ID: 1000041255

View in Genome Browser
Species Human (GRCh38)
Location 5:157486704-157486726
Sequence ACTTGGGGTTACAGGAGAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 171
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 153}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000041255_1000041264 22 Left 1000041255 5:157486704-157486726 CCTGTTCTCCTGTAACCCCAAGT 0: 1
1: 0
2: 1
3: 16
4: 153
Right 1000041264 5:157486749-157486771 TTTCTTTCATCTCTCTGTTAGGG No data
1000041255_1000041263 21 Left 1000041255 5:157486704-157486726 CCTGTTCTCCTGTAACCCCAAGT 0: 1
1: 0
2: 1
3: 16
4: 153
Right 1000041263 5:157486748-157486770 CTTTCTTTCATCTCTCTGTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000041255 Original CRISPR ACTTGGGGTTACAGGAGAAC AGG (reversed) Intronic
904483666 1:30809956-30809978 ACTTGGGGATGCAGGAAAAGAGG - Intergenic
904921722 1:34013424-34013446 ATTTGGGGTCTCAGGAGAGCTGG - Intronic
905824359 1:41017511-41017533 ACTGGGGGCCACAGGAGAAGAGG - Intronic
908958977 1:69671455-69671477 GCCTGGGGTTAGAGGAGAAGTGG + Intronic
910677517 1:89829714-89829736 ACTTGGGGTGACAAGAGCATTGG - Intronic
912471918 1:109912023-109912045 ATTTGGGGGTAGAGGAGAGCGGG + Intronic
913533616 1:119750660-119750682 GATTGGGGTGACAGGAGAAATGG - Intronic
915532096 1:156508628-156508650 ACTTGGGGACCCAGGAGAGCTGG + Intergenic
917011105 1:170472263-170472285 ACTTGTGGGTAAAGGAGAATGGG - Intergenic
920072391 1:203311804-203311826 ACCTGGGGTTACAGGGGCTCTGG + Intergenic
920647823 1:207816200-207816222 ATTTGGGGTTTCTGGAGATCTGG - Intergenic
920873229 1:209811502-209811524 ACTTGGGGAGTCAGGAGACCTGG + Intergenic
921340418 1:214128920-214128942 ACCTGGGGTTCTAGGAAAACTGG + Intergenic
1062821994 10:541661-541683 TCTTGGGGTTCCAGGAGAGACGG - Intronic
1065564689 10:26996801-26996823 TTCTGGGGTTACAGGAAAACTGG + Intronic
1068846284 10:61678659-61678681 TCTTAGGGTTACAAGATAACTGG + Intronic
1068874529 10:61982115-61982137 ACTTGGGGTTAGATTAGAGCTGG + Intronic
1069641110 10:69956070-69956092 ACATGGGGCTTCAGGAGACCCGG - Intronic
1069786425 10:70990999-70991021 ACTTGGGCAGACAGGAGAGCTGG + Intergenic
1070257202 10:74823229-74823251 TCCTGGGGTTACAAGAGCACAGG + Intergenic
1073221094 10:101874811-101874833 ACTGGGGGTTCAAGGAGAACGGG + Intronic
1073517149 10:104086734-104086756 ACTTGGAGTTGCAGGACATCTGG - Intergenic
1075166040 10:120069371-120069393 ACATGGTGGTACAGGAGAGCAGG + Intergenic
1077572500 11:3352336-3352358 AGTTGGGGGTGCAGGAGAACTGG + Intronic
1077573483 11:3358047-3358069 AGTTGGGGGTGCAGGAGAACTGG + Intronic
1078055326 11:8004405-8004427 ACTGGGGGGTAGAGGAGAAGGGG + Intergenic
1079447938 11:20573279-20573301 ACTTGGGGATATAGGATAAAGGG + Intergenic
1079577730 11:22024448-22024470 AATTGGAGTTACAGGAGGAGAGG - Intergenic
1081622540 11:44627416-44627438 ACTGGGGGTGAGAGAAGAACAGG - Intergenic
1081641299 11:44756145-44756167 ACTTGGGATTCTAGGACAACAGG + Intronic
1082089072 11:48074579-48074601 CCTCTGGGTTACAGGAGAAAGGG - Intronic
1083990441 11:66243143-66243165 ACTAGGGGTGACAGGAGAGGAGG - Exonic
1085645925 11:78222847-78222869 TGTTGGGGTTACAGGCGTACAGG + Intronic
1087350727 11:97028750-97028772 ACTTGGGCTTTCAGGATAATAGG + Intergenic
1088754453 11:112874195-112874217 ACCTGGGGTTCCAATAGAACTGG + Intergenic
1088900410 11:114111897-114111919 ACTTGGGGTAAAAGGGGAAGAGG - Intronic
1089068530 11:115680458-115680480 CCTTGGGGTTTGAGCAGAACTGG - Intergenic
1089391906 11:118107942-118107964 GCTTGGGGTTCCAGGTGAGCTGG - Intronic
1089603925 11:119630749-119630771 GGTTGGGGGTACAGGAGACCAGG + Intronic
1090333005 11:125945895-125945917 ACTGAGGGTAACAGGAGAGCAGG + Intergenic
1091667601 12:2430644-2430666 GCTTGGGTTTACAGGGGAAAGGG - Intronic
1096541473 12:52309697-52309719 CCTTGGGTTGAGAGGAGAACTGG + Intergenic
1096788632 12:54031784-54031806 ACTTGGGGCTACGGGGGAAGAGG + Intronic
1099630999 12:85145605-85145627 ACTTGGGGGAAAAGGAGAATTGG - Intronic
1100597635 12:96085459-96085481 AGTTGGAGATACAGGAGAACTGG + Intergenic
1101158060 12:101946331-101946353 ACTTGGGGTGACAGGACAGATGG - Intronic
1105041662 12:132966116-132966138 ACCTGGGGTAGCAGGAGACCAGG + Intergenic
1106626425 13:31425326-31425348 GCCTGGTGTGACAGGAGAACAGG + Intergenic
1107431438 13:40344197-40344219 ACTTGTGATTTCAGGAGAACTGG - Intergenic
1107998545 13:45885832-45885854 CCTTGGGGCTAGAGGAGAAGAGG + Intergenic
1108720711 13:53128801-53128823 ACTTTAGGTGACAGGAGAAAAGG + Intergenic
1109060209 13:57608071-57608093 TCTTATGGTGACAGGAGAACAGG - Intergenic
1113187320 13:107703475-107703497 AGCTGGGGTTACAGGATTACAGG + Intronic
1114260116 14:21030522-21030544 ACTTGGGGGTGAAGGAGAAGGGG - Exonic
1117629246 14:57672209-57672231 ACAAGGGGTGACAGGAAAACAGG - Intronic
1119640424 14:76310455-76310477 ACTTGGGGTCACAGGGGAGCTGG - Intergenic
1121705582 14:95990820-95990842 TCTTGGGTTTCCAGGAGAAGGGG + Intergenic
1121759828 14:96435490-96435512 GCTTGGGGTTAGAGGAGAGGTGG + Intronic
1122051976 14:99066732-99066754 GCTTGGGGCTAAAGGAGCACAGG + Intergenic
1126826112 15:52550029-52550051 ATTTGGGGTCATAGGAGAGCAGG + Exonic
1128181731 15:65611033-65611055 TGTTGGGGTTACAGGTGAAGGGG - Intronic
1128388852 15:67169282-67169304 ATTTGGGGTTACAGGGGAGAAGG + Intronic
1129141270 15:73600027-73600049 ACTTGGGGTTACAGTGGAATTGG - Intronic
1129203880 15:74023796-74023818 ACCTGGGGTTACGGTAGAAGGGG + Intronic
1130513135 15:84605517-84605539 CCTTTGGGTGACAGGAGAGCTGG + Intronic
1132617009 16:846544-846566 ACGTGGGTTTACAGGAAACCGGG - Intergenic
1136088138 16:27900167-27900189 ATTTGGGGTTCCTGGAGGACTGG - Intronic
1138608010 16:58100976-58100998 ACTTGGGGTCTGAGGAGAAGGGG + Intergenic
1140930850 16:79626462-79626484 ACTTGGGGCCACAAGAGAAGAGG + Intergenic
1144051494 17:11500835-11500857 ACTTGGGTCTACAGGGAAACTGG + Intronic
1144195458 17:12890434-12890456 ACTTGGGGTTACTTGAGTAATGG + Intronic
1146496809 17:33329913-33329935 ACTTGGGGCAAGAGGGGAACGGG + Intronic
1147501343 17:40966809-40966831 ACATGGGGTTGAAGGAGAATTGG + Exonic
1147620248 17:41861816-41861838 AATTGGTGTTACAGGAGCAGGGG - Intronic
1148154599 17:45415700-45415722 CCTTGGTGTTACCTGAGAACTGG - Intronic
1155782389 18:29852494-29852516 ACTTGGGGTTACAGAAAGAATGG - Intergenic
1155965043 18:32027874-32027896 ACTTGAGGTTACAGAAGAATGGG + Intronic
1157334437 18:46727778-46727800 ACATGGGGTTAAAGGAGAGAAGG - Intronic
1157526779 18:48389317-48389339 AGATGGGGTTATAGGAGAACAGG + Intronic
1158223176 18:55170497-55170519 ACTTGGGGAGGCAGGAGAAAGGG + Intergenic
1158416815 18:57256142-57256164 ACTTGGAGCTACAGGACATCAGG + Intergenic
1158447254 18:57532157-57532179 ACTAGGGGAGACAGGAGACCTGG + Intergenic
1161437640 19:4273225-4273247 GCCTGGGCTTACAGGAGAAGAGG + Intergenic
1163870272 19:19815473-19815495 ACCTGGGATCACAGGACAACGGG + Intronic
1165786975 19:38467458-38467480 TCTTGGAGTTAGAGGAGAATTGG - Intronic
1166250880 19:41570114-41570136 ACTGGGGGTGTCAGGAGAGCTGG + Intronic
1167037022 19:47000698-47000720 ACCTGGGGCGACAGGAGAACCGG + Exonic
930233385 2:48865364-48865386 AGCTGGGGTTAAAGGAGAACTGG + Intergenic
934558237 2:95298756-95298778 ACTTGAGGTGACAGGAGAGAAGG - Intronic
934718739 2:96558379-96558401 ACTTGGGGTTGGTGGTGAACGGG - Intergenic
938029594 2:127981299-127981321 AATTGGGGGTGCAGGAGGACTGG - Intronic
940252661 2:151696659-151696681 ACTTGGGCTTGTAGCAGAACAGG + Exonic
942238400 2:173935484-173935506 TCTTTGGGTGACAGGAAAACAGG - Intronic
944981315 2:205123835-205123857 AATTGGAGATGCAGGAGAACAGG + Intronic
947825247 2:233101278-233101300 TCTTGGGGTTCCTGGAAAACTGG + Intronic
1172152153 20:32798184-32798206 ACTTTGGATTACAGGCCAACTGG - Intronic
1172901084 20:38335398-38335420 ACTTGGGGTTGATGGACAACAGG + Intronic
1173216202 20:41086716-41086738 ATTTTGGGTTAAAGGGGAACTGG + Intronic
1176001397 20:62833043-62833065 TCCTGGGGATAAAGGAGAACTGG + Exonic
1177647397 21:23917410-23917432 ATTTGGGGTCACAGGAGTCCAGG - Intergenic
1181316009 22:21971259-21971281 AGCTGGGGGTACAGGAGCACGGG + Intronic
1182041980 22:27245254-27245276 ACCTTGGGTTACAGGGGTACTGG - Intergenic
1183263742 22:36813132-36813154 ACTTGGGGTTACAGGACACCAGG + Intronic
949659611 3:6262673-6262695 AATAGGTGTTACAGGAGAATGGG + Intergenic
953079022 3:39598072-39598094 ACTTGGTGATACAGGAGGACAGG - Intergenic
954436761 3:50500394-50500416 ACCTGGGGGCACTGGAGAACAGG + Intronic
954752286 3:52820454-52820476 ATTTGGGGAGACAGGAGACCCGG + Intronic
955621335 3:60867562-60867584 GCTTGGGGCTAAAGGAGAACTGG - Intronic
960655714 3:120002084-120002106 ACTTTGTGATTCAGGAGAACTGG - Exonic
962101295 3:132345507-132345529 ACTCAGGGTTTCAGGAAAACAGG - Intronic
970662676 4:18303718-18303740 AATTGGAGTTCCAGAAGAACAGG - Intergenic
973063122 4:45754781-45754803 ACTTGTGGTTTCAGGGGAAGAGG - Intergenic
976599866 4:86928265-86928287 ACTTAGTGTTACAGGAGCTCAGG + Intronic
976756245 4:88500901-88500923 ATTTGCGGTTACAGGTGCACTGG + Exonic
977724968 4:100285707-100285729 GCTTGGGGAGAGAGGAGAACGGG - Intergenic
978801361 4:112758540-112758562 AGTTGGGATTACAGGCGAGCAGG + Intergenic
982305667 4:153928259-153928281 CCTTGGGGTTACAGGCTAAAAGG + Intergenic
983994473 4:174164696-174164718 ACTTTGAGTTAAAGGAAAACTGG + Intergenic
986057306 5:4151156-4151178 ACTTGGGGTGAAGGGAGAGCAGG + Intergenic
986273686 5:6255625-6255647 AATTGGGTTTACATCAGAACTGG + Intergenic
986965947 5:13271302-13271324 AGTTGAGGTGACAGGAGAAGTGG - Intergenic
987452454 5:18103166-18103188 ACTTGGGTATAAAGGAGAAAAGG + Intergenic
991027166 5:62042398-62042420 AGTTGGGGGTGCAGGAGAAAAGG + Intergenic
991536298 5:67672648-67672670 ACTTTGGGTTAAAAGAGAAATGG - Intergenic
991670027 5:69038194-69038216 ACTTTGTGCTAGAGGAGAACAGG + Intergenic
992952515 5:81874403-81874425 AGTTGGGATTACAGGATTACAGG - Intergenic
995518024 5:112973682-112973704 AGTTGAGGTAACAGGAGAACAGG - Intergenic
995538725 5:113163498-113163520 ACTAAGGGTTACAGGAAAAAAGG - Intronic
997867453 5:137477280-137477302 TCTTGGGGTGACAGGATTACAGG + Intronic
998258990 5:140613639-140613661 ACTTGGTGAGACAGGAGAAAAGG - Intergenic
1000041255 5:157486704-157486726 ACTTGGGGTTACAGGAGAACAGG - Intronic
1002043462 5:176530023-176530045 ACTGGAGGTTCCAGGAGAACAGG + Intronic
1004577109 6:16907786-16907808 AATTGGGGTTGCAGGGGAAAAGG + Intergenic
1004992008 6:21149100-21149122 ACAAGGAGTTACAGTAGAACAGG + Intronic
1005870960 6:29974433-29974455 ACTTGGGGTAAAGTGAGAACAGG + Intergenic
1006600026 6:35219132-35219154 ACTTGGGGTTCCAGGAAACTGGG - Intronic
1006947006 6:37791367-37791389 CCCTGGGTCTACAGGAGAACAGG - Intergenic
1007766912 6:44166069-44166091 TCTTGGGGGACCAGGAGAACAGG + Intronic
1012312602 6:97746115-97746137 AATTGGAGTTACAGAAGAAGAGG - Intergenic
1013004462 6:106059108-106059130 TATTGGGGTTACAGAATAACAGG - Intergenic
1014764530 6:125391410-125391432 ACTTGGGATAAAAGGAGAACAGG + Intergenic
1017791984 6:157808177-157808199 ACTTGAGATTACAATAGAACTGG + Intronic
1022125070 7:27348587-27348609 TCATGGTGTTACAGGAGACCTGG + Intergenic
1023369264 7:39496731-39496753 ACTTGGAGAGACAGGAGAAGTGG - Intergenic
1024445201 7:49469651-49469673 ACTTTTAGTTACATGAGAACAGG - Intergenic
1024818021 7:53293992-53294014 CCTTGAGGTTACAGGAAAATTGG - Intergenic
1025121095 7:56304032-56304054 ACTAGGAGTTAAAAGAGAACAGG - Intergenic
1029704805 7:102270613-102270635 GCTTGGGGTGATAGGAGCACAGG - Intronic
1033636548 7:143217507-143217529 ACTTGGGGCAACAGGAAAAGTGG - Intergenic
1033876583 7:145826863-145826885 ACTTGGGATTGTATGAGAACAGG - Intergenic
1034461135 7:151198661-151198683 ACCTGGGGGTAGAGGAGAAAAGG + Intronic
1039582420 8:38677804-38677826 ATTTGGGGTTACAGCTGAAAGGG + Intergenic
1041240390 8:55844373-55844395 ACTTGGTGTTTAAGGAGAGCGGG - Intergenic
1042442524 8:68844809-68844831 ACTTGAGGTTACAAAAGAATGGG - Intergenic
1049176489 8:141195743-141195765 ACCTGAGGTTACATGAGGACTGG - Exonic
1050163724 9:2743411-2743433 TCTTGGGATTACAGAAGAATGGG + Intronic
1050783029 9:9363137-9363159 ACTTGTGGTCACATTAGAACTGG + Intronic
1055040811 9:71869668-71869690 ACTTGATGTTAGAGAAGAACAGG - Intronic
1061819522 9:133218531-133218553 ACCTGGGCATCCAGGAGAACAGG + Intergenic
1062241165 9:135539658-135539680 ACCTGGGCATCCAGGAGAACAGG - Intergenic
1189618013 X:42804633-42804655 TCTTGAGGTTACAGAAGAATAGG + Intergenic
1189734478 X:44055774-44055796 GCTTGGGGTTGGAGGAGAAAAGG - Intergenic
1190101265 X:47524358-47524380 ACTTGGGGTGACTTGATAACGGG - Intergenic
1190449651 X:50565914-50565936 ACATCAGGTTACAAGAGAACAGG - Intergenic
1191858237 X:65644805-65644827 GCTTGGGATTACTGGAGAGCAGG + Intronic
1195272901 X:103250776-103250798 ACTTGGGGTTGAAGCAGAAGGGG - Intergenic
1195311207 X:103633526-103633548 ACTTGGGGTTGAAGCAGAAGGGG + Intergenic
1196130810 X:112153941-112153963 AATGGGGGTTGCAGAAGAACAGG - Intergenic
1199608796 X:149596652-149596674 TCTTTGGGGTACAGGGGAACGGG - Exonic
1199630326 X:149772708-149772730 TCTTTGGGGTACAGGGGAACGGG + Intergenic
1201274938 Y:12287863-12287885 AGTCGGGGGTGCAGGAGAACTGG + Intergenic