGAAGG - Intronic
915586601 1:156847151-156847173 CCTAAGTGAAGACACTGGGAAGG - Intronic
918012547 1:180601570-180601592 CCCAAGAGGTTTCAGTGGGAAGG + Intergenic
918204648 1:182298102-182298124 CCTAAGAGCTTCCTCTGGGATGG - Intergenic
919879764 1:201893811-201893833 CCATGAAGATTTCACTGGGAAGG - Intergenic
920103919 1:203537002-203537024 CCAAAGAGATTAGTGTGTGAAGG - Intergenic
921528409 1:216247136-216247158 CCATGGAGGTTACACTGGCAGGG + Exonic
922561690 1:226574501-226574523 TCACAGTGATTACACAGGGAAGG - Intronic
922562450 1:226579098-226579120 CCTAAGAAATGGCACTGGGATGG - Intronic
924133652 1:240939684-240939706 CCATAAAGATTCCTCTGGGAGGG + Intronic
1063042383 10:2356549-2356571 CTGAAGAGATGAAACTGGGATGG - Intergenic
1064389544 10:14929796-14929818 CCAAAGAAATTTGAGTGGGATGG - Intronic
1067719987 10:48721072-48721094 CCAAGGAGATTAGTCTGGCAGGG + Intronic
1069121427 10:64574280-64574302 GGACAGAGCTTACACTGGGAGGG + Intergenic
1071017984 10:81020854-81020876 CCAGAGACAGTAGACTGGGAGGG + Intergenic
1073736023 10:106347575-106347597 CTTAACAGATTACAGTGGGATGG - Intergenic
1074891081 10:117737074-117737096 CCAAAGATAGGACCCTGGGATGG - Intergenic
1080315110 11:30938811-30938833 CCACAGATAATTCACTGGGAAGG - Intronic
1083558485 11:63652598-63652620 CAAAAGAGATTAAACTAAGAAGG + Intronic
1084201171 11:67559491-67559513 CCAAAGTGATTATTCAGGGAGGG - Intergenic
1084987261 11:72886437-72886459 CCACAGAAATCACTCTGGGAGGG - Intronic
1086414735 11:86577227-86577249 CCAAAGAGATTGCACAGATAGGG + Intronic
1087097045 11:94329069-94329091 CCAAAGAGATTAATATGGGTGGG - Intergenic
1087402463 11:97684675-97684697 CCAGAGACAGTAGACTGGGAGGG - Intergenic
1088421406 11:109651925-109651947 CCAAAGAGGTTACCTTAGGAAGG - Intergenic
1088568363 11:111196927-111196949 CCAAAGAGAATGCACTCAGAAGG - Intergenic
1089274443 11:117325036-117325058 CCAAAGGGACCAGACTGGGAAGG - Intronic
1090125876 11:124083526-124083548 TCAAAGAGTTTCCTCTGGGAAGG - Intergenic
1093663577 12:21785723-21785745 CAAAAGAGATTATACTTGTAAGG + Intergenic
1095820482 12:46473046-46473068 CAATAGAGATTAAACTAGGAAGG - Intergenic
1098470844 12:70841908-70841930 CCATGGAGATAACAATGGGAAGG - Intronic
1099933927 12:89103523-89103545 CTAAACAAATTACACTAGGATGG + Intergenic
1101332811 12:103770814-103770836 CCAAGGTGATAACACTAGGAGGG + Intronic
1101743136 12:107516887-107516909 CTGAAGAGATGACACTGGCATGG - Intronic
1102674319 12:114646310-114646332 CCTAAGAGATGACACTGGAGGGG - Intergenic
1102807578 12:115795424-115795446 CCAAATCCATTACACGGGGAAGG + Intergenic
1103218426 12:119222373-119222395 TCAAAAAGATTACACTGATATGG - Intergenic
1104117300 12:125762082-125762104 CCTAAAAGTTTACATTGGGATGG - Intergenic
1104759276 12:131287267-131287289 GCCAAGAGGTAACACTGGGAAGG - Intergenic
1104821335 12:131679229-131679251 GCCAAGAGATGACACTGGGAAGG + Intergenic
1105797885 13:23874413-23874435 ACACAGTGTTTACACTGGGATGG - Intronic
1109172427 13:59113565-59113587 CCACAGAGTTTGCACTGGTAAGG + Intergenic
1109637065 13:65134695-65134717 CAAAAGAGATTATTCTGGGTTGG + Intergenic
1109826975 13:67734545-67734567 TCAAAGAGATTAAACTGGATAGG - Intergenic
1116012551 14:39367673-39367695 CCTAAGAGAGAACACTGGAATGG - Intronic
1118764957 14:68903653-68903675 CCAAGGAGAGCACACAGGGAAGG + Intronic
1120205202 14:81580331-81580353 ACAAAGAGGCTACAATGGGAAGG + Intergenic
1123787752 15:23689736-23689758 CCTGAGAGATTACACTTGGAAGG + Intergenic
1123932274 15:25177651-25177673 TCAAAGAGGTGCCACTGGGAGGG - Intergenic
1123934241 15:25186469-25186491 TCAAAGAGGTGCCACTGGGATGG - Intergenic
1125299002 15:38234193-38234215 CCACATAGATCAAACTGGGAAGG - Intergenic
1126002509 15:44224369-44224391 CCAAAAAGATGAAAATGGGAAGG - Intergenic
1126217712 15:46175611-46175633 CCTAATAGATGACACTAGGATGG + Intergenic
1126297992 15:47162727-47162749 CCAAGGAGCTCACAATGGGATGG - Intergenic
1126544708 15:49860627-49860649 CCCAAAAGATAACACTGGGGGGG + Intronic
1126558669 15:50019676-50019698 CCAGAGAGATTGCAGTTGGAAGG - Intronic
1127100908 15:55563859-55563881 GCAATGAGATAACACTGGGATGG + Intronic
1128913364 15:71537175-71537197 GCTAAGAGCTTAAACTGGGATGG - Intronic
1131574485 15:93572758-93572780 TCAAAAAGAAAACACTGGGATGG - Intergenic
1131717350 15:95127728-95127750 CCAAATGTATAACACTGGGAAGG + Intergenic
1133131802 16:3680698-3680720 CCAAGGGGATGGCACTGGGAGGG + Intronic
1136518394 16:30781636-30781658 CCAAAAAAATTACATGGGGAAGG - Exonic
1139681068 16:68563712-68563734 CCACAGAGACTACACTGATAGGG - Exonic
1140803690 16:78512853-78512875 CCAAAGTGATTCCAATGGGAGGG - Intronic
1146081362 17:29783609-29783631 CAAAAGAGATTACCTGGGGAAGG - Intronic
1146157331 17:30535395-30535417 CCAAAGGGATGACACGGTGAGGG + Intergenic
1147345633 17:39791553-39791575 CCACACTGATTACACTGGAATGG + Exonic
1149391963 17:56201033-56201055 GCAAAGAGATTGGACTGTGAGGG - Intronic
1149427032 17:56565235-56565257 CCCAAGAAATTTCACTGGGGTGG - Intergenic
1150822527 17:68446910-68446932 ACAGAGAGAAAACACTGGGAGGG + Intronic
1153350311 18:4073089-4073111 CCAAGGAGATTAAGATGGGATGG + Intronic
1153894517 18:9546191-9546213 GTAAACAGATTCCACTGGGAAGG - Intergenic
1158426630 18:57346325-57346347 CCTGAGAGATAACAGTGGGAGGG + Intergenic
1164697585 19:30258015-30258037 CCAAAGAGGAGACACTAGGAAGG - Intronic
1167943316 19:52964852-52964874 CAAAATAGATTACAATTGGATGG - Intergenic
925133731 2:1512325-1512347 GCAAAGAGGTAGCACTGGGAGGG - Intronic
925805368 2:7643319-7643341 CCATAAAGATGACTCTGGGAGGG + Intergenic
928435492 2:31251985-31252007 CCAGGGAGTTCACACTGGGAAGG - Intronic
929340204 2:40806334-40806356 CCAGCGTGATTACACTGGGAGGG - Intergenic
932778992 2:74548592-74548614 CAAAATAGATTACAGTGAGAGGG + Intronic
938150440 2:128877938-128877960 CCAGTGCCATTACACTGGGAGGG + Intergenic
942669691 2:178361673-178361695 CAAAAGAGAATGCACTGGGTGGG - Exonic
944655510 2:201873249-201873271 CCAGAGATCTTTCACTGGGAGGG + Intronic
945005147 2:205397438-205397460 CCAAACATATTCCACTGTGAGGG + Intronic
945176537 2:207049032-207049054 CCAAAGAGGTGGCAATGGGAAGG + Intergenic
946195486 2:218030338-218030360 CCAGAGGGATTGCACCGGGAAGG - Intergenic
947869264 2:233423897-233423919 CCAAAGGGATGACACTGTGGTGG - Intronic
1169408455 20:5346502-5346524 CAAAAGAGATTACACAGAAAAGG - Intergenic
1169605197 20:7309767-7309789 CCAAAGAGAGTACAGTGGAGAGG + Intergenic
1170216783 20:13900087-13900109 CCAAAGACACTACACTCAGATGG - Intronic
1173168495 20:40703300-40703322 CCACAGAGATGGGACTGGGAAGG + Intergenic
1174609932 20:51790684-51790706 CCACAGATCTTACACTGGAACGG + Exonic
1175515566 20:59567663-59567685 GCACAGAGATGACATTGGGAAGG - Intergenic
1175915413 20:62423655-62423677 CCACAGTGACTTCACTGGGAAGG - Intronic
1176100603 20:63362737-63362759 CCAAAGAGATAACACAGGTGCGG + Intronic
1176511774 21:7754008-7754030 CCAATGAGATTCCACTGTGGGGG - Intronic
1178094219 21:29197072-29197094 CCACAGAGATAAATCTGGGAAGG + Intronic
1178644001 21:34369608-34369630 CCAAAGAGATGGCTCTGGGGAGG + Intronic
1178645887 21:34384535-34384557 CCAATGAGATTCCACTGTGGGGG - Intronic
1179152079 21:38817782-38817804 CCAGAGAGAAAACACTGGGCCGG - Intronic
1179209320 21:39312872-39312894 CCGAAGAGATTGGACTGGGAGGG - Exonic
1181487785 22:23242388-23242410 CCATAAAGATTCCTCTGGGAGGG - Intronic
1182170458 22:28223606-28223628 CCAAAGAGATTTCTCTGAAAAGG + Intronic
1183352411 22:37341623-37341645 CCCAAGAGATTTCTCTGAGATGG - Intergenic
1184307685 22:43617760-43617782 CCAAGGAGCTTACACTGTGATGG + Intronic
949730806 3:7110651-7110673 CCAAAGGACTTAGACTGGGAAGG - Intronic
949938273 3:9134383-9134405 CCTAAAAATTTACACTGGGAAGG - Intronic
951465715 3:22998572-22998594 CCTCAGAGAGAACACTGGGATGG - Intergenic
955655028 3:61236356-61236378 CACAAGAGATGTCACTGGGAAGG - Intronic
957255083 3:77825954-77825976 CCCCAGAGATTACACGGAGATGG - Intergenic
958951359 3:100420235-100420257 TCAAAGACATTTCACTGAGAAGG - Intronic
959137274 3:102439261-102439283 CCAAAGAGATTCCATTTGCATGG - Intronic
960043675 3:113175657-113175679 CCAAAGACAGAACACTGGGCAGG + Intergenic
962361949 3:134750150-134750172 CCGAAGAGCTCACATTGGGAAGG - Intronic
963648520 3:147947042-147947064 CCAAAGAAATTACCTTGGGCAGG - Intergenic
966172965 3:177103110-177103132 ACAAATAAATCACACTGGGAAGG + Intronic
973388889 4:49535715-49535737 TCAAAGTGATTACACTGGTCAGG + Intergenic
973788673 4:54358529-54358551 GCAAAGAAATTACACGGGTAAGG - Intergenic
976126844 4:81842328-81842350 TCAAAGTGATCACTCTGGGAAGG - Intronic
976908847 4:90275041-90275063 AGAAAGAGATTACAATGGAAGGG - Intronic
979088378 4:116444838-116444860 TCAAAGAGCTTACACTGTCATGG + Intergenic
979293459 4:119003651-119003673 ACATAGAGACTATACTGGGAGGG - Intronic
985924908 5:3008326-3008348 CCAAAGAGATTCCATGGAGAAGG - Intergenic
986309725 5:6543212-6543234 CCACAGAGGTCACAGTGGGAGGG + Intergenic
986849168 5:11790951-11790973 CAAATGAGGTTACACTGGGATGG + Intronic
987092057 5:14516895-14516917 CCATAAAGATTCCTCTGGGAGGG - Intronic
987359864 5:17097082-17097104 CCAAAGGAATTTCCCTGGGAAGG - Intronic
988217559 5:28294711-28294733 CTAAAAAGATTACACTTGCATGG - Intergenic
990896069 5:60701074-60701096 CCACAAAGATTTCTCTGGGATGG + Intergenic
991733280 5:69609222-69609244 CCAACGAAACTACAGTGGGAGGG + Intergenic
991809715 5:70464368-70464390 CCAACGAAACTACAGTGGGAGGG + Intergenic
991861673 5:71018629-71018651 CCAACGAAACTACAGTGGGAGGG - Intronic
994843610 5:104957060-104957082 ACAAAGATTTTACTCTGGGAAGG + Intergenic
996458230 5:123709518-123709540 CCAAAGAGATTAGAATGTAAGGG - Intergenic
996850371 5:127944471-127944493 ACAAAGAGATTCGGCTGGGAAGG - Intergenic
996948993 5:129102289-129102311 CCATAGAGAATACAGTGGCAAGG - Intronic
998134800 5:139668955-139668977 CCCAAGAGAGGAGACTGGGAGGG - Intronic
1000040769 5:157483575-157483597 CCAAAGAGATTACACTGGGATGG + Intronic
1001838465 5:174852815-174852837 ACAAAGAGAGGAAACTGGGAGGG + Intergenic
1003750604 6:9050852-9050874 CCATAGAGATTAAAATGTGATGG - Intergenic
1004278400 6:14258259-14258281 TAAAAGAGAATAAACTGGGAGGG + Intergenic
1005695744 6:28351200-28351222 CCAAACTGATCACAGTGGGAAGG - Intronic
1007217548 6:40252029-40252051 CACAAGAGTTTACACTTGGAAGG - Intergenic
1007413314 6:41677805-41677827 CCAAAGATAGTACAATGGAAAGG + Intergenic
1013698251 6:112730140-112730162 CCCCAGAGATTACACAGGTATGG + Intergenic
1016485020 6:144528330-144528352 CCAAAAAGATCACACTAGGCTGG - Intronic
1026823764 7:73568225-73568247 CCACAGAGCTGACAGTGGGATGG + Intergenic
1027798012 7:82718103-82718125 CCAAAGAGACTATACTGGGGTGG - Intergenic
1028624284 7:92860661-92860683 CCAAAGAGATGAAATTGGGGTGG + Intergenic
1029268000 7:99357704-99357726 GCAAAGAGATTACACAGATATGG - Intronic
1029565867 7:101337295-101337317 CCAAAGAGATAAAACTGGCTGGG - Intergenic
1029795978 7:102895067-102895089 TCAAAGAGCTTACCTTGGGAAGG + Intronic
1031126982 7:117785552-117785574 CCAAAGTGATTACAGATGGAGGG + Intronic
1032785038 7:135194037-135194059 CCGAAGCGAGTACGCTGGGAGGG - Intronic
1033636666 7:143218325-143218347 CCCAAGACATTACAATTGGATGG + Intergenic
1034873799 7:154706817-154706839 CCCAAGAGATTTCTCTGGGTGGG + Intronic
1036125673 8:6059566-6059588 CCAAATAGAAAATACTGGGAAGG + Intergenic
1037855764 8:22369525-22369547 CCCAAGAGTTTGCACTGGAAGGG - Intronic
1038941333 8:32309169-32309191 CCATAAAGATTCCTCTGGGAGGG + Intronic
1040632451 8:49231013-49231035 CCATAAAGATTCCTCTGGGAGGG - Intergenic
1044355057 8:91212445-91212467 CAAAAGAGATTAGACTGCGTAGG + Intronic
1044636983 8:94335188-94335210 TTAAGAAGATTACACTGGGAGGG - Intergenic
1048324473 8:133428519-133428541 CCAACCTGATTTCACTGGGAGGG + Intergenic
1050571693 9:6947117-6947139 TCCCAGAGATTACACTGGGAAGG - Intronic
1056932739 9:90892380-90892402 CCATAAAGATTCCTCTGGGAAGG - Intronic
1057800526 9:98188382-98188404 CCAAAGAGCTTACAATCAGATGG - Intronic
1058038802 9:100282220-100282242 CCAGAGAGATCACACTGAAATGG + Intronic
1058798451 9:108521017-108521039 CCAAAGATGTTACCCTGGGAGGG + Intergenic
1059576405 9:115493553-115493575 ACAAAGATCTCACACTGGGATGG + Intergenic
1059721576 9:116965150-116965172 CCTAAGATATTATGCTGGGAAGG - Intronic
1060357046 9:122918940-122918962 CCACAGATTTTACACTGGAAAGG + Exonic
1060770475 9:126327974-126327996 ACAATGAGATTATACTGAGAAGG - Intronic
1186999896 X:15165954-15165976 CCAAAGAAATGACGGTGGGAAGG - Intergenic
1187171268 X:16854515-16854537 CCTAAAAGTTTACACTGGGATGG + Intronic
1188679392 X:32983049-32983071 CCATAAAGATTCCTCTGGGAGGG + Intronic
1189675151 X:43453778-43453800 CCATAAAGATTCCTCTGGGAGGG + Intergenic
1190017299 X:46837678-46837700 CCAAAGAGATTTGCCGGGGAGGG - Intronic
1192531734 X:71893560-71893582 CCCAAGAAATTTCACTGAGATGG + Intergenic
1193086564 X:77452183-77452205 CCAAAGAGATTTCAAGAGGATGG - Intronic
1194765704 X:97844080-97844102 GCAAAGAGATTGCACTGGAGGGG - Intergenic
1197252827 X:124233003-124233025 CAAGAGAGATTACACAGGGAGGG - Intronic
1199364000 X:146957050-146957072 CCAGAGAGAGTGAACTGGGAGGG + Intergenic