ID: 1000042280

View in Genome Browser
Species Human (GRCh38)
Location 5:157493614-157493636
Sequence GGGTGGGGCAGTGTGAATTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 199
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 181}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000042280 Original CRISPR GGGTGGGGCAGTGTGAATTA AGG (reversed) Intronic
900644850 1:3704381-3704403 GGGTGGGGGTGTGTGAAATGTGG - Intronic
900654433 1:3748069-3748091 GGGTGGGCCAGTGTGAAGTGAGG - Intergenic
901817480 1:11803137-11803159 GGGTGGGGCAGGGAGCATCAGGG + Exonic
902531617 1:17094297-17094319 GGGTGGGGCAGAGTGAGCGAGGG - Intronic
903139685 1:21332072-21332094 GGGTGGGGGAGGGTGCAGTAAGG - Intronic
903353509 1:22732220-22732242 GGGTGGGGCTCTATGAATTCTGG + Intronic
903691040 1:25173854-25173876 GGTTGGGGTAGGGTTAATTAGGG - Intergenic
906895278 1:49764042-49764064 GGGTTGCGCAGCGTGAAGTATGG - Intronic
907870554 1:58438954-58438976 GGGCGAGGCAGTGTGACGTAGGG + Intronic
911849808 1:102803904-102803926 GGTTGGGGCAGTGAGAACTTGGG + Intergenic
915033076 1:152900954-152900976 GGCTGGGGCTGAGTGAATGAGGG - Intergenic
917199181 1:172497494-172497516 GGGTGGAGCAGTGGGAATTGGGG - Intergenic
917575873 1:176321330-176321352 GAGTGGGGCAGTGGGATTTAAGG + Intergenic
918622336 1:186619922-186619944 GGGTGGAGTGGTGTGAAATAAGG - Intergenic
919833094 1:201555791-201555813 GGGAGGGGCAGTGGGGATTCGGG + Intergenic
919844484 1:201632768-201632790 GGGTGGGGCAGTGTGGAGTTTGG + Intronic
921339615 1:214121725-214121747 GGGTAGGGGAGGGTGAATGATGG + Intergenic
922188335 1:223295665-223295687 GGGTGGGGCTGTGGGGATAAAGG + Intronic
922978065 1:229801554-229801576 GGGTGGGGCAGAGTGGATGGAGG + Intergenic
923207030 1:231769002-231769024 GGCTGGAGCAGTGTAAATGAGGG + Intronic
1067415388 10:46098154-46098176 GGGCAGGGGAGTGTGAAGTAGGG + Intergenic
1067455011 10:46412971-46412993 GGGTGGGCCAGTGAGGATTTGGG - Intergenic
1067632193 10:47971663-47971685 GGGTGGGCCAGTGAGGATTTGGG + Intergenic
1071187745 10:83062913-83062935 GGTTGGGGCAGTGAAAATTTTGG - Intergenic
1074189048 10:111119996-111120018 GGTTGGGGCAGAGTGAAGCAAGG + Intergenic
1076700963 10:132272463-132272485 GGCTGTGGCAGTGTGAGCTAGGG - Intronic
1081963571 11:47155869-47155891 GGGTGCAGCTGTGTGAATTGGGG - Intronic
1091386122 12:96168-96190 GGGTGGGACAATTTGAAATATGG + Intronic
1091791256 12:3273476-3273498 GGGTGAGGCAGGGTGACTCAGGG - Intronic
1091992197 12:4964393-4964415 GGCTGAAGCAGTGTGAATGAGGG - Intergenic
1092494668 12:8980734-8980756 GGGTGCAGCAGTGTGAGTTCTGG + Intronic
1095951090 12:47782416-47782438 GGGTGGGGGAGTGGGAATACAGG - Exonic
1096107229 12:49003494-49003516 GGGGGGGGCACTGTTAAATATGG - Intronic
1098509701 12:71297312-71297334 GTGGGGGCCAGTGTGCATTAAGG - Intronic
1098705125 12:73677581-73677603 GAGTTGGTTAGTGTGAATTATGG + Intergenic
1103799306 12:123526935-123526957 GGCTGGGGCAGGGAGAATAATGG + Intronic
1105702220 13:22942182-22942204 GGGTGGGCCAGTGGGAAACATGG - Intergenic
1105837767 13:24225587-24225609 GAGTGGGGCAGTGGGACTGAAGG - Intronic
1105854839 13:24363967-24363989 GGGTGGGCCAGTGGGAAACATGG - Intergenic
1105888118 13:24659941-24659963 GGGTGGTACAGAGGGAATTATGG - Intergenic
1108953486 13:56120058-56120080 AGGTGGGGCAGAGGTAATTATGG - Intergenic
1109256963 13:60095430-60095452 GGGTGGGTCAATGTAAATTAAGG + Intronic
1113511225 13:110856182-110856204 GGATGGTGAAGTGTGAATTTTGG + Intergenic
1113958407 13:114112049-114112071 GGGAGGGACAGTGTCACTTACGG - Intronic
1116311955 14:43338610-43338632 TGGTGGGGCAGTGTCAGTGAGGG - Intergenic
1120541288 14:85754048-85754070 GGGTGGGGGAGTGGCAATTCTGG - Intergenic
1120813730 14:88831303-88831325 GGGTGGGCCAATGCAAATTAGGG - Intronic
1121320130 14:92987314-92987336 GGACGGGGCAGTGTGAATGTGGG + Intronic
1121626582 14:95389631-95389653 GGGTGGATCAGAGTGAAGTAAGG - Intergenic
1122359586 14:101151503-101151525 GGGTGGGGCAGAGTGAGTCATGG + Intergenic
1122680385 14:103456419-103456441 GGCTGGAGAAGTGTGAATGAGGG - Intronic
1124241314 15:28030375-28030397 GGGTGGGGCAGAGACAACTAAGG + Intronic
1125397746 15:39268992-39269014 GGGTGGGGCAGGGGTAATTTGGG - Intergenic
1126135349 15:45384690-45384712 GGGTGGGGAAGTGTCAATTTAGG - Intronic
1128114776 15:65098301-65098323 GGGAAGGACAGTGTGAATAAAGG - Intronic
1128237794 15:66079526-66079548 GGGGGGGGGGGTGTGAATGAAGG - Intronic
1128345206 15:66848940-66848962 GGGAGGGCCAGTGTGACTGATGG - Intergenic
1128451239 15:67806987-67807009 GGGTGGGGCATTGAGAATGGAGG + Exonic
1129351774 15:74959483-74959505 GGATGGGGTGCTGTGAATTAGGG + Intronic
1130063734 15:80588079-80588101 GGTTGGGGCAGTGAGAATGGAGG + Intronic
1133030932 16:3010836-3010858 GGGTGGGACATTGTGTATAAAGG - Intergenic
1133476268 16:6124914-6124936 TGGTGAGGCACTGTGAAATATGG - Intronic
1134812285 16:17178007-17178029 AGGTGGTGCAGGGTGAATTACGG + Intronic
1137406408 16:48192875-48192897 GGGCAGGGCAGTGGGAATGAAGG - Intronic
1137563767 16:49520673-49520695 GGGTGGGGCAGTGGGAGGCAAGG - Intronic
1138280864 16:55771339-55771361 GGGAGGGGCAGTGGGAGTCAAGG - Intergenic
1138287664 16:55822523-55822545 GGGAGGGGCAGTGGGAGTCAAGG + Intronic
1138449443 16:57084657-57084679 GGGTGGCCCTGTGTGAAGTATGG - Intergenic
1138495110 16:57404101-57404123 GGCTGGGGCAGAGTGAACCAGGG + Intergenic
1139238412 16:65364492-65364514 GGCTGGGGAAGTGTGAGTTATGG - Intergenic
1142604498 17:1074015-1074037 GGGTGGAGCTGTGTGATTCAGGG - Intronic
1143158300 17:4852869-4852891 TGGTGGGGGAGTGTGATTTGTGG + Intronic
1143532342 17:7512703-7512725 AGGTGGGGCAGGGAGAATTGGGG + Intronic
1144914088 17:18707785-18707807 CGGTGGGGCAGTGTGGAGGAGGG + Intronic
1149948785 17:60961700-60961722 GTGTGGGGCAGGGTGAATGAAGG - Intronic
1150935844 17:69634530-69634552 GGGTGGGGCAATGTGATATATGG + Intergenic
1151191153 17:72399129-72399151 AGGTGGGGCTGTGTCCATTAGGG - Intergenic
1151743609 17:76000454-76000476 GGGTGGGGCTGTCGGATTTATGG - Exonic
1151948218 17:77330891-77330913 GGGCTGGGCAGGGTGAATTGCGG - Intronic
1152208899 17:78992354-78992376 GGGGAGGGCACTGTGAATGATGG + Exonic
1152366006 17:79856808-79856830 GAGTGGGACAGTGTGGATTTTGG + Intergenic
1156904068 18:42333640-42333662 GGGTTGGGCAATGTGATTTCTGG - Intergenic
1157476892 18:48029339-48029361 GGGTCGGGCAGCGGGAAGTAGGG + Exonic
1157731277 18:50006577-50006599 GGGGGGGCCAGTGTGAACTGGGG - Intronic
1162117783 19:8442019-8442041 GGCTGGAGCAGTGTGATTGAGGG + Intronic
1164432044 19:28197259-28197281 AGGTGGGGCAGTGTGGACAACGG - Intergenic
1164509458 19:28885586-28885608 GGGTGGGACCCTATGAATTAGGG - Intergenic
1164714221 19:30379696-30379718 GGGTGGTGCAGGGTGGATGAAGG + Intronic
1165382610 19:35491896-35491918 GGGTGGGGCAAGGTGGGTTAGGG - Intronic
1165854814 19:38873268-38873290 GTATGGGGCAGAGTGAATGAGGG + Intronic
1166051699 19:40264537-40264559 GGCTGGAGCAGTGTGAGCTAGGG - Intronic
1166148759 19:40855456-40855478 GGGTGGGGCTGTGGGAATGTTGG + Intronic
1166152899 19:40887241-40887263 GGGTGGGGCTGTGGGAATGTTGG + Intronic
1166251577 19:41575174-41575196 GGGTGGGGCAGGGGGAAGTGGGG + Intronic
1166589979 19:43988487-43988509 GGGTGATGCAGTTTGAATGAAGG - Exonic
1167163793 19:47784462-47784484 GGGTGGGGTGGTGTGGATTCCGG - Exonic
1167380999 19:49138095-49138117 TGGTGGGGCAATGGGAATTCTGG - Intronic
1168615629 19:57834731-57834753 GGCTGAGGCAGGGAGAATTAGGG + Intronic
1168621155 19:57880716-57880738 GGCTGAGGCAGGGAGAATTAGGG - Intronic
927636339 2:24819951-24819973 TGGTGGGGCAGTGTGACAGAGGG + Exonic
927921175 2:26972698-26972720 GGGTGGAGGGTTGTGAATTAAGG + Intronic
928166606 2:28976927-28976949 GGGTGGGGCAGTGGTATTTTGGG + Intronic
928407934 2:31029048-31029070 GGGTGGGGCAGTTTGAGAAATGG - Intronic
930221528 2:48751117-48751139 GGGTGGGGCAGTGGGCATCAGGG + Intronic
930886595 2:56333412-56333434 GGCTGGTGCAGAGTGAATGAGGG + Intronic
931639565 2:64369928-64369950 CGGTGGGGCAGTGGGGATGACGG - Intergenic
935332485 2:101987207-101987229 GGGTTGTGCAGTGTGAGTGAGGG + Intergenic
938032705 2:128009104-128009126 GGGTGTGGGAGTGTGAAAGAAGG - Intronic
938040492 2:128071829-128071851 TGGTGGGCCAGTGTGGATTCTGG + Intergenic
940266164 2:151841184-151841206 GGGTGCGGCAGGATTAATTAAGG + Intronic
941598581 2:167509709-167509731 GGCTGGAGCAGTGTGAGTTAGGG + Intergenic
944688629 2:202139879-202139901 CCGTGGGGCTGTGTGAATTTGGG - Intronic
945556343 2:211281040-211281062 GCTTGGGGCAGTGAGAATGAGGG + Intergenic
945743163 2:213688083-213688105 AGGTGGGGCAGTTTGAACTTGGG + Intronic
946033158 2:216721166-216721188 GGGTGGGTCAGTGTGATGAATGG + Intergenic
946433000 2:219635521-219635543 GGATGGGGGAGTGTGTATTGGGG - Intronic
948205380 2:236160378-236160400 GGTGGGGGCAGTGTGAACTGCGG + Intergenic
948242331 2:236447888-236447910 GGGTGGGGGAGGGTGGATTCAGG + Intronic
1168901495 20:1368896-1368918 GGGTTGGGCAGGGTGAAGGAGGG - Intronic
1169116742 20:3071356-3071378 GGGTGGGACAGGGAGAATTTGGG - Intergenic
1169189475 20:3648822-3648844 GGGGGGGCCTGTGGGAATTAAGG - Exonic
1169340506 20:4792834-4792856 GGGTGGGGCAGGGGGAGTTCCGG + Intronic
1173247583 20:41347306-41347328 CAGTGGGGCAGTGTGAGTGAGGG + Intronic
1173750131 20:45469947-45469969 GGCTGGGGAAGTGGGAATTCCGG + Intronic
1174364008 20:50045315-50045337 GGGTGGGGGTGTGTGACCTAGGG - Intergenic
1174993898 20:55544115-55544137 AGGTGGGGAAGGGTGAATTGTGG + Intergenic
1178681355 21:34674977-34674999 GGGTGGGACAGTCTGAGCTACGG + Intronic
1179175005 21:39001855-39001877 AGGTGGGGCAGTGTGCATAGGGG - Intergenic
1179251158 21:39672883-39672905 GGGTGGGGCAGTGTCCATTGAGG + Exonic
1181572273 22:23773985-23774007 GGGTGGGGTAGAGTGAATGGGGG + Intronic
1181836453 22:25613984-25614006 GGGTGGGGCGATGATAATTATGG - Intronic
1185049057 22:48544211-48544233 GGGTGGGGCTCTGTGAAGTTAGG - Intronic
950185965 3:10945760-10945782 GGGTGGGGGAGAGTGGATAAGGG - Intergenic
951222819 3:20086593-20086615 GGGTGGGGCAGTGTCAAGACAGG - Intronic
952114799 3:30165982-30166004 GTTTGGGGCAGTATGAATAAAGG - Intergenic
952146282 3:30536448-30536470 GGGAGGTGCAGTGGGAAGTAAGG + Intergenic
953154720 3:40359297-40359319 GGGTGGGGAAGTGATTATTATGG - Intergenic
953905934 3:46868288-46868310 GGGTGGGGCACTGTGATTCCAGG + Intronic
964560159 3:157986248-157986270 GGCTAGGGCAGTCTGAATTCTGG - Intergenic
966952249 3:184831875-184831897 AGGTGGGGCAGTATGAAGAATGG - Intronic
969695049 4:8729560-8729582 GGCTGGGGCAGTGTGAGTGGGGG + Intergenic
969791023 4:9494035-9494057 GGGTGGGGCAGGGTTCTTTATGG + Intergenic
973642102 4:52913638-52913660 GGGTGGGGCGGTGTGGTTTCAGG - Intronic
973699630 4:53523834-53523856 TGGTGGGACAGTGTGAATGGAGG - Intronic
973788756 4:54359163-54359185 GAATGGGGCAGTGGGAATGAGGG + Intergenic
974744385 4:66051866-66051888 AGGTGGAGCAATGTGAATTCTGG - Intergenic
974836422 4:67256658-67256680 GGGTGGGTCAATGCAAATTAAGG + Intergenic
975654628 4:76629316-76629338 GGCTGGGGCAGAGTGAGTGAGGG + Intronic
977630771 4:99239924-99239946 GGCTGGGGGAGTTTGTATTAAGG - Intergenic
977937666 4:102826220-102826242 GGGTGGAGGAGAGTGACTTAAGG - Intronic
980731660 4:136832146-136832168 GGGTGGGACAATGTGAAATTTGG - Intergenic
980880630 4:138706795-138706817 CTGTGGGGCAGTGTGAAGAAGGG + Intergenic
981477416 4:145200751-145200773 GGGTGGGGGAGTGTGAAAGGGGG + Intergenic
981811658 4:148782445-148782467 GGGTGGGGCAGAGAGAGTAAGGG - Intergenic
983734403 4:171039785-171039807 GGTTTTGGCAGTGTGGATTAAGG - Intergenic
986781960 5:11074934-11074956 GGGGTGGGCAGGGGGAATTAGGG - Intronic
988168564 5:27625950-27625972 GGGTATGGCAGGCTGAATTATGG + Intergenic
989314262 5:40059068-40059090 GGTTTGGGCAGTGTGAAATTTGG - Intergenic
991629638 5:68643653-68643675 GGGTGGGGGAGTGTGGATGTGGG - Intergenic
991962810 5:72062686-72062708 GGCTGGGGCAGAGTGAGTGAAGG + Intergenic
993301567 5:86217329-86217351 GGCTGAGGCAGGGTGAATTCAGG + Intergenic
993598332 5:89888021-89888043 GTGTGGAGCAGAGTGAATAAGGG + Intergenic
993693730 5:91035201-91035223 GAGGGAGGCAGTGAGAATTAAGG - Intronic
993709731 5:91212980-91213002 GGGTGTGGCCATGTGACTTATGG - Intergenic
998978596 5:147675649-147675671 GCGTGGGGAATAGTGAATTATGG - Intronic
1000042280 5:157493614-157493636 GGGTGGGGCAGTGTGAATTAAGG - Intronic
1002908380 6:1469299-1469321 GCGTGGGGAAGTGTGAATACTGG - Intergenic
1003622808 6:7716607-7716629 GGGAGGGGCAGTGTGTGTTGAGG + Intergenic
1007084237 6:39131998-39132020 TGTTGGGGCAGTGAAAATTATGG + Intergenic
1007813925 6:44506597-44506619 GGGTGGGGGAGTGAGAAGGAGGG + Intergenic
1014810798 6:125883515-125883537 GGGTGGGAGAGTGTGAAATGGGG - Intronic
1016298179 6:142599087-142599109 GGGTGGGGAGGGGAGAATTAGGG - Intergenic
1017992234 6:159501075-159501097 GGGGGAGGCAGTGTGAAGTGGGG - Intergenic
1019049145 6:169169983-169170005 GTGTGGGGCAGTGTGGACTGTGG - Intergenic
1019973746 7:4563432-4563454 GGGTGGGGCACTGTGAGATGTGG - Intergenic
1022194994 7:28056166-28056188 GGGTGGGGGAATATGATTTAGGG + Intronic
1022516861 7:30980494-30980516 TGGTGGGGCTGTGGGACTTAGGG - Intronic
1029112892 7:98222638-98222660 GGGTGGGGCTGTGTGACTCCCGG - Intronic
1033483265 7:141762470-141762492 GGGAGGGGCAGTGTGGATTCAGG + Intronic
1034821251 7:154218258-154218280 GGGTGAGGTTGTGTGGATTAGGG - Intronic
1035782427 8:2239136-2239158 TGGAAGGGGAGTGTGAATTAGGG + Intergenic
1035783250 8:2244933-2244955 GGGTGGGGTGGTGTGATTTATGG + Intergenic
1035808874 8:2474653-2474675 GGGTGGGGTGGTGTGATTTATGG - Intergenic
1035809692 8:2480452-2480474 TGGAAGGGGAGTGTGAATTAGGG - Intergenic
1038605777 8:29002293-29002315 GGGTGGGGCAGTGGGAGAGAGGG + Intronic
1038682598 8:29683202-29683224 GGGTAGGGCAGTGGGGATCAGGG - Intergenic
1041484438 8:58359071-58359093 GGGTGGGGTAGTGTATAATATGG - Intergenic
1045915436 8:107464653-107464675 AGTTGGGGCACTGAGAATTAAGG - Intronic
1047888340 8:129278429-129278451 GAGTGGGGCAGTGTGGTTTGGGG + Intergenic
1060163688 9:121390640-121390662 GGGTGGGGGAGTATCAAATAAGG - Intergenic
1061058285 9:128236507-128236529 GGGTGGGGAAGAGTGAATGGAGG - Intronic
1061353652 9:130086455-130086477 TGGTGGGGCAGTGTCATTTCAGG + Exonic
1061596907 9:131636710-131636732 GGGTGGGCCAGAGTGACTCAGGG + Intronic
1185477138 X:422048-422070 GGGTGGGGCAGGGGGATTTCTGG + Intergenic
1187474895 X:19602063-19602085 GGGTGGGGCAGATGGAATGAAGG - Intronic
1190586876 X:51953809-51953831 AGATGGGGCAATGTGAATGAAGG - Intergenic
1190827530 X:54031385-54031407 GGGTGGGGCGGTGGGAATGGTGG - Intronic
1190914135 X:54797772-54797794 GTGTGGGGCAGTGGGAAATGAGG + Intronic
1201920200 Y:19225924-19225946 GGGTGAGGTAGTGTGGATTCAGG - Intergenic