ID: 1000042040

View in Genome Browser
Species Human (GRCh38)
Location 5:157491938-157491960
Sequence CAGTGCAATGGGAGGGATGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 346
Summary {0: 1, 1: 0, 2: 2, 3: 32, 4: 311}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000042034_1000042040 16 Left 1000042034 5:157491899-157491921 CCCTCAAAGCAAATCTGCACGGA 0: 1
1: 0
2: 0
3: 7
4: 91
Right 1000042040 5:157491938-157491960 CAGTGCAATGGGAGGGATGCTGG 0: 1
1: 0
2: 2
3: 32
4: 311
1000042031_1000042040 26 Left 1000042031 5:157491889-157491911 CCTGCACTGCCCCTCAAAGCAAA 0: 1
1: 0
2: 0
3: 11
4: 207
Right 1000042040 5:157491938-157491960 CAGTGCAATGGGAGGGATGCTGG 0: 1
1: 0
2: 2
3: 32
4: 311
1000042032_1000042040 17 Left 1000042032 5:157491898-157491920 CCCCTCAAAGCAAATCTGCACGG 0: 1
1: 0
2: 0
3: 3
4: 98
Right 1000042040 5:157491938-157491960 CAGTGCAATGGGAGGGATGCTGG 0: 1
1: 0
2: 2
3: 32
4: 311
1000042035_1000042040 15 Left 1000042035 5:157491900-157491922 CCTCAAAGCAAATCTGCACGGAG 0: 1
1: 0
2: 2
3: 18
4: 108
Right 1000042040 5:157491938-157491960 CAGTGCAATGGGAGGGATGCTGG 0: 1
1: 0
2: 2
3: 32
4: 311

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000042040 Original CRISPR CAGTGCAATGGGAGGGATGC TGG Intronic
901352734 1:8612254-8612276 CAGTGTAATGAGAGAGCTGCTGG - Intronic
902114770 1:14112400-14112422 AAGAGGAGTGGGAGGGATGCAGG - Intergenic
902200173 1:14827403-14827425 CAGGGCAAAGGGTGGGAAGCAGG - Intronic
902236286 1:15059587-15059609 CAATGCAGTGGGAGAGAAGCAGG + Intronic
902337307 1:15760907-15760929 CAGTGGGACGGGAGGGAAGCCGG + Intronic
902481028 1:16711965-16711987 CTGTGCAGTGGGAGGGAGGGAGG - Intergenic
902667040 1:17946724-17946746 CAGAGAGATGGGAGGGATGGGGG + Intergenic
904037680 1:27567594-27567616 CAGTGCAGTGCAAGGGAGGCAGG - Intronic
904078790 1:27858959-27858981 CAGAGAAATGGGAGGGCGGCTGG - Intergenic
905498997 1:38420925-38420947 CAGAGCAGCGGGAGGGATGTGGG + Intergenic
905930501 1:41783514-41783536 CAGGGTGATGGGAGGGATGCGGG + Intronic
906282427 1:44563408-44563430 CAGGGCCAAGGGAGGGAAGCGGG - Intronic
906680100 1:47720445-47720467 CAGTGCAGTGGGAGGGACAGGGG - Intergenic
908352733 1:63302180-63302202 AAGTGCAAGGGTAGTGATGCTGG - Intergenic
911086111 1:93978703-93978725 CAGAGCAGAGGGAGGGGTGCTGG - Intergenic
911954561 1:104217894-104217916 CAGTGCAGTGGGGGGGCTGAAGG + Intergenic
912312949 1:108641310-108641332 CAGTGCAGTGGGGGGGCTGAAGG + Intronic
912440168 1:109691675-109691697 GAGTGCAGTGAGAGGGCTGCAGG + Intronic
913387253 1:118272109-118272131 CATGGCAATGGGATGGCTGCTGG + Intergenic
914030904 1:143959178-143959200 CAGTGCAAATGGAAGAATGCGGG + Intronic
914158546 1:145108782-145108804 CAGTGCAAATGGAAGAATGCGGG - Intronic
914342702 1:146773899-146773921 CAGTGTGATGGGAGGGAAGCAGG - Intergenic
915267837 1:154731592-154731614 CAGTGCAAAGGGAGGGCCGCAGG - Intronic
918146361 1:181759430-181759452 GAGTGCAAGGGGAAGGATTCTGG + Intronic
920215396 1:204358928-204358950 CAGTGGAAGGGGAGGGAAGCGGG - Intronic
920259389 1:204678661-204678683 AGGTGCAAGGGCAGGGATGCAGG - Intronic
920466371 1:206190072-206190094 CAGTGCAAATGGAAGAATGCGGG + Intronic
920632815 1:207669319-207669341 CAGAGCATGGGGAGGGCTGCGGG - Intronic
920883216 1:209899250-209899272 CAGTGCAGTGGGGGGGCTGAAGG + Intergenic
920951290 1:210573913-210573935 CAGGGAAATGAGAGGGATGAAGG + Intronic
921790593 1:219286038-219286060 CAGTGCATTTGGAGGGCTGCAGG + Intergenic
921912078 1:220560498-220560520 AAGTGCAAGGGCAGTGATGCTGG - Intronic
923324878 1:232871893-232871915 CAGTGCAGTGGGGGGGCTGAAGG + Intergenic
923501194 1:234566191-234566213 CAGTACAAAGGGAAGGATTCTGG - Intergenic
924743147 1:246809427-246809449 CATTGAAGTGGGAGGGAGGCAGG + Intergenic
924793001 1:247270125-247270147 AACTGGAATGGGTGGGATGCAGG + Intergenic
1064790420 10:18951727-18951749 CAGTGCAGTGGGCGGGCTGAAGG + Intergenic
1065225176 10:23536238-23536260 CAGGGCAGTGGCAGGGATTCTGG + Intergenic
1065276995 10:24095516-24095538 CAATGCAGTGGGAGGAAGGCTGG - Intronic
1065407730 10:25388552-25388574 CAGGGCAATGGGTGAGATGAAGG - Intronic
1067529249 10:47058623-47058645 CAGTGCATTTGGAGGGAAACTGG - Intergenic
1068817705 10:61336224-61336246 AAGTGCAAAAGGAGTGATGCTGG + Intergenic
1069834111 10:71297833-71297855 CAGTCCAAGGGGAGGGAGGCTGG + Intronic
1070639918 10:78160835-78160857 CAGTGACATGGGAGGGATAGTGG - Intergenic
1072081889 10:92041039-92041061 GGGTGCAATGGGAGGGAAGTGGG + Intergenic
1073073815 10:100810854-100810876 CAGGGCCATGGGGGGGAGGCGGG - Intronic
1073708822 10:106016433-106016455 CAGAGCAGTGGGGGGGATGTTGG + Intergenic
1074166479 10:110881468-110881490 CAGTCCAAAGGGAAGGTTGCTGG + Exonic
1074212267 10:111346488-111346510 CAGTGCAATGGGAGAAAGGTTGG - Intergenic
1074369638 10:112889572-112889594 CAGTTAAATGTGATGGATGCTGG - Intergenic
1076550182 10:131273127-131273149 CAGGGTAATGGAAGGGATGCGGG - Intronic
1077123892 11:924117-924139 CAGGGCAATGGGGGTGCTGCAGG - Intergenic
1077317844 11:1927267-1927289 CCAGGCAATGGGTGGGATGCTGG - Intronic
1077523506 11:3050266-3050288 CCGTGCAGTGGGAAGGAAGCAGG - Intronic
1079451321 11:20601773-20601795 CAGTGCCAGGTGATGGATGCGGG + Intronic
1080750693 11:35147542-35147564 CAGTCCACAGGAAGGGATGCAGG + Intronic
1081124996 11:39311739-39311761 CAGTGCAGTGGGGGGGCTGAAGG - Intergenic
1081604179 11:44517064-44517086 CAGTGGAGTGGGAGTGATGGGGG + Intergenic
1081793131 11:45803132-45803154 TAGGGAAATGGGAGGGCTGCAGG - Intergenic
1082006603 11:47422805-47422827 GAGTACTTTGGGAGGGATGCGGG - Intronic
1082777604 11:57259444-57259466 CAGGGCACTGGGATGAATGCAGG + Intergenic
1082847541 11:57738776-57738798 TAGTGCAAAGGGAGGGATGGTGG + Intronic
1083193345 11:61068328-61068350 CGGTGGATTGGGAGGGATGGGGG - Intergenic
1083384851 11:62300036-62300058 CACGGCAATGGGAGGGAAGGCGG - Intergenic
1084589553 11:70082703-70082725 AATTGCAGTGGGAGGGATGTGGG - Intronic
1085033366 11:73286044-73286066 CCCTGCAATGGGAAGTATGCAGG + Intronic
1085351861 11:75802811-75802833 CAGAGCAGTGGGAGGAGTGCTGG + Intergenic
1086983537 11:93224624-93224646 CAGGACAGTGGTAGGGATGCTGG - Intergenic
1087354473 11:97076511-97076533 CAGTGCAGTGGGGGGGCTGAAGG - Intergenic
1088061217 11:105653293-105653315 GAGTGCAAGGGTAGTGATGCTGG - Intronic
1089373642 11:117978937-117978959 CAGTGCAGTGGGGGGGCTGAAGG + Intergenic
1089681525 11:120121523-120121545 CAGTGCTTGGGCAGGGATGCCGG + Intronic
1090458009 11:126866480-126866502 CAGTGAAATAGGAGGGGGGCCGG + Intronic
1090963653 11:131579718-131579740 CAATGCAAGGGCAGAGATGCAGG + Intronic
1091483908 12:865170-865192 AAGAGCACTGGGAGAGATGCGGG - Intronic
1092188396 12:6498947-6498969 AAGTGCAAGGGTAGTGATGCTGG - Intronic
1092221329 12:6715947-6715969 CAGTGCAGTGGGGGGGCTGAAGG - Intergenic
1092617224 12:10226081-10226103 CAGTGCAGTGGGGGGGCTGAAGG + Intergenic
1093289520 12:17303190-17303212 CAGTCCAAGGGGAGGTATACAGG + Intergenic
1093588965 12:20876533-20876555 AAGAGCAATGGGATGGATGCTGG + Intronic
1093602419 12:21044647-21044669 AAGAGCAATGGGATGGATGATGG + Intronic
1094589373 12:31806238-31806260 CAGTGCAGTGGGGGGGCTGAAGG + Intergenic
1096557243 12:52410920-52410942 CAGAGGAGTGGGAGGGAAGCAGG - Intergenic
1096809108 12:54158502-54158524 CAGTGCAATGGGATGCCTGGTGG - Intergenic
1097519631 12:60650490-60650512 CAGTTCTATGGGAGAGATTCTGG + Intergenic
1098580118 12:72089680-72089702 GAGTGCAATGGGTGGGAAGGTGG - Intronic
1098588601 12:72184951-72184973 CAGTGCAGTGGGGGGGCTGAAGG - Intronic
1099872024 12:88361529-88361551 AAGTGCAAGGGTAGTGATGCTGG - Intergenic
1101287394 12:103329102-103329124 CAGAGCTATGGCAGGGACGCAGG + Intronic
1101287398 12:103329133-103329155 CAGAGCTATGGCAGGGACGCAGG + Intronic
1101732845 12:107440737-107440759 CAGGGAAATGGAAGGGAGGCAGG + Intronic
1103274103 12:119697255-119697277 CAGCCCAGTGGGAGAGATGCTGG - Intronic
1104800585 12:131552899-131552921 CAGTGCAATCAGAGTGAGGCTGG + Intergenic
1113173172 13:107529655-107529677 CATTGCAATGGGAGCCAAGCTGG - Intronic
1113506569 13:110821070-110821092 CAGTGCAGTGGGGGGGCTGAAGG - Intergenic
1113781638 13:112980777-112980799 CAGTGGACTCGGAGGGAGGCTGG - Intronic
1113913271 13:113854783-113854805 CTGTTGGATGGGAGGGATGCTGG + Intronic
1114182170 14:20376375-20376397 CAGCTCCATGGGAGGGATGCAGG + Intronic
1114654512 14:24308026-24308048 AAGTCCAAGGGGAGGGATGAGGG + Exonic
1116656152 14:47656275-47656297 CAGTGCAATAGGAAAGATGTAGG - Intronic
1119764890 14:77182019-77182041 CCTTGCATTGGGAGGGATGGGGG + Intronic
1121171112 14:91855138-91855160 CAGTGGAACGGCAGGGATGGAGG + Intronic
1121313482 14:92947453-92947475 CACTGCACTGGGAAGGATTCTGG + Intronic
1122849418 14:104519401-104519423 CAGTCCAAAGGGAGTGATGCAGG + Intronic
1123133353 14:106006196-106006218 CAGTGCAAGGGCTGGGCTGCAGG - Intergenic
1123135744 14:106026254-106026276 CAGTGCAAGGGCTGGGCTGCAGG - Intergenic
1123165094 14:106318926-106318948 CAGTGCAAGGGCTGGGCTGCAGG - Intergenic
1123583381 15:21736641-21736663 CAGTGCAAGGGCTGGGCTGCAGG - Intergenic
1123620031 15:22179238-22179260 CAGTGCAAGGGCTGGGCTGCAGG - Intergenic
1126314582 15:47356628-47356650 CTGTGAAATGAGAGGGATGAAGG - Intronic
1128080765 15:64855536-64855558 AAGTGCAAGGGGAGGAAAGCTGG - Intronic
1128338729 15:66805072-66805094 CAGTGCAAAGGCAGGGATACTGG + Intergenic
1128544503 15:68558067-68558089 CAGTGGAATGGCAGGGAGGGTGG + Intergenic
1129318668 15:74761797-74761819 CAGTGCAATGGGGCGGAGGGGGG + Intergenic
1129433280 15:75517061-75517083 AAGTGAAATGGGAGGAATTCGGG - Intronic
1131086186 15:89577364-89577386 AAGTGCAATGAGAAGGATGAAGG - Intronic
1131934527 15:97488624-97488646 CAGTGCAATGGTAAGCATGCAGG - Intergenic
1132610995 16:816314-816336 CAGTGCCAGGGGAGGGACACGGG - Intergenic
1132868535 16:2105271-2105293 CAGTGCCCTGGCAGGCATGCGGG + Intronic
1135083893 16:19459244-19459266 CAGGGCCATGTGAGGGAGGCAGG + Intronic
1135362317 16:21825527-21825549 GAGTGCAATGGCAGTGATGTCGG - Intergenic
1135705465 16:24671041-24671063 CAGTGCTGTCGGAGGGTTGCTGG - Intergenic
1136050315 16:27645590-27645612 CAGTGCATTTGGAGGCAGGCTGG + Intronic
1136720567 16:32316595-32316617 CAGTACTTTGGGAGGGAGGCGGG + Intergenic
1136788243 16:32947934-32947956 AAATGAAATGGGTGGGATGCAGG - Intergenic
1136838947 16:33522877-33522899 CAGTACTTTGGGAGGGAGGCGGG + Intergenic
1136843959 16:33561049-33561071 CAGTACTTTGGGAGGGAGGCGGG + Intergenic
1137048079 16:35686763-35686785 CATTCTAATGGGAGAGATGCTGG - Intergenic
1137569480 16:49556034-49556056 AGGTACAATGGGAGGGAAGCAGG - Intronic
1139028275 16:62846770-62846792 TAGTGAAATGGGAAGGATGCAGG - Intergenic
1139991282 16:70941429-70941451 CAGTGTGATGGGAGGGAAGCAGG + Intronic
1140042255 16:71415931-71415953 AGGTGAATTGGGAGGGATGCTGG - Intergenic
1140760088 16:78102157-78102179 CAGTGCTTCGGGAGGGAGGCTGG - Intronic
1142124271 16:88402424-88402446 GAGTGCAGTGGGAGGGAGGATGG + Intergenic
1203005865 16_KI270728v1_random:201175-201197 CAGTACTTTGGGAGGGAGGCGGG - Intergenic
1203149110 16_KI270728v1_random:1823164-1823186 CAGTACTTTGGGAGGGAGGCGGG + Intergenic
1203154124 16_KI270728v1_random:1861348-1861370 CAGTACTTTGGGAGGGAGGCGGG + Intergenic
1142549667 17:731164-731186 CCGTGAAATGAGAGGGAGGCTGG - Intergenic
1147770751 17:42866455-42866477 CAGTACAAGGGGAGGCATGAAGG + Intergenic
1148159284 17:45441051-45441073 CACACCAATGGGAGGGATCCAGG + Intronic
1149406546 17:56357507-56357529 CAGTAGAAAGGGAGAGATGCAGG - Intronic
1149606289 17:57927316-57927338 CAGGGCAATGGCAGGGCTTCTGG - Intronic
1149867481 17:60158734-60158756 CAGTGCAAGGGTAGGGATTTGGG - Intronic
1151032600 17:70758483-70758505 CAGAGCCATGGGTGGGATGTGGG + Intergenic
1151127359 17:71859550-71859572 GAGTGCAATGGCAGCGATTCTGG + Intergenic
1151326646 17:73383834-73383856 CAGAGGAATGGGTGGGATGGGGG - Intronic
1151380748 17:73724214-73724236 CAGTGCTAGGAGAGGGAGGCTGG + Intergenic
1152181601 17:78825597-78825619 CTGTGAGATGGGAGGAATGCAGG - Intronic
1152184260 17:78844281-78844303 CAGTACCAGGGGAGCGATGCAGG - Intergenic
1152519539 17:80847130-80847152 CCGTGCAAGGGAAGGGCTGCCGG - Intronic
1153552411 18:6275269-6275291 CAGAGAAACGGGAGGAATGCAGG + Intronic
1154158572 18:11962793-11962815 CAGTGCAAGAGGAGGGATAAAGG - Intergenic
1156226889 18:35118303-35118325 CAGTGGATTGGGAGGGAAACCGG + Intronic
1161065653 19:2236107-2236129 CAGTGCCAGGGGCGGGAGGCCGG - Intronic
1161768253 19:6218340-6218362 CAGGGTACTGGGAGGGAGGCTGG + Intronic
1162959761 19:14118584-14118606 CTGTGCAATGGGAGTGATGATGG - Intergenic
1163223874 19:15940965-15940987 CCCAGCAATGGGAGGGATGGGGG + Intergenic
1163334246 19:16660913-16660935 CCGTGCAAGGCGAGGGAGGCTGG - Intergenic
1163779710 19:19239922-19239944 CAGAGGAATGGGAGGGAGGAAGG - Intronic
1164821007 19:31251266-31251288 CTCTGAAATGGGAAGGATGCAGG - Intergenic
1165722352 19:38088602-38088624 CTGTGCAATCTGTGGGATGCTGG - Intronic
1166544862 19:43627895-43627917 CAGTGCAATGGAATGAATGAGGG - Intronic
1166695159 19:44847849-44847871 CATAGCAATGGGAGGGACGGGGG - Intronic
1167156317 19:47741434-47741456 CAGGGCCATGGGAGGGGGGCCGG - Exonic
925933701 2:8732883-8732905 CAGAGCAAAGTGAGAGATGCAGG - Intronic
926020128 2:9487282-9487304 CAGGGCAATGGGAGGGAGACTGG + Intronic
926992985 2:18699802-18699824 AAGTGCAAGGGTAGTGATGCTGG + Intergenic
927158518 2:20236326-20236348 CAGTGCCCTGGGATGGAGGCTGG + Intergenic
927168614 2:20350415-20350437 CAATGCAGGGGGAGGGGTGCCGG - Intronic
928058031 2:28078349-28078371 AAGTGCAAGAGTAGGGATGCTGG + Intronic
928069709 2:28202374-28202396 CAGGGGCATGGGAGGGAAGCAGG - Intronic
928353203 2:30582208-30582230 CATTGCCATGGGAGGGGGGCAGG - Intronic
930979762 2:57509510-57509532 CACTGCAATGGCACAGATGCAGG - Intergenic
932304965 2:70695498-70695520 AAGTGCAGTGGGAGGGAGGAGGG - Intronic
932449646 2:71801451-71801473 AGCTGCAATGGGAGGGATTCAGG + Intergenic
932486405 2:72086801-72086823 CAGTGCAGTGGGGGGGCTGAAGG - Intergenic
934092470 2:88564826-88564848 CAGTGTAATGGGATGGACCCAGG + Intronic
934320260 2:91965579-91965601 CAGTACCTTGGGAGGGAGGCGGG - Intergenic
936462747 2:112724400-112724422 CAGGTCAAAGGGAGGGGTGCTGG + Intronic
936795343 2:116196536-116196558 CAGCGGAATGGGAGGGGGGCAGG - Intergenic
937321005 2:120960767-120960789 CAGTGCCCTGGGAGGAACGCAGG - Intronic
937349065 2:121148549-121148571 CAGTGCAATGGGAGTGATCTTGG - Intergenic
938232763 2:129675673-129675695 CGGTGACATGGGAGGCATGCAGG + Intergenic
942243879 2:173989813-173989835 CAGAGCACTGGGAGGGAGGGGGG - Intergenic
942496586 2:176546639-176546661 CTGTGCAATGGGAGACTTGCTGG + Intergenic
944034569 2:195278211-195278233 CAGTGGACTGGGAGAGAGGCAGG - Intergenic
944505051 2:200402474-200402496 CAGGGGAATGGGAGGGAAGGTGG - Intronic
945925505 2:215799240-215799262 CAGTGCAAGAGTAGTGATGCTGG - Intergenic
946378282 2:219327466-219327488 AAGGGCAATGGGAAGGGTGCTGG + Exonic
947087211 2:226466754-226466776 CAGTGAAGTGGGAGGAATACTGG - Intergenic
947160866 2:227212701-227212723 AAGTGCAATGGGAGGGACCCAGG - Intronic
948159781 2:235814252-235814274 CGGTGAAATGGGAGGCAGGCAGG - Intronic
948280811 2:236746928-236746950 CAGTGCCATGGCAAGGCTGCAGG + Intergenic
948890671 2:240905626-240905648 TGGGGCAATGGGAGGGAAGCAGG - Intergenic
1169353210 20:4886873-4886895 CAGCTCAAAGGGAAGGATGCTGG - Intronic
1170345031 20:15376292-15376314 CAGTGCAAGGAGAAGGAAGCAGG + Intronic
1170829905 20:19830971-19830993 CTGTGGAATGGGAAGGAAGCAGG - Intergenic
1171223581 20:23421769-23421791 CATGGCAATGGGATGGATGAAGG + Intergenic
1172882116 20:38208866-38208888 CAGTGCACAGAGAGGGAAGCAGG + Intergenic
1173003610 20:39123199-39123221 GAGTGTAAGGGGAGGGAGGCAGG + Intergenic
1173817653 20:46000162-46000184 CAGTGGAAGGGGCTGGATGCTGG - Intergenic
1174524329 20:51159192-51159214 CAGTGAAAGGGGCTGGATGCAGG - Intergenic
1174883652 20:54307810-54307832 CTGTGAAGAGGGAGGGATGCAGG - Intergenic
1175154827 20:56963615-56963637 CAGTCCAATGGGAGAGAAGATGG + Intergenic
1175273253 20:57749488-57749510 CAGTGCAAGGGCAGGAAGGCAGG + Intergenic
1178898232 21:36578148-36578170 CATTGCAAGGGCATGGATGCAGG - Intergenic
1179343201 21:40531847-40531869 CAGAGCATTGAGTGGGATGCTGG - Intronic
1179924090 21:44522852-44522874 CAGGCCCATGGCAGGGATGCTGG - Intronic
1180036473 21:45252815-45252837 GTGTGCAATGGGAGGGGTGTCGG + Intergenic
1180308508 22:11149624-11149646 CAGTACTTTGGGAGGGAGGCGGG - Intergenic
1180546985 22:16511437-16511459 CAGTACTTTGGGAGGGAGGCGGG - Intergenic
1181093089 22:20487614-20487636 CAATGGAAGTGGAGGGATGCAGG + Intronic
1181101133 22:20540078-20540100 CAGTGGAAGTGGAGGGATGCAGG + Intronic
1183250247 22:36725293-36725315 CTGTGAAATGGAAGGGATGCTGG + Intergenic
1183250541 22:36727092-36727114 CTGTCAAATGGAAGGGATGCTGG - Intergenic
1184248642 22:43248238-43248260 GAGTACAGTGGGAGGGAAGCTGG + Intronic
1184951875 22:47848926-47848948 CAATGCAGTGGGAGAGATGCAGG - Intergenic
1185019582 22:48366430-48366452 CATTGCAATGGCAAGGAAGCTGG - Intergenic
1185309416 22:50145907-50145929 CAGTGCTCAGGGAGGGAGGCAGG + Intronic
950725430 3:14913999-14914021 CAGGGTAATCAGAGGGATGCAGG - Intronic
950966350 3:17149320-17149342 ACGTGCAATGGGAGGAATGCAGG - Intergenic
952323736 3:32301632-32301654 CAGTGCAATGTCACCGATGCCGG - Intronic
953616806 3:44497964-44497986 CAGTGTAATGGGAGGGAGACGGG + Intergenic
960165669 3:114398478-114398500 CAGGGCAATGGCAGTGATGGCGG - Intronic
962343707 3:134605124-134605146 CAGAGCAAGGGGAGAGATGGGGG - Intronic
962398816 3:135039866-135039888 CAGTGCAGTGGGGGGGCTGAAGG + Intronic
962454490 3:135552728-135552750 CAGAGCAATGGGAGACAAGCAGG + Intergenic
962649890 3:137477822-137477844 CAGGGCAATGGGAGGGGAGGGGG + Intergenic
962746630 3:138401944-138401966 CAATGCAATGGGGGAGATGGGGG - Intronic
964139290 3:153378785-153378807 CAGTGCAGTGGGGGGGCTGAAGG + Intergenic
965915248 3:173837826-173837848 CAGTGCAGTTGGAGGGAAGTGGG + Intronic
966715249 3:183007754-183007776 CAGTGGAATCGGGGGGCTGCAGG + Intergenic
967869053 3:194214540-194214562 CAGTGCATAGGGAGGGCAGCTGG + Intergenic
968772299 4:2515090-2515112 CAGTGGAAGAGGAGGCATGCCGG - Exonic
969107993 4:4822483-4822505 CAGTGCAGCGGGAGAAATGCAGG + Intergenic
969137773 4:5044428-5044450 CAGGGCAAAGGGAGGGAAGGAGG - Intergenic
969681231 4:8644594-8644616 CAGAGCCATGGGAGGGAGCCTGG - Intergenic
970855320 4:20644492-20644514 GAATGCAATGGGAGGAGTGCGGG + Intergenic
974003403 4:56532576-56532598 CAGAGAAATGGGGGTGATGCTGG - Intronic
974220352 4:58961361-58961383 CAGTGCTATGGGAGGGCTGGAGG - Intergenic
976387642 4:84480022-84480044 CAGTGCCAGGTGAGGGGTGCAGG + Intergenic
984611767 4:181848460-181848482 CAGTGCAATATGAAGGATGATGG + Intergenic
985913100 5:2898039-2898061 CTGTGGATTGGCAGGGATGCAGG - Intergenic
985964873 5:3332217-3332239 CAGAGCCATGGCAGGGCTGCTGG - Intergenic
986224655 5:5801502-5801524 CTGTGCAGTGGGATGGAGGCTGG + Intergenic
989251297 5:39319047-39319069 CTGTGCTATGGGAGGGTTGGGGG - Intronic
990807658 5:59684171-59684193 CAGTGCTCAGGGAGGGATGGAGG - Intronic
991037115 5:62138671-62138693 CAATGCACAGGGAGGGGTGCAGG - Intergenic
993430533 5:87827168-87827190 CAGTTCAAGGTGAGGGAGGCAGG + Intergenic
996409662 5:123144255-123144277 CTATGCAATGGGAAGGATCCTGG + Intronic
997860447 5:137410846-137410868 CAATGCACTGGGAGGGAGGAGGG + Intronic
998063604 5:139138532-139138554 CAGTGTAATAGGAAGAATGCAGG + Intronic
1000042040 5:157491938-157491960 CAGTGCAATGGGAGGGATGCTGG + Intronic
1001436803 5:171705512-171705534 CAGGGCAGTGGGAGGCATGGAGG + Intergenic
1001754555 5:174158626-174158648 CCGTGCAATGGAAAGGGTGCTGG + Intronic
1004522708 6:16377444-16377466 CACAGCAATGGGAAGGATGAGGG - Intronic
1004543708 6:16575866-16575888 CAGTACAATAGAAGGGAAGCAGG - Intronic
1005759739 6:28957757-28957779 CAGTGCAGTGGGGGGGCTGAAGG - Intergenic
1006826452 6:36939419-36939441 CCGGGCAATGGGAGCCATGCTGG + Intergenic
1009955096 6:70444154-70444176 TAGTGCTTTGGGAGGGAAGCAGG + Intronic
1013143636 6:107364693-107364715 CAGTGCAGTGGGGGGGCTGAAGG + Intronic
1013526887 6:110982325-110982347 CCGTGGGATGGGAGGGATGTGGG + Intronic
1014136620 6:117896813-117896835 CAGTGAATTGGGAGGAAAGCTGG + Intergenic
1015412656 6:132912408-132912430 AAGTGGCATGGGAGTGATGCAGG - Intergenic
1017036318 6:150270332-150270354 CTGTGTAAGGGGAGGCATGCTGG + Intergenic
1017108713 6:150912530-150912552 CACTGCAGTGGGAGGGATGCAGG - Intronic
1017298920 6:152834256-152834278 CAGTGCAGTGGGAGGGCTGAAGG - Intergenic
1018064577 6:160116347-160116369 CAGTGGAAAAGGAAGGATGCAGG + Intergenic
1018371308 6:163170661-163170683 CAGTGCAAGGTGGGGGAAGCTGG - Intronic
1018529654 6:164749395-164749417 CAGAGAAATGGGAGGGCTGTGGG + Intergenic
1019712424 7:2523748-2523770 CTGAGCAGTGGGAGGGGTGCTGG + Intronic
1019795379 7:3044298-3044320 CACTGCAATGGGAGGGGAACGGG + Intergenic
1020720584 7:11739848-11739870 AAGTGCAATGCCAAGGATGCAGG + Intronic
1021501758 7:21339501-21339523 CAGGGCAATGGGAGGGATGGGGG - Intergenic
1022135483 7:27443722-27443744 AAGTGCAATCGTAGTGATGCTGG - Intergenic
1022372287 7:29783253-29783275 CAGTGATATGGGAGGGAGACAGG + Intergenic
1022469845 7:30675331-30675353 GAGTGCACAGGGAAGGATGCTGG + Intronic
1022644178 7:32215547-32215569 GAGACCAATGGGAGGGAGGCAGG + Intronic
1023348575 7:39296584-39296606 CTGTGCAGTGGGAGGGAGTCAGG - Intronic
1023617848 7:42038586-42038608 CAGTGCACAGGGAGGGGTCCTGG - Intronic
1023673449 7:42604418-42604440 GAGTGCCATGACAGGGATGCAGG - Intergenic
1026187158 7:68090862-68090884 CAGTGCAGTGGGGGGGCTGAAGG + Intergenic
1026567551 7:71501919-71501941 TAGTGAAATGGGAGGGAAGAAGG - Intronic
1026578740 7:71596531-71596553 TAGTGAAATGGGAGGGAAGAAGG + Intronic
1028547968 7:92026061-92026083 CATTGCAATGGAAGGAATGTTGG + Intronic
1029156009 7:98518517-98518539 CAGTGGAATGGTGGGGAGGCGGG - Intergenic
1030297049 7:107939692-107939714 CAGTAAAATGGGAGGAATGCTGG - Intronic
1033243424 7:139699734-139699756 AATGTCAATGGGAGGGATGCAGG - Intronic
1033472695 7:141664091-141664113 GAATGACATGGGAGGGATGCAGG + Intronic
1034057278 7:148048487-148048509 CAGTCCAATGGCAGGGAGGCTGG + Intronic
1034923246 7:155100676-155100698 CAGCCCACTGCGAGGGATGCAGG - Intergenic
1035180032 7:157082625-157082647 CAGTGTGATTGAAGGGATGCAGG + Intergenic
1035221601 7:157409714-157409736 CAGAGCAGAGGGAGGGAAGCTGG - Intronic
1035975608 8:4307346-4307368 CAGAGCAATGGGAGAGGTGGTGG + Intronic
1037791009 8:21941672-21941694 TAAGGAAATGGGAGGGATGCTGG + Intronic
1037971410 8:23174248-23174270 CAGTGCAGTGGGGGGGCTGAAGG + Intergenic
1038409829 8:27349516-27349538 CAGTGCATTGGCAGGAATGCGGG + Intronic
1039617751 8:38969791-38969813 CAGTGCCATGGGAGGGAGGGAGG + Exonic
1039881481 8:41627952-41627974 CAGTGCAGTGGGATGGGTGTGGG - Intergenic
1040386966 8:46920492-46920514 CGGTGACAAGGGAGGGATGCGGG + Intergenic
1040532749 8:48278837-48278859 CAGTGCCATAACAGGGATGCAGG - Intergenic
1040890298 8:52310178-52310200 CAGTTTAATGGGAGTGATGATGG + Intronic
1041806937 8:61861808-61861830 CAGTGCAAGAGTAGTGATGCTGG - Intergenic
1041918862 8:63161901-63161923 CAGTGCAGTGGGGGGGCTGAAGG - Intergenic
1042120620 8:65484068-65484090 CAGTTGGATGGGAGGGATGGAGG + Intergenic
1044472948 8:92592805-92592827 CAGTGCAAAGGGGGAGATGCAGG - Intergenic
1045289971 8:100824780-100824802 AAGTGAAGTGGGAGGGATTCCGG - Intergenic
1047878452 8:129166691-129166713 AAGAGGGATGGGAGGGATGCAGG - Intergenic
1048344495 8:133566521-133566543 CCCTGCAATGCGGGGGATGCAGG - Intronic
1048991706 8:139764284-139764306 CAGTGAAATGGGGTGGCTGCAGG + Intronic
1049211914 8:141390869-141390891 CCATGCAATGGGAAGGATGGAGG + Intergenic
1049585987 8:143432598-143432620 CAGTGCGATGGGCGGGAGGGGGG - Intergenic
1049603673 8:143519384-143519406 TAGTGCAATGGGAGGGACCTGGG + Intronic
1050150877 9:2618373-2618395 CAAGGCAATGGAAGGGATTCAGG - Intergenic
1052467176 9:28843606-28843628 CAGAGAAAGGGGAGGGATGGAGG + Intergenic
1053902226 9:42806433-42806455 CAGAGCCATGTGAAGGATGCCGG + Intergenic
1054532751 9:66199087-66199109 CAGAGCCATGTGAAGGATGCCGG - Intergenic
1057073667 9:92122601-92122623 CCTTGGAATGGGAGGCATGCTGG - Intergenic
1057152386 9:92807664-92807686 CAGCGCCTTGGGTGGGATGCTGG - Intergenic
1057628708 9:96701366-96701388 CAGTGCAGTGGGGGGGCTGAAGG + Intergenic
1060182762 9:121545670-121545692 CAGTGCGAGGGGAGGGCCGCTGG + Intergenic
1060439859 9:123628313-123628335 CAGTGACATGGGAGGGAGGAAGG + Intronic
1060586082 9:124786909-124786931 CAGTGCTATGGCAGGGAGGAAGG - Intronic
1060870953 9:127039768-127039790 CAGTGAAATGGGAGGGAAAGGGG + Intronic
1061089536 9:128419300-128419322 CACTGCAAGGGGAGGGCTGAAGG - Intronic
1061943246 9:133894181-133894203 AAGTGCACTGTGAGGGATCCAGG + Intronic
1186047440 X:5551917-5551939 CAGTGATATGGGAGGGGAGCAGG + Intergenic
1186393696 X:9186373-9186395 CAGTGAGAAGGGAGGGAAGCAGG + Intergenic
1186511236 X:10131221-10131243 GAATGCAATGGCAGGGAAGCGGG + Intronic
1187267237 X:17746797-17746819 CAGTGCATGGGGAGGCAGGCTGG - Intronic
1187706225 X:22012255-22012277 CAGGGCACTAGGAGGGCTGCTGG + Intergenic
1189288695 X:39870250-39870272 CACTGCACTGGAAGGGATGAGGG + Intergenic
1190107387 X:47570085-47570107 CAGTGCAAAGGAGGGGATGTGGG - Intronic
1190455981 X:50628186-50628208 CACTGCAGTTGGAGGCATGCTGG - Intronic
1193437392 X:81492579-81492601 CAGTAGAATGGTAGGGATGAAGG - Intergenic
1195236087 X:102900072-102900094 CAGGGGAAAGGGAGGGATGGAGG - Intergenic
1196546975 X:116974442-116974464 CACTGGAATGGCTGGGATGCAGG - Intergenic
1196662588 X:118283153-118283175 CAGTGCAGTGGGGGGGCTGAAGG + Intergenic
1196729008 X:118922434-118922456 CAGTGCAGTGGGGGGGCTGAAGG + Intergenic
1197199472 X:123735210-123735232 CAGAGGAGTGGGAGGGAAGCAGG - Intergenic
1198831886 X:140759605-140759627 CAGTGACTTGGGAGGGAGGCAGG - Intergenic
1199025699 X:142934964-142934986 CTTTGCAATGGGAGTCATGCTGG - Intergenic
1199818399 X:151420737-151420759 AAGAGCCATGGGAGGGATTCGGG + Intergenic
1199852453 X:151735449-151735471 AAGTGAAATGGGAGGGATGGGGG - Intergenic
1200822860 Y:7605975-7605997 CAGTCCAGTGGGAAGGATGTAGG + Intergenic
1202237195 Y:22725114-22725136 CAGTCCAGTGGGAAGGATGTAGG - Intergenic