ID: 1000044735

View in Genome Browser
Species Human (GRCh38)
Location 5:157512887-157512909
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 257
Summary {0: 1, 1: 0, 2: 2, 3: 15, 4: 239}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000044735_1000044741 -3 Left 1000044735 5:157512887-157512909 CCTGACCTACCTCAATTCCCTCC 0: 1
1: 0
2: 2
3: 15
4: 239
Right 1000044741 5:157512907-157512929 TCCTAAGTCAGAGAATCCCTGGG 0: 1
1: 0
2: 2
3: 9
4: 158
1000044735_1000044740 -4 Left 1000044735 5:157512887-157512909 CCTGACCTACCTCAATTCCCTCC 0: 1
1: 0
2: 2
3: 15
4: 239
Right 1000044740 5:157512906-157512928 CTCCTAAGTCAGAGAATCCCTGG No data
1000044735_1000044743 9 Left 1000044735 5:157512887-157512909 CCTGACCTACCTCAATTCCCTCC 0: 1
1: 0
2: 2
3: 15
4: 239
Right 1000044743 5:157512919-157512941 GAATCCCTGGGCTTTGTATCTGG 0: 1
1: 0
2: 0
3: 18
4: 112
1000044735_1000044745 13 Left 1000044735 5:157512887-157512909 CCTGACCTACCTCAATTCCCTCC 0: 1
1: 0
2: 2
3: 15
4: 239
Right 1000044745 5:157512923-157512945 CCCTGGGCTTTGTATCTGGAAGG 0: 1
1: 0
2: 2
3: 15
4: 213

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000044735 Original CRISPR GGAGGGAATTGAGGTAGGTC AGG (reversed) Intronic