ID: 1000043448

View in Genome Browser
Species Human (GRCh38)
Location 5:157502255-157502277
Sequence CAGTGAGTGTGGAGGGTACA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 330
Summary {0: 1, 1: 0, 2: 1, 3: 28, 4: 300}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000043448_1000043453 -5 Left 1000043448 5:157502255-157502277 CCGTGTACCCTCCACACTCACTG 0: 1
1: 0
2: 1
3: 28
4: 300
Right 1000043453 5:157502273-157502295 CACTGTGAAGATCAGAAGGAAGG 0: 1
1: 0
2: 2
3: 36
4: 307
1000043448_1000043452 -9 Left 1000043448 5:157502255-157502277 CCGTGTACCCTCCACACTCACTG 0: 1
1: 0
2: 1
3: 28
4: 300
Right 1000043452 5:157502269-157502291 CACTCACTGTGAAGATCAGAAGG 0: 1
1: 0
2: 0
3: 28
4: 262

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000043448 Original CRISPR CAGTGAGTGTGGAGGGTACA CGG (reversed) Intronic
900433242 1:2612675-2612697 CAGTGAGGGTGGAGGGGCTAGGG - Intronic
900634908 1:3658161-3658183 CAGGGACCGTGGAGGGGACATGG + Intronic
900799240 1:4727294-4727316 CAGGGAGTGTGGAGGGCTCCCGG + Intronic
901259325 1:7860107-7860129 CAGGGACTGTGTAGGGTACTAGG + Intergenic
902218531 1:14950071-14950093 GGGTGGGTGTGGAGGGTGCAGGG - Intronic
903358714 1:22763590-22763612 GAGTGAGTGTGTGGGGTTCATGG + Intronic
903756360 1:25664133-25664155 CAGAGCGTGTGGAGGGCAGATGG - Intronic
904289390 1:29474471-29474493 CAGTGAATGGGGAAGGCACACGG - Intergenic
905821102 1:40992090-40992112 TAGGGAGAGTGGAGGGTACTAGG - Intronic
906674165 1:47681235-47681257 CAGTGAGTGTGTTGGGTGGACGG + Intergenic
907251695 1:53143777-53143799 CAGTGAGGGTGGGAGGTAAAGGG + Intergenic
908453581 1:64280391-64280413 CAGTGACTTTGAAGGGGACAAGG + Intergenic
909749601 1:79142578-79142600 CAGAGAGGGTAAAGGGTACAAGG + Intergenic
910066360 1:83156604-83156626 CAGAGAGTGTGCCGGGGACATGG + Intergenic
911230636 1:95357646-95357668 CCATGAGTCTGGAGGGGACATGG + Intergenic
911481675 1:98450411-98450433 CAGTGAGTGTATTGGCTACAGGG - Intergenic
915070706 1:153263394-153263416 CGGTGAGTCTGGAGAGGACAAGG + Intergenic
915319071 1:155046269-155046291 AGGTGAGGGTGGAGGGTAAAAGG + Intronic
915321694 1:155060093-155060115 CAGGGAGAGTGAAGGGTTCAAGG - Intronic
917363922 1:174208219-174208241 CAGTAAGGTTGGAGGATACAAGG - Intronic
920106146 1:203555092-203555114 CGGTCAGTGAGAAGGGTACAGGG + Intergenic
920226947 1:204446137-204446159 CAGTGAGCCTGGTGGGCACACGG + Exonic
920761401 1:208786813-208786835 CAGTGAGTGGGGAGGGTTATAGG - Intergenic
921269827 1:213457502-213457524 CAGTGAGTGTGAAAGGGACAAGG - Intergenic
923381447 1:233423534-233423556 CAGTGTGTGCAGAGGTTACATGG + Intergenic
924872370 1:248062559-248062581 CAGAGGGTGGGAAGGGTACAGGG + Intronic
1063002544 10:1938236-1938258 CAGTGAGTATACATGGTACAGGG + Intergenic
1063345757 10:5311083-5311105 CAATGAGCTTGGAGGGTTCATGG - Intergenic
1064110695 10:12536167-12536189 CAGTCTGGGTGGTGGGTACATGG - Intronic
1064347885 10:14549040-14549062 CATTGAGGCTGGAGAGTACAGGG - Intronic
1064386034 10:14892520-14892542 CAGTGATTGAGTAGGGAACATGG - Intronic
1064825717 10:19397245-19397267 TAGAGAATGTGGAGGGGACAGGG - Intronic
1068027336 10:51662881-51662903 CAGTAAGTGTGGAGTGTATTGGG + Intronic
1068931058 10:62590754-62590776 CAGTGACAGTTGAGGGAACAAGG - Intronic
1070476789 10:76836687-76836709 CAGTAAGTGTGGCTGGTTCAGGG + Intergenic
1070726332 10:78793724-78793746 CAGTGAGTGTGGCAGGAAGAAGG - Intergenic
1071275351 10:84049103-84049125 CAGTGGGGGTGGAGGGTAGAAGG + Intergenic
1071358044 10:84818057-84818079 CAGTGGGAGTGCAGGGTGCAGGG + Intergenic
1072727289 10:97822354-97822376 CACAGAGTGTGGCGGGTACGGGG - Intergenic
1072783490 10:98265856-98265878 CAGTGTGGGTGGAGGGAAAAGGG - Intronic
1073284439 10:102379210-102379232 CAGTGAGTGGGGAGGGGGAAAGG + Intronic
1074187785 10:111112144-111112166 CTGTGAGTGTGGAGGGTCCTTGG + Intergenic
1074764752 10:116692252-116692274 CAGTGAATGTGGGAGGTACCTGG + Intronic
1074953573 10:118365039-118365061 CAGAGTGTGTATAGGGTACAAGG - Intergenic
1076067249 10:127458612-127458634 CAGTGAGAATCCAGGGTACAGGG + Intergenic
1076497008 10:130904015-130904037 CAGTCAGGGTGCAGGGCACATGG + Intergenic
1078173439 11:8949032-8949054 GTGTGTGTGTTGAGGGTACAGGG - Intronic
1079184061 11:18220786-18220808 CAGTGGGTCTGGAGGGTCCTGGG + Intronic
1079205816 11:18413405-18413427 CAGAGAGGGAGGAGGGCACAAGG - Intronic
1079509439 11:21194199-21194221 TAGAGAGTCTGGAGGCTACAGGG - Intronic
1079614811 11:22479206-22479228 CACTCAGTATGGAGGGTAGAAGG + Intergenic
1081207172 11:40289937-40289959 CATTAAGTGTGGAGGGCACAGGG + Intronic
1082975755 11:59070205-59070227 CAGGGAGTGTGGAGGAAGCAAGG - Intergenic
1083728519 11:64640997-64641019 CAGGAAGTGATGAGGGTACAAGG + Intronic
1084090786 11:66878352-66878374 GAGTGAGTGTGGTGTGGACAGGG - Intronic
1084729745 11:71065597-71065619 CAGTGAGTGGGGACGTTGCAGGG + Intronic
1086185308 11:84006857-84006879 CAGTCAGTGTTGGGGGAACAAGG - Intronic
1087613498 11:100461929-100461951 CACTGGGTGTGGAGGGTATGAGG + Intergenic
1089087196 11:115830692-115830714 CAGTGAGTGTACAGTGTCCAGGG - Intergenic
1089087201 11:115830732-115830754 CAGTGAGTGTACAGTGTCCAGGG - Intergenic
1089087245 11:115831504-115831526 CAGTGAGTGTACAGTGTCCAGGG - Intergenic
1089087263 11:115831704-115831726 CAGTGAGTGTACAGTGTCCAGGG - Intergenic
1090260307 11:125314563-125314585 CAGTCAGTGGGGAGGGGACAAGG + Intronic
1090874456 11:130776425-130776447 CTCTGTGTGTTGAGGGTACAAGG + Intergenic
1091830135 12:3543559-3543581 CAGTGAGTGTTGAGGAAACGTGG + Intronic
1092498308 12:9020405-9020427 TAATGAGTGTTGAGGGGACAGGG - Intergenic
1092814441 12:12300756-12300778 CAGTGTGTGTGGAGAGTACTGGG + Intergenic
1094272069 12:28628036-28628058 CACTGAGTGTGAAGGACACAAGG + Intergenic
1094842902 12:34349388-34349410 GGGTGGGTGTGGAGGGGACAAGG + Intergenic
1095948714 12:47768956-47768978 CAGTGAGGGTCTAGGGGACAGGG + Intronic
1096582918 12:52600038-52600060 CAGTGAGTGGAGAGGAGACAGGG - Intronic
1096650750 12:53060915-53060937 CAGGAAGTGTGGTGGGCACAGGG - Exonic
1096683832 12:53274755-53274777 CAGTGAGTGTGTATGGTGGAAGG - Intronic
1098715932 12:73828596-73828618 CAGTGAGTCTAGTGGGTTCACGG + Intergenic
1101789108 12:107911917-107911939 CAGTGAGTGAGGAGGGACCCTGG - Intergenic
1102162011 12:110777017-110777039 CAGTGAGTGCAGAGATTACAAGG + Intergenic
1103915388 12:124373238-124373260 CAGTGCGTGTGCAGGGGACCCGG + Intronic
1104925478 12:132311816-132311838 CAGGGAGTGTGGAGGGTGGAGGG + Intronic
1105213656 13:18272365-18272387 CTGTGTGTGGGGAGGGCACAGGG - Intergenic
1105213956 13:18273711-18273733 CAGTGAGTTTTGAGGGTGGAGGG - Intergenic
1107114043 13:36727211-36727233 CTGTTATTGTGGAGGGAACAGGG - Intergenic
1110294935 13:73853405-73853427 GAGTGAGTGAGGAGGAGACAGGG + Intronic
1110434320 13:75462514-75462536 CTCTGAGGGTGGAGGGTAGAGGG + Intronic
1110614478 13:77525917-77525939 TTGTGAGTGGGGAGGGAACAAGG + Intergenic
1113567105 13:111325692-111325714 CGGTGGGTGTGGAGGGAAAATGG + Intronic
1113939757 13:114012451-114012473 GAGTGTGTGTGGACGGTGCATGG - Intronic
1113940824 13:114017867-114017889 GAGTGAGTGGGGAGGGGAAACGG - Intronic
1114339319 14:21726641-21726663 CAGTGTGTCTGTAGGGCACATGG + Intergenic
1115368743 14:32587939-32587961 CAGTGAGTATCAGGGGTACATGG + Intronic
1115744193 14:36419072-36419094 CAGTCACTGTGGAGGTTAGAAGG + Intergenic
1117838421 14:59831833-59831855 CAGAGAGTGAGGGGGGAACAAGG - Intronic
1118371123 14:65137893-65137915 CAGTGAGTGGGGATGGGCCACGG - Intergenic
1119082951 14:71713753-71713775 CAATGAGGGTGCAGGGAACAGGG - Intronic
1119770863 14:77219924-77219946 CAGGGAGTGGGGAGGGAGCAGGG + Intronic
1120844361 14:89112940-89112962 CACAGAGTGTGGTGGGTGCACGG - Intergenic
1123184831 14:106506916-106506938 CACTGAATGAGGAGGTTACAGGG - Intergenic
1123185459 14:106512392-106512414 CTGAGAGTGTGGTGGGTGCACGG - Intergenic
1123469159 15:20537373-20537395 CAGTGAATGTGGAAGGGACAGGG + Intronic
1123648901 15:22463325-22463347 CAGTGGATGTGGAAGGGACAGGG - Intronic
1123682408 15:22772108-22772130 CAGTAAGGGTGGAAGGCACAGGG + Intergenic
1123729435 15:23132360-23132382 CAGTGGATGTGGAAGGGACAGGG + Intronic
1123747603 15:23329842-23329864 CAGTGGATGTGGAAGGGACAGGG + Intergenic
1123805247 15:23864580-23864602 AAGTGTGTGTGGAGGGTAGTGGG - Intergenic
1124279965 15:28353693-28353715 CAGTGGATGTGGAAGGGACAGGG + Intergenic
1124302734 15:28557918-28557940 CAGTGGATGTGGAAGGGACAGGG - Intergenic
1124693616 15:31845709-31845731 CAGAGTGGGTAGAGGGTACAGGG - Intronic
1125321108 15:38490015-38490037 TAGTGAGGAAGGAGGGTACATGG + Exonic
1125359452 15:38850060-38850082 CATTGGGTGGGGAGGGTCCATGG - Intergenic
1125588135 15:40836682-40836704 ACATGAGGGTGGAGGGTACAGGG - Intergenic
1126544214 15:49854614-49854636 CACTGAGTGTGGAGAGGCCACGG - Intergenic
1126614849 15:50567318-50567340 CATTTAGTGGGGAGGGGACAGGG - Intronic
1127773581 15:62249102-62249124 CAGTAAGGGTGGAAGGGACAGGG + Intergenic
1127806024 15:62521284-62521306 CCGTGAGGGTGGGGGGTACAGGG + Intronic
1128122387 15:65162053-65162075 CATTGAGGGTGGAGGTTCCAGGG - Intronic
1128774798 15:70311995-70312017 CTGTGATTGAGGAGGGAACAGGG - Intergenic
1129840582 15:78740934-78740956 CAGTGAGGGTGCTGGGTACCAGG - Intergenic
1130049722 15:80473793-80473815 CAGTAACTGAGCAGGGTACAAGG - Intronic
1130165429 15:81452468-81452490 CAGTGACTGGGAAGGGTGCATGG - Intergenic
1130225091 15:82050878-82050900 CAGTGAATGAGTAGGCTACAAGG + Intergenic
1130677654 15:85967955-85967977 CACAGAATTTGGAGGGTACAGGG + Intergenic
1130847237 15:87758797-87758819 CTTTTAGTGTGAAGGGTACATGG + Intergenic
1130921306 15:88347362-88347384 TTGTGAGTCTGGAGGGAACAAGG + Intergenic
1131963638 15:97814655-97814677 AAGTGGGTTTGGAGGGTGCAAGG + Intergenic
1133215800 16:4291737-4291759 CAGAGAGAGTGGAGGGTCAAAGG + Intergenic
1133982577 16:10644434-10644456 CAGTAAGTGTGTAGGGCTCAAGG - Intronic
1135153481 16:20031391-20031413 CAGTGACTGTGGATGGTACCAGG + Intergenic
1136628924 16:31477891-31477913 CAGTGAGGGTGCAGGGAGCAAGG - Exonic
1137710864 16:50565990-50566012 CAGTGTGTGTCGGGGGCACAGGG - Intronic
1138069082 16:53972806-53972828 CAGTGTTTGTGGAGAGTGCAGGG + Intronic
1138386055 16:56636273-56636295 CAGTGTGAGTGGAGAGGACATGG + Intergenic
1139213654 16:65106280-65106302 CAGTGAGTGGGATGGGTATAGGG + Intronic
1139344790 16:66295998-66296020 CAATGAGGGTGGACAGTACAGGG + Intergenic
1140277337 16:73522524-73522546 CAGTGAGGGAGGAGGTTACTTGG + Intergenic
1143594418 17:7905988-7906010 AAGTGAGTGTGGGTGATACAGGG + Exonic
1145172325 17:20669232-20669254 CAGAGGATGTGGAAGGTACAGGG - Intergenic
1145964956 17:28910496-28910518 CATTGAGTGCAGAGCGTACAAGG + Intronic
1147583129 17:41638050-41638072 CAGTGACTGGGGAGGAGACAAGG + Intergenic
1149061928 17:52432914-52432936 CAGTGACTTTGGAGAGAACAGGG + Intergenic
1149232838 17:54555033-54555055 CAGTGAGTGGGAATGGTAGATGG + Intergenic
1151263211 17:72933220-72933242 TAGTGAGGTTGGAGGATACAGGG + Intronic
1151325897 17:73379614-73379636 CAGGGAGGGTGGAGGCTGCAGGG + Intronic
1151327812 17:73389706-73389728 CTGTGAGTGGGGAGGGGAGAGGG + Intronic
1151602824 17:75116868-75116890 CTGTGAGTGTGGTGGCTGCAGGG - Intronic
1151724247 17:75875365-75875387 CAGTGTGAGTGGAGGGGGCACGG + Intronic
1152067075 17:78117781-78117803 CAGTGAGTGGGGCGGGTGGAGGG - Exonic
1152641838 17:81452516-81452538 CAGTGTGTGTGGATGGTAGGAGG + Intronic
1154002905 18:10499380-10499402 AAGTGAGTGTGCGTGGTACAGGG + Intergenic
1154129805 18:11727125-11727147 CAGTGAGAGCAGAGGGCACAGGG - Intronic
1155767287 18:29651658-29651680 CAGAGACTGTGAAAGGTACAAGG - Intergenic
1156111593 18:33733598-33733620 CATTCAGTGTGGAGGGAATATGG - Intronic
1156365066 18:36418531-36418553 AAGTGTGTGTGGAAGGCACATGG + Intronic
1156448251 18:37252588-37252610 CAGTCAGTATGGAGGCTGCAAGG - Intronic
1159882891 18:73876352-73876374 AAGTGATGGTGGAGGGGACAGGG - Intergenic
1160145289 18:76358898-76358920 CAGAGAGGGTGTAGGTTACAGGG - Exonic
1160607898 18:80066072-80066094 GAGTGAGTGTGCAGGGTCCTGGG + Intronic
1162068234 19:8138363-8138385 CTGTGGGTGAGGAGGGGACAGGG - Intronic
1162958242 19:14111810-14111832 CAGTGGGTGGGGAGGGTGGAGGG + Intronic
1163490872 19:17616551-17616573 GAGTGTGTGTGGAGGGGGCAGGG + Intronic
1164679099 19:30122052-30122074 CGGTCAGGGTGGAGGGTGCAGGG + Intergenic
1166743640 19:45129655-45129677 GGGTGAGTGGGGAGGGCACAAGG - Intronic
1167054438 19:47100510-47100532 AAGTGAGGGTGTAGGGTACAGGG - Intronic
1167966942 19:53155771-53155793 CTGTGAGTGAGGCTGGTACATGG + Intronic
925225679 2:2182495-2182517 GAAAGAGTGTGGGGGGTACATGG - Intronic
925814633 2:7735669-7735691 CTGTGACTGGGGAGGGTACCAGG - Intergenic
925814719 2:7736463-7736485 CTGTGACTGGGGAGGGTACCAGG - Intergenic
927159008 2:20241058-20241080 CAGTCAGTGTGGAGGCCACAGGG - Intergenic
927812636 2:26188453-26188475 CTTTGAGTGTGCAGAGTACATGG + Exonic
929081854 2:38129326-38129348 CAGTGAGTGAGGAAGCTAGACGG - Intergenic
930620940 2:53643124-53643146 AAGTGAGGGTGCAGGGGACAAGG + Intronic
931239705 2:60441240-60441262 CAGTGAGTGTGCTGGGAAGACGG - Intergenic
931997472 2:67853007-67853029 GAGTGAGTGTGGCGGCTACAGGG + Intergenic
932036395 2:68251733-68251755 GAGTGAGTGTGGAGGGGAGGGGG + Intronic
934300367 2:91773038-91773060 CAGTGAGTTTTGAGGGTGGAGGG + Intergenic
934300672 2:91774381-91774403 CTGTGTGTGGGGAGGGCACAGGG + Intergenic
935351055 2:102152092-102152114 CAGTGAGCTTAGAGGGCACATGG + Intronic
936460805 2:112712691-112712713 CAGTGAGTGTGAAAGGGAGAAGG - Intergenic
937275043 2:120678940-120678962 CACTGAGAGGGGAGGGTATAAGG - Intergenic
938220784 2:129565627-129565649 CAGGGAGTGTGGAGGGGCCCTGG - Intergenic
938671293 2:133588975-133588997 CAGTGGTTGTGGAGGTCACATGG + Intergenic
938849660 2:135247850-135247872 AAGGGAGTGTGGAGGGTGGAAGG + Intronic
938894721 2:135738591-135738613 CAGTGAGTGTGAAGGTGAGAAGG - Intergenic
941034240 2:160549994-160550016 GAGTGAGTGGGGGGGGTATAAGG + Intergenic
943501439 2:188693966-188693988 CAGTCAGTGTGGAGCTCACAGGG - Intergenic
944919602 2:204397828-204397850 CAGGGAGTGGGGAGGCTATATGG + Intergenic
945694637 2:213087635-213087657 CAGGGAGTGGGGAGGGTAGAGGG - Intronic
946316207 2:218914782-218914804 CAAAGAGTGTGAAGGGTAAAAGG - Intergenic
946802994 2:223441218-223441240 TAGTGAGATTGCAGGGTACAAGG - Intergenic
948548034 2:238746344-238746366 CAGTGAGAGAGGAGGCTGCAGGG - Intergenic
1168939758 20:1698606-1698628 CAGTGTGTGTGGAGAATTCATGG - Intergenic
1170612993 20:17929388-17929410 CAGCGAGGGAGGAGGGTCCAGGG + Intergenic
1170827862 20:19811521-19811543 CAGTGGGTGTGGAGGGGACAAGG + Intergenic
1172789217 20:37490980-37491002 CAGAGAGTGTAGAGGGAAGATGG - Intergenic
1175731506 20:61357401-61357423 CAGTGTGTGTGGCGGCAACATGG - Intronic
1175896313 20:62337029-62337051 CACTGCGTGTGGAATGTACACGG - Intronic
1176195447 20:63834764-63834786 CAGTGAGGGTGGAGGGCAGGTGG - Intergenic
1179031537 21:37724555-37724577 TAGTGAGTGTGGAGGGGAGTGGG + Intronic
1179931147 21:44571875-44571897 TAGTAAGTGTGGAAGGAACAAGG + Intronic
1179942816 21:44650740-44650762 CAGTGAGGGTGGAGAGTCCAGGG + Intronic
1180119408 21:45736874-45736896 CAGTGGCTGTGGAGGAAACAGGG + Intronic
1180639978 22:17290666-17290688 CAGTGAGGGTGGAGGGTGTCGGG - Intergenic
1180836156 22:18930517-18930539 CAGTGAGTGTAGAGGGCAGTTGG + Intronic
1180868465 22:19133118-19133140 CACTGGGTGGGGAGGGCACACGG - Exonic
1181699027 22:24609517-24609539 CTGTGTGTGGGGAGGGCACAGGG + Intronic
1184502588 22:44882881-44882903 CTGTGAATTTGGAGGGCACAGGG + Exonic
1203286248 22_KI270734v1_random:155816-155838 CAGTGAGTGTAGAGGGCAGTTGG + Intergenic
949676677 3:6462668-6462690 CTGTGTGTGTGTAGGGAACATGG - Intergenic
950141815 3:10620924-10620946 CTGTGAGTGAGGAGGACACAGGG - Intronic
952694585 3:36250365-36250387 CAGTGAGTAGGGATGGGACATGG - Intergenic
952849930 3:37719545-37719567 CAGGGTGGGTGGAGGGGACATGG - Intronic
952851304 3:37732201-37732223 CAGGGTGTGGGGAGGGTACAAGG - Intronic
953230157 3:41057763-41057785 CCGTGAGTGGAGAGGGAACATGG - Intergenic
953391350 3:42535699-42535721 CAGTGAGTGGGGAGGGATGAGGG + Intronic
954609249 3:51935571-51935593 CTGTGAGTGTGGATGGGAGAGGG - Exonic
954840801 3:53509638-53509660 CAGTGAGTGTGGTGGGATCCCGG + Intronic
956033630 3:65066722-65066744 CTCTGAGGCTGGAGGGTACAGGG - Intergenic
956578030 3:70777441-70777463 CCTTGAGGGTGGAGGGTAGAAGG + Intergenic
957036379 3:75297049-75297071 CTGTGAGTGTGGAGGGAAGAAGG - Intergenic
958620666 3:96555227-96555249 CAGTGAATGTGGAGAGGATATGG - Intergenic
960622518 3:119650686-119650708 GAGTGAGTGTGGATGGAAGAGGG - Intronic
962642892 3:137406761-137406783 GAGTGAGTGTGGAGGGAGGAGGG + Intergenic
962907101 3:139813802-139813824 CAGTGAAGTTGTAGGGTACAGGG + Intergenic
963229704 3:142896594-142896616 CAGTGAGTGAGGAGAGCACAGGG - Intergenic
963878673 3:150503935-150503957 CAGTGACTGTGAAGGGTGGATGG - Intergenic
963908179 3:150791503-150791525 CTCTGTGTGTGGAGGGCACATGG - Intergenic
964544717 3:157821234-157821256 AAGTGAGTGTGCAAGGCACAAGG + Intergenic
967424986 3:189316658-189316680 CAGTGTGCGTGGTGGGGACAGGG - Intronic
967669564 3:192216810-192216832 CAGAGAGTGTGGAGCAAACACGG + Intronic
968391843 4:199253-199275 CACAGAATGTGAAGGGTACAGGG - Intergenic
968648018 4:1749497-1749519 TGGTGAGTGTGCAGGGTCCAGGG - Intergenic
968948932 4:3680242-3680264 CAGTGGGTGTGCAGGGCGCAAGG + Intergenic
969167423 4:5329186-5329208 CTGTGATGGTGGAGGGTGCAGGG - Intronic
970069505 4:12141277-12141299 AATTGAGAGTGGAGGGCACAGGG + Intergenic
971287937 4:25308215-25308237 CAGGGAGTGTGGCAGGGACAAGG + Intergenic
973605453 4:52582895-52582917 CAGTGTGTGTTGGGGGCACAGGG + Intergenic
976963959 4:91012305-91012327 CAGTGACTGGGAGGGGTACATGG + Intronic
977250843 4:94687078-94687100 TAGTGAGTGTGGGGTGTGCATGG - Intergenic
979029159 4:115618427-115618449 CAGTGTGTGTGGAGATCACATGG + Intergenic
980448109 4:132938214-132938236 CAGTGACTGGGAAGGGTAGATGG - Intergenic
983006982 4:162495185-162495207 CAGTGTTTGTCAAGGGTACAAGG + Intergenic
983238012 4:165201646-165201668 TAGGGAGTGTTGAGGGTGCAGGG + Intronic
985927981 5:3032754-3032776 CAGAGAGAGTGGAGGCCACACGG - Intergenic
986393018 5:7302638-7302660 CAGTAAGGGTGGAAGGGACAGGG + Intergenic
986725742 5:10595098-10595120 CTGTGACTGTGGAGGGTGGAGGG + Intronic
987216900 5:15747056-15747078 GAATGAGTGTGGAGGGAAAAGGG + Intronic
988912397 5:35856686-35856708 CAGTAAGTGTGGGGGCTGCAGGG + Intronic
991119250 5:62992920-62992942 CAGTGTGTGTAGAGATTACATGG + Intergenic
991548800 5:67813801-67813823 CAGTGAGTCTGAAGGCAACAGGG + Intergenic
992872761 5:81023068-81023090 TTGTGAGTGCGGAGGGTAGAGGG + Intronic
993399417 5:87430441-87430463 CATAGGGTGTGCAGGGTACAGGG + Intergenic
998152535 5:139765423-139765445 CAGTGGATGTGCAGGGTACTGGG - Intergenic
999525280 5:152398679-152398701 ATGTGAGTGTGGAAGGTAGAGGG - Intronic
999916457 5:156267982-156268004 ACGTGAGGGTGGAGGGTGCAGGG - Intronic
1000043448 5:157502255-157502277 CAGTGAGTGTGGAGGGTACACGG - Intronic
1003901600 6:10660033-10660055 CAGTAGATGTGGAGGGTGCACGG + Intergenic
1004652038 6:17619315-17619337 CAGTGATTCTTGAGGGTTCAGGG - Intronic
1004775667 6:18841564-18841586 CCGTAAGTGAGGAGGGTGCACGG + Intergenic
1006418517 6:33919317-33919339 CAGGGAGGGAGGAGGGGACAAGG - Intergenic
1006530837 6:34652313-34652335 CAGTTAGTTTGGGAGGTACATGG - Intronic
1006601994 6:35232412-35232434 CAATGAGAGTGGAGGGTAATTGG - Intronic
1007104087 6:39271542-39271564 CAGTGGGTGTTCAGGGTTCAGGG - Intergenic
1007246947 6:40469863-40469885 CAGGGTGTGTGCAGGGTAGAGGG - Intronic
1007702179 6:43771746-43771768 CAGAGAGCGTGGAGGGGGCAGGG + Intronic
1010016534 6:71110814-71110836 AGGTGAGTGTGGAGAGGACAAGG - Intergenic
1011559704 6:88601985-88602007 AAGTGAGTGTTGAGGGGAAAAGG + Intergenic
1012247043 6:96937717-96937739 CTGTGAGGATGGAGGGTAGAGGG - Intronic
1014108474 6:117593460-117593482 AAGTGAGATTGTAGGGTACAAGG - Intronic
1015563374 6:134540322-134540344 CAGTGAGTCTGGAGCCTAGAAGG + Intergenic
1018012781 6:159686968-159686990 CAGGGAATGAGGAGAGTACAGGG - Intronic
1018631751 6:165827459-165827481 CAGTGAGGGAGGAGGATACTCGG - Intronic
1018722973 6:166587905-166587927 GAGTGAGTGAGGAGGGCGCAGGG - Intronic
1019575787 7:1737053-1737075 CAGGGAGTGTGGGGTGTCCAGGG - Intronic
1020097682 7:5377712-5377734 CAGTGAGTGTGGAAGGCCCCGGG - Intronic
1020112100 7:5453051-5453073 CAGTGACTGTGAAGGGCACTGGG + Intronic
1023139909 7:37091579-37091601 CAGTGAGAGTGGAGGGGGCAGGG - Intronic
1023891815 7:44398199-44398221 CAGTCAGTGTGGAGGGACTAGGG - Intronic
1027277751 7:76578156-76578178 CAGAGAGTGTGCAGGGGACATGG - Intergenic
1027464463 7:78498328-78498350 CAGTGATTGGGGAGGGAGCATGG - Intronic
1027614444 7:80403962-80403984 CAGTGAGTGTGGAAACTACAGGG - Intronic
1030888702 7:114970655-114970677 CAGTGAGTGGGGAAGGCACTTGG + Intronic
1032394612 7:131580534-131580556 GAGTTAGTGTGGAGGATAAATGG + Intergenic
1033437484 7:141346605-141346627 CAGTGTGTGTGGAGTGTGTATGG - Intronic
1034975197 7:155444850-155444872 CAGAGTGTGTGGAGGACACAAGG + Intergenic
1035403636 7:158585234-158585256 CACTGAGTGAGGATGGTACAAGG + Intronic
1035964577 8:4176473-4176495 TAGTGAGTGAGGAGGTTAGAAGG - Intronic
1036078834 8:5530194-5530216 CAGTGAGAGTGAGGGGTACGAGG - Intergenic
1037751384 8:21684615-21684637 CAGTGGCTGGGGAGGGGACAAGG - Intergenic
1038691192 8:29765035-29765057 CAGTGGGTGTGAAGGGGAAAGGG - Intergenic
1038728497 8:30103928-30103950 CAGGCTGTGTGGAGGGTACAGGG - Intronic
1039219991 8:35319940-35319962 CAGTGAGTCTAGAGACTACATGG - Intronic
1040855317 8:51942962-51942984 CAGTGAGTGGAGAGGGGACCAGG - Intergenic
1041320985 8:56612266-56612288 TGGTGAGTGTGGAGGACACAGGG + Intergenic
1044599087 8:93985800-93985822 CAGTGAGTCAGGAAGCTACACGG - Intergenic
1045417517 8:101982084-101982106 CAATGATGGTGGACGGTACAGGG - Intronic
1045875970 8:106981017-106981039 CAGTCAGTCTGCAGGGTAGATGG - Intergenic
1046617643 8:116495080-116495102 CAGTGGGAGAAGAGGGTACAAGG - Intergenic
1047058412 8:121193805-121193827 GAGTGAGTGTGGAGGAAACATGG + Intergenic
1047095287 8:121618435-121618457 TAGTGAGTGTGGAAGGAATAAGG - Intronic
1047965273 8:130041809-130041831 GATGGAGTGTGGAGGGAACAAGG + Intergenic
1048222043 8:132551107-132551129 CAGTGAGCATGGAGGTTACATGG - Intergenic
1049167073 8:141133120-141133142 CAGTGAGCGTGGGGGGTGGAGGG + Intronic
1050120473 9:2302331-2302353 CAGAGACTAAGGAGGGTACATGG - Intergenic
1051078507 9:13268880-13268902 GAGGGAGTTTGGAGGGTACAGGG + Intronic
1052323155 9:27190166-27190188 CAGTGGGACTGGAGGGTACTAGG + Intronic
1052831741 9:33221404-33221426 CAGTGTGCCTGGAGGGTTCAGGG - Intronic
1056108509 9:83371719-83371741 CAGTGGGTGTGGAAAGTCCAGGG - Intronic
1057227592 9:93300715-93300737 CGGTGGGTGTGCAGGGTACTGGG - Intronic
1059018832 9:110551840-110551862 GAGAGAGTGTGGAGAGTTCAGGG - Intronic
1059059023 9:111015394-111015416 CAGTGGGTTTGGAGGGAAGAAGG - Intronic
1059459445 9:114420601-114420623 CTGTGCATGTGGAGGGTACCTGG + Intronic
1060200474 9:121649392-121649414 GAGTGTGTGTGGAGGGGAGAGGG - Intronic
1061012416 9:127963506-127963528 CAGTGGCTGTGGTGGGTGCAGGG - Intronic
1062186628 9:135221900-135221922 CAGTGTGTCTGGAGGGAGCAAGG - Intergenic
1062315045 9:135962997-135963019 TGGTGACTGTGGAGGGGACAGGG + Intergenic
1186961707 X:14743752-14743774 CAGAGACTTTGGAGGGAACATGG - Intergenic
1187500181 X:19832908-19832930 CAGTGACTGTGGAGGGAACCAGG - Intronic
1189497347 X:41521050-41521072 CAGTGAGTGTGGAGGACCAAGGG - Intronic
1190047342 X:47123272-47123294 CAGTGATTGTGGAGGGCAGGGGG + Intergenic
1190420817 X:50282495-50282517 CAGTGTGTATGTAGGGGACATGG + Intronic
1191145143 X:57157515-57157537 CAGTCAGTGTGGAGATTGCATGG - Intergenic
1193062378 X:77220338-77220360 CAGTGAGGATGGATGGTTCAGGG - Intergenic
1193622016 X:83765183-83765205 ACTTGAGGGTGGAGGGTACAAGG - Intergenic
1194216855 X:91140866-91140888 AAGGGATAGTGGAGGGTACAGGG - Intergenic
1195602179 X:106762266-106762288 CAGGGGCTGGGGAGGGTACAGGG - Intronic
1196756225 X:119159746-119159768 CATTGTGTTTGGAGGGGACAGGG - Intergenic
1197002662 X:121456442-121456464 CATAGAGTGTGGATGGTAAAGGG + Intergenic
1197161215 X:123324517-123324539 CAGTGGGAGTTGAGGGGACATGG - Intronic
1197708543 X:129650660-129650682 CAGTAAGTATGGATGGAACAAGG + Intronic
1199983140 X:152932098-152932120 CAGTGAGTGTGGAAGCTTCAGGG - Intronic
1200067647 X:153511873-153511895 GAGTGGCTGTGGAGGGCACAGGG + Intergenic
1200097131 X:153669686-153669708 CGGCGAGTGTGGAGGGGACCTGG - Intergenic