ID: 1000044736

View in Genome Browser
Species Human (GRCh38)
Location 5:157512892-157512914
Sequence ACTTAGGAGGGAATTGAGGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 271
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 252}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000044736_1000044743 4 Left 1000044736 5:157512892-157512914 CCTACCTCAATTCCCTCCTAAGT 0: 1
1: 0
2: 0
3: 18
4: 252
Right 1000044743 5:157512919-157512941 GAATCCCTGGGCTTTGTATCTGG 0: 1
1: 0
2: 0
3: 18
4: 112
1000044736_1000044747 29 Left 1000044736 5:157512892-157512914 CCTACCTCAATTCCCTCCTAAGT 0: 1
1: 0
2: 0
3: 18
4: 252
Right 1000044747 5:157512944-157512966 GGAACCTTAAAGAACCTTAAAGG No data
1000044736_1000044741 -8 Left 1000044736 5:157512892-157512914 CCTACCTCAATTCCCTCCTAAGT 0: 1
1: 0
2: 0
3: 18
4: 252
Right 1000044741 5:157512907-157512929 TCCTAAGTCAGAGAATCCCTGGG 0: 1
1: 0
2: 2
3: 9
4: 158
1000044736_1000044745 8 Left 1000044736 5:157512892-157512914 CCTACCTCAATTCCCTCCTAAGT 0: 1
1: 0
2: 0
3: 18
4: 252
Right 1000044745 5:157512923-157512945 CCCTGGGCTTTGTATCTGGAAGG 0: 1
1: 0
2: 2
3: 15
4: 213
1000044736_1000044740 -9 Left 1000044736 5:157512892-157512914 CCTACCTCAATTCCCTCCTAAGT 0: 1
1: 0
2: 0
3: 18
4: 252
Right 1000044740 5:157512906-157512928 CTCCTAAGTCAGAGAATCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000044736 Original CRISPR ACTTAGGAGGGAATTGAGGT AGG (reversed) Intronic
900801359 1:4738933-4738955 ACTTAGGAGGAGAAGGAGGTGGG + Intronic
903345341 1:22680766-22680788 ACTTAGGGGGAAACTGAGGCTGG + Intergenic
905495925 1:38386069-38386091 TCTTGGGAAGGAAATGAGGTAGG + Intergenic
907197855 1:52701251-52701273 AATTAGGCGGGCATTGTGGTGGG - Intergenic
907409618 1:54274928-54274950 AATTGGCAGTGAATTGAGGTGGG - Intronic
908117027 1:60950530-60950552 ACCTAGGATGGAATCGGGGTGGG + Intronic
914714085 1:150239780-150239802 AGTCAGGAGGAAAGTGAGGTTGG + Intergenic
916095109 1:161342663-161342685 AATTAGCAGGGAATGGTGGTGGG - Intronic
918754926 1:188327826-188327848 AATTAAGAGGGAATAGAGGTAGG - Intergenic
919440852 1:197632039-197632061 CCTTAAGAGGGAGGTGAGGTTGG - Intronic
919865581 1:201780501-201780523 ACTTGGGAGGGAGTTGAGTGAGG - Exonic
920046198 1:203134132-203134154 ACTGAGGAGGAAACTGAGATTGG + Intronic
921997787 1:221440412-221440434 ACATATGAGGAAATTAAGGTAGG - Intergenic
923429768 1:233908965-233908987 ACTCAGGAGGAAGCTGAGGTAGG - Intronic
923837748 1:237632541-237632563 AATTAGCAGGGAATGGTGGTGGG - Intronic
923995931 1:239494388-239494410 ACATAGTACGGATTTGAGGTAGG - Intronic
924188615 1:241523654-241523676 AATGAGGAGGGAGTTGAAGTGGG - Intergenic
924317301 1:242811602-242811624 AGTTAGGAGGGACTTGGGTTGGG - Intergenic
1063676412 10:8144002-8144024 ATTTGGGAGTGAATTGATGTGGG + Intergenic
1064158201 10:12921202-12921224 ATTAAGGAGGCAATTGAGGAAGG + Intronic
1064775553 10:18772979-18773001 GCTGAGGAGGGTACTGAGGTGGG + Intergenic
1064864531 10:19864807-19864829 ACTCAGGAAGGAATTCACGTCGG + Intronic
1065184218 10:23156676-23156698 ACATAGGAGGAAAATGGGGTTGG - Intergenic
1069401305 10:68049797-68049819 ACTACTCAGGGAATTGAGGTGGG + Intronic
1070041124 10:72781114-72781136 ACTATGGAGGAAATTTAGGTAGG + Intronic
1070722408 10:78765716-78765738 ACAGAGGAGGGAATTGATGCTGG - Intergenic
1071200489 10:83216509-83216531 ACTTAGGAGACAATAGTGGTAGG + Intergenic
1071849504 10:89554311-89554333 TATCAGAAGGGAATTGAGGTGGG - Intronic
1072041245 10:91608829-91608851 ACTTGTGAGGGAGTGGAGGTGGG + Intergenic
1072590799 10:96826946-96826968 ACTTAGGAGGGTATGGAGCCAGG + Intergenic
1073082662 10:100869641-100869663 ACTTATGTGAGAACTGAGGTTGG + Intergenic
1073936140 10:108634625-108634647 AATTTGTAGGGAAGTGAGGTAGG - Intergenic
1079055921 11:17207060-17207082 ATTGAGGAGGGAAATGAGGAAGG - Intronic
1079776237 11:24532656-24532678 GCTTAGAAGGCAATTAAGGTGGG + Intronic
1080630415 11:34069810-34069832 TGTTAGGAAGGAATTGTGGTAGG + Intronic
1081645422 11:44786778-44786800 ACTTAGCAGGGCATGGTGGTGGG - Intronic
1081832652 11:46127142-46127164 ACTTAGGATTGAATTGACCTTGG - Intergenic
1084535797 11:69755950-69755972 AATTAGCAGGGAATGGTGGTGGG - Intergenic
1084574151 11:69977816-69977838 ACTTTGGAGTGATCTGAGGTCGG + Intergenic
1084965672 11:72743378-72743400 CCTGGGGAGGGATTTGAGGTGGG - Intronic
1086130898 11:83401285-83401307 ACTTAGCTGGGCATTGTGGTGGG - Intergenic
1087508010 11:99053045-99053067 ACATAAGAGGGAGTAGAGGTGGG - Intronic
1089547728 11:119242660-119242682 ACTCAGGAGGCAGTTGAGGTGGG + Intronic
1089666710 11:120025315-120025337 GCTTAGGAGCCAACTGAGGTTGG + Intergenic
1089693130 11:120199079-120199101 TCTGAGGAGGGGATGGAGGTGGG - Intergenic
1090413750 11:126526853-126526875 CCATAGGAGGGAATAGAGCTGGG - Intronic
1090480147 11:127060920-127060942 GCTTAGAATGGATTTGAGGTGGG - Intergenic
1092456704 12:8650278-8650300 ACTTAGAAGGGAAATGAAGGTGG - Intronic
1093741985 12:22699573-22699595 TCTTAGGAAGCAATTAAGGTTGG + Intergenic
1095699220 12:45174259-45174281 TCTGAGGAGGGAATTGATGTGGG - Intergenic
1096598822 12:52714981-52715003 AATCAGGAGGGAATGGGGGTGGG - Intergenic
1099270033 12:80497092-80497114 ACTAGGGAGGGGAGTGAGGTTGG + Intronic
1099496360 12:83351711-83351733 ACAAAGGAGGGAATGGAGGGAGG - Intergenic
1101052779 12:100880988-100881010 TCATAGGTGGGAATTGAGCTTGG - Intronic
1101293539 12:103396747-103396769 ACCTAGGAGGGAAGTGTGCTTGG + Intronic
1104337059 12:127908997-127909019 AATTAGCAGGGCATTGTGGTGGG + Intergenic
1105686045 13:22783019-22783041 ACTTAGGAAGGTATTCATGTAGG + Intergenic
1107279116 13:38713159-38713181 ACTGTGGAGGAATTTGAGGTTGG - Intronic
1107835613 13:44410343-44410365 ACTTAGGAAAAAATTGGGGTGGG + Intergenic
1108242827 13:48484737-48484759 ATTTAGGAAGTAACTGAGGTTGG - Intergenic
1108947554 13:56043209-56043231 ACTAAGGAGGGAGTAGAGGTGGG - Intergenic
1109597526 13:64576044-64576066 AATTAGCAGGGAATGGTGGTGGG + Intergenic
1110093594 13:71486350-71486372 ACTGCAGAGGAAATTGAGGTAGG + Intronic
1111004258 13:82228393-82228415 ACTTTGGAGGAGACTGAGGTGGG - Intergenic
1111700871 13:91686279-91686301 AATGAGGAGGGAAATGAGGGAGG + Intronic
1112379067 13:98871697-98871719 ACGTGGCAGGGAGTTGAGGTTGG - Intronic
1114066183 14:19061745-19061767 ACGCAGGATGGAGTTGAGGTGGG + Intergenic
1114096085 14:19338279-19338301 ACGCAGGATGGAGTTGAGGTGGG - Intergenic
1115200804 14:30852342-30852364 AATTAGGGGGGAATGGTGGTGGG + Intergenic
1115766523 14:36628673-36628695 ACTTATGGGAGAATTGAGGCTGG - Intergenic
1116100891 14:40433960-40433982 ACTGAGTAAGGAATTGAGATAGG + Intergenic
1117729101 14:58703606-58703628 ATTTGGAAGGGATTTGAGGTAGG + Intergenic
1118835624 14:69475823-69475845 ACCCAGGAGAGAGTTGAGGTGGG - Intergenic
1118989205 14:70782643-70782665 CCTGAGGAGGTACTTGAGGTTGG - Intronic
1119304130 14:73593445-73593467 ACTTGGGAGGCAATGGAGGGAGG - Intronic
1119439090 14:74616293-74616315 ACAAAGGAGGAAACTGAGGTTGG + Intergenic
1120859424 14:89241538-89241560 ACATAGGAGGAAACTGAGATTGG - Intronic
1125236493 15:37520199-37520221 ACATATGAGGTAACTGAGGTGGG + Intergenic
1128945640 15:71818465-71818487 ACTTAGGAAGGAGATGAGGCAGG - Intergenic
1130155012 15:81342882-81342904 AATTAGGAGGAAATGGAGGGAGG + Intronic
1133086427 16:3367236-3367258 ACTTAGTATGGAGTTGAGCTTGG + Intronic
1134189801 16:12112297-12112319 ACTTAAGAGGGAGGGGAGGTAGG - Intronic
1134541042 16:15065789-15065811 ACTCAGGAGGAAATAGTGGTTGG + Intronic
1134875926 16:17698659-17698681 GCTAAGGAGGGGATTGGGGTAGG - Intergenic
1135436494 16:22430333-22430355 ACTCAGGAGGAAATAGTGGTTGG + Intronic
1135628240 16:24014903-24014925 ACTTGGGAGGAAGTTGAGGCAGG - Intronic
1136263763 16:29101582-29101604 ACTCAGGAGGAAATAGCGGTTGG - Intergenic
1137391182 16:48082606-48082628 ACTTACAAGGGAAGTGGGGTGGG + Intergenic
1137778449 16:51076313-51076335 ACAGATGAGGAAATTGAGGTAGG + Intergenic
1138189330 16:55001292-55001314 ACTTTGGAGGAAATGGAGGAAGG - Intergenic
1138524480 16:57594463-57594485 ACTTAGGAGGGGGTGGAGGATGG - Intergenic
1138533871 16:57649461-57649483 ACTCTGGAGGGAGTTGAGGAGGG + Intronic
1139271345 16:65686281-65686303 ATTTAGGAGTGAATTGGGTTTGG - Intergenic
1139919246 16:70448895-70448917 ACTTAGCAGGGCATGGTGGTGGG - Intergenic
1140737025 16:77907561-77907583 ACATAGGAGGGACTTGAGCTGGG - Intronic
1143525646 17:7470545-7470567 AATTAGCAGGGCATGGAGGTGGG + Intronic
1144114110 17:12069108-12069130 AGTTGGGAAGGAATTGTGGTTGG + Intronic
1144479178 17:15614851-15614873 ACTTAGGAGTGCCTTGAGGTGGG + Intronic
1144919124 17:18748881-18748903 ACTTTGGAGTGCCTTGAGGTGGG - Intronic
1146039918 17:29442152-29442174 ACTTGGGAGGAGGTTGAGGTGGG - Intronic
1146946620 17:36877853-36877875 TCTTCTGAGGGAATGGAGGTTGG + Intergenic
1147459747 17:40560669-40560691 ATTTAGGAGGAAGGTGAGGTGGG - Intronic
1148738991 17:49881217-49881239 CCTTGGGAGGGAATGGAGGAGGG + Intergenic
1148978007 17:51546454-51546476 ACTTGGAAGGGAGTTGGGGTAGG - Intergenic
1149286230 17:55167391-55167413 AATTAAGAAGGAAATGAGGTGGG + Intergenic
1149607562 17:57935771-57935793 CCCTAGGAAGGAATTGGGGTGGG - Intronic
1150093440 17:62351017-62351039 ACTTGGGAAGGAATTAAGGGAGG - Intergenic
1150946979 17:69758117-69758139 ACTTGGGAGGTTATTGTGGTTGG + Intergenic
1151296176 17:73187845-73187867 ACTTAGGAGGGAATTAAAGCTGG - Intergenic
1151622998 17:75258421-75258443 ACTTTGGAGGGAGCTGAGGCAGG + Intronic
1153538101 18:6124751-6124773 AATAAGGAGGAAATTGAGGCTGG + Intronic
1157058561 18:44258915-44258937 ATTTGGGAGGGAACAGAGGTGGG - Intergenic
1157424247 18:47571309-47571331 AATAAGGAGGGCAGTGAGGTGGG + Intergenic
1157870338 18:51224534-51224556 ACCTAGGAGGGAATTCAGTTAGG - Intergenic
1159317628 18:66798530-66798552 ACTAAGAAGGGAATTGAAATAGG + Intergenic
1159729264 18:72004651-72004673 GCTTAGTAGTGAAATGAGGTAGG + Intergenic
1161856158 19:6767016-6767038 AGATAGGAGGGCAATGAGGTTGG + Intronic
1162501478 19:11056542-11056564 GCTGAGGAGGAAATTGAGGTGGG - Intronic
1162600319 19:11663875-11663897 ACTATGGAGGGAACTGAAGTTGG + Intergenic
1163241220 19:16065020-16065042 ACAGAGGAGGAAATTGAGGCTGG - Intergenic
1166350808 19:42197173-42197195 AGTTAGGTGGGGAATGAGGTGGG - Intergenic
1167433615 19:49466427-49466449 ACAGATGAGGGAACTGAGGTAGG - Intronic
1168238335 19:55077160-55077182 TCTTAGGAAGAAATTGAGGACGG + Intronic
924966734 2:83567-83589 ACTTGGCATGGATTTGAGGTTGG - Intergenic
925521162 2:4747388-4747410 ATGTAAGAGGGAATTGAGATTGG + Intergenic
925653091 2:6113294-6113316 AAGTAGGAGAGAATTCAGGTTGG + Intergenic
926900694 2:17748674-17748696 ACTGAGAAGGGAATAGAGGGTGG - Intronic
927760086 2:25744732-25744754 CATTAGGAGGGAGTTGAGATAGG - Intronic
931940776 2:67249562-67249584 AAGTAGGAGGGAAATGGGGTTGG - Intergenic
935266744 2:101401485-101401507 GCTTAGTAGGAAATTGAGGCAGG - Intronic
937047233 2:118858354-118858376 ACAAAGGAGGAAACTGAGGTCGG + Intergenic
937363469 2:121244669-121244691 CAGTAGGAGAGAATTGAGGTAGG - Intronic
941965276 2:171294701-171294723 ACTAAGGAGAGAATGGAGGACGG - Intergenic
942091650 2:172497387-172497409 ACTTGGGAGGCAGCTGAGGTGGG + Intronic
942123411 2:172800919-172800941 AATGAGGAGGGAAATGGGGTTGG + Intronic
942206036 2:173620709-173620731 ACTTAGGAGAGACCCGAGGTAGG + Intergenic
942307462 2:174622891-174622913 TCTTAGGAGGGCATTATGGTAGG - Intronic
943606984 2:189987575-189987597 ATTTTGGAGGGAGTTTAGGTAGG - Intronic
943769745 2:191703644-191703666 AGATAGGAGGGAGTTGATGTGGG + Intergenic
943887577 2:193241456-193241478 ACTTATCAGAGAACTGAGGTTGG - Intergenic
946169261 2:217884863-217884885 ACTTGGGAGAGAGTTGAGATTGG - Intronic
946187416 2:217988831-217988853 ACAGAGGAGGAAACTGAGGTTGG - Intronic
946923922 2:224607372-224607394 ATTTGGGAGGGAAGGGAGGTAGG - Intergenic
947008121 2:225535844-225535866 AGTAAGGAAGGAATGGAGGTAGG - Intronic
947298938 2:228666470-228666492 TCTCTGGAGGGGATTGAGGTTGG - Intergenic
1171316215 20:24197667-24197689 AGTTAGCAGGGAATTGAGGCTGG - Intergenic
1172378749 20:34469723-34469745 ATAAAGGAGGGAATTGATGTTGG + Intronic
1172515891 20:35532983-35533005 ACTCAGGAGGAGACTGAGGTAGG + Intergenic
1173267756 20:41501123-41501145 ATTTAGGAAGGAAATGAGGTAGG - Intronic
1173898819 20:46571936-46571958 TGTTAGGAGGGAAGAGAGGTAGG + Intronic
1177554360 21:22670800-22670822 AGACAGGAGGGAATTGAAGTGGG + Intergenic
1178956719 21:37029320-37029342 ACTTAGGAGTAAATTCTGGTGGG + Intergenic
1179036768 21:37764816-37764838 ACTGAGGGGAGAATTGAGGGTGG + Intronic
1180484661 22:15784336-15784358 ACGCAGGATGGAGTTGAGGTGGG + Intergenic
1182018929 22:27064591-27064613 ACAGAGGAGGAAGTTGAGGTTGG + Intergenic
1182410503 22:30181120-30181142 ACTTAGGAGGAGGCTGAGGTGGG - Intergenic
1183007499 22:34915635-34915657 ACTGATGAGGAAATTAAGGTAGG - Intergenic
1183430191 22:37761303-37761325 ACTTAGCAGGGCATGGTGGTGGG + Intronic
1184498953 22:44860453-44860475 ACTTAGGAGGGAAAGGTGGAGGG - Intronic
1185184102 22:49382272-49382294 AGTTAGGAGGGAAGTGGGGAAGG + Intergenic
949732056 3:7125086-7125108 ACTTAGGTGGGCATGGTGGTGGG - Intronic
949750077 3:7342101-7342123 ACCTAGCAGGGAATTGACTTGGG - Intronic
952989787 3:38821693-38821715 ACTTGGTAGGGAATGGAGGTAGG - Intergenic
957313247 3:78545693-78545715 CCTTAGTGGGGAATTGAGGCAGG + Intergenic
958864334 3:99483550-99483572 TCTTTGGAGGCAATTGAGGCTGG - Intergenic
959963906 3:112332870-112332892 ACTGAGAAAGGAAATGAGGTGGG - Intronic
962060818 3:131925337-131925359 TGTTAGGAGAGCATTGAGGTGGG - Intronic
963410011 3:144915390-144915412 TCCTAGGAGGGAATTGAGTGTGG - Intergenic
963429552 3:145181222-145181244 AGTGAGGGGGGAAATGAGGTAGG - Intergenic
964687315 3:159411123-159411145 GCTTAGAAGGGTATTGTGGTGGG + Intronic
967309381 3:188091598-188091620 CCTTAGGAGAGAATAGAGGCAGG - Intergenic
971000220 4:22314330-22314352 ATATAAGAGGGAATTGAGGGGGG + Intergenic
971097850 4:23428301-23428323 ACTTAGGTGGTACCTGAGGTAGG - Intergenic
972791010 4:42371017-42371039 ACTAAAAAGGGAATTTAGGTAGG + Intergenic
973107579 4:46359766-46359788 ACTTAGCCGGGCATGGAGGTGGG + Intronic
973578200 4:52314155-52314177 ACCTAGCTGGGAATGGAGGTTGG + Intergenic
974430278 4:61788276-61788298 AGGTAGGAGGGGATTGAGGTGGG - Intronic
974665856 4:64960647-64960669 AATTAGGAGTAAAGTGAGGTGGG + Intergenic
976035233 4:80810492-80810514 TCTTAGAAGTGAATTGATGTAGG - Intronic
976496911 4:85740369-85740391 AATTAGCAGGGCATGGAGGTGGG - Intronic
976691679 4:87874833-87874855 ACCTAGGTGGGAGTTCAGGTAGG + Intergenic
978233071 4:106424148-106424170 GCTTAGGAGGGAATTGTGAAAGG + Intergenic
981437004 4:144736282-144736304 AATTAGGAGGGCATGGTGGTGGG - Intronic
982351034 4:154415702-154415724 AATTAGGAGGAAACCGAGGTCGG + Intronic
982987434 4:162228618-162228640 ACTTAGGACGGTAATGAGGATGG + Intergenic
984768204 4:183415628-183415650 ACTAAGGAGGGAAGGGAGGGGGG - Intergenic
986779273 5:11049225-11049247 GCTTAGGAGGTTATTGAGGCAGG - Intronic
987073888 5:14362416-14362438 AATTAGGAGGCATGTGAGGTTGG + Intronic
989473191 5:41844865-41844887 ATTTAGGAGGGAATGGAAGGTGG - Intronic
992806162 5:80339864-80339886 GCTACTGAGGGAATTGAGGTGGG + Intergenic
993915525 5:93740423-93740445 ACATAGTAGGGAATGGGGGTGGG - Exonic
995120401 5:108530553-108530575 ACTTAGGAGGAAATTTAGTGAGG + Intergenic
995536567 5:113142561-113142583 AATTAGGAGAGGATAGAGGTGGG - Intronic
995733400 5:115270948-115270970 ACTTAGGAGGGAGTACAGGGAGG - Intronic
996947078 5:129083262-129083284 ACTCAGGAGGCTACTGAGGTGGG + Intergenic
997688419 5:135808461-135808483 TCTTTGGAGGGAAGTGAGGGGGG - Intergenic
998236222 5:140401057-140401079 ATTTGGGAGGGAATAGAGGACGG - Intergenic
998268299 5:140683417-140683439 ACTTAAAAGGGAATGGAGTTTGG - Intronic
998333594 5:141351090-141351112 ACTTATTGGGGAATTGAGGAAGG - Exonic
998835154 5:146196207-146196229 AATTAGCTGGGAATTGTGGTGGG + Intergenic
999881620 5:155870989-155871011 TCTTAGCAGGGAATAAAGGTGGG + Intronic
1000044736 5:157512892-157512914 ACTTAGGAGGGAATTGAGGTAGG - Intronic
1000106579 5:158065526-158065548 GCTTAGGAGGGGTTTGGGGTGGG + Intergenic
1001194008 5:169655239-169655261 AGGTAGGAGGGAACTGTGGTAGG - Intronic
1001801567 5:174548844-174548866 AGCTAGGCAGGAATTGAGGTGGG - Intergenic
1002309777 5:178307275-178307297 ACTTAGGAGGAAAGTAAGGGTGG + Intronic
1003016585 6:2472902-2472924 ACTTAGGAGGGAAGAGAACTAGG - Intergenic
1003043773 6:2714102-2714124 ACTGAACATGGAATTGAGGTAGG + Intronic
1006476345 6:34257045-34257067 AATTAGCAGGGCATGGAGGTGGG + Intergenic
1007596507 6:43054067-43054089 ACTTGTAAGGGAATTGGGGTGGG + Exonic
1007613007 6:43162387-43162409 CCCTAGGAGGGAAGTGAAGTAGG + Intergenic
1010016378 6:71109032-71109054 ACTTAGAAGGGACCTGAGCTTGG - Intergenic
1010287479 6:74096027-74096049 CCTTAGGACAGAAATGAGGTTGG - Intergenic
1011282353 6:85689646-85689668 ACATAGGAGGGATTTGCTGTTGG - Intergenic
1012298837 6:97559065-97559087 GCTTAGGAGAGAATTGTTGTGGG - Intergenic
1013785791 6:113778621-113778643 ACTTAGCTGGGCATTGTGGTGGG + Intergenic
1013871971 6:114775025-114775047 ACATAGGAAGGAGTTGAGGCCGG - Intergenic
1015293724 6:131566661-131566683 CATTAGGAGGGATTTGACGTTGG - Intergenic
1017856951 6:158357916-158357938 ACTTAGTAAGGAGGTGAGGTTGG + Intronic
1019380704 7:721400-721422 ACTTTGGGGGGCATTGAGGCAGG + Intronic
1021503055 7:21350961-21350983 ACTTAGGAGGAGGCTGAGGTGGG - Intergenic
1022402123 7:30049218-30049240 TCGTAGGAGGGAATTGATGTGGG + Exonic
1024182519 7:46910237-46910259 ATGAAGGAGGGAATTGGGGTTGG + Intergenic
1025211106 7:57019974-57019996 ACAGAGGAGGGAACGGAGGTGGG + Intergenic
1025660849 7:63556873-63556895 ACAGAGGAGGGAACGGAGGTGGG - Intergenic
1025989658 7:66486678-66486700 AATTAGGAGGGTATGGTGGTGGG + Intergenic
1029312196 7:99677756-99677778 ACAAAGGAGGGAACTGAAGTGGG - Intronic
1034711796 7:153199067-153199089 ACTTAAGAGGCAAGAGAGGTGGG - Intergenic
1037519541 8:19666584-19666606 ACTCAGGAGGGAGAGGAGGTGGG + Intronic
1040284271 8:46092007-46092029 ACTCAGGAAGACATTGAGGTAGG + Intergenic
1040284728 8:46093939-46093961 ACTCAGGGGGACATTGAGGTAGG + Intergenic
1040285380 8:46098047-46098069 ACTCAGGAGCACATTGAGGTAGG + Intergenic
1040288227 8:46111222-46111244 ACTCAGGGGGACATTGAGGTAGG - Intergenic
1040303809 8:46201816-46201838 ACTAAGGGGGGCATTGAGGTAGG + Intergenic
1040311802 8:46240637-46240659 ACTTAGGGGGGCATCGAGGCAGG + Intergenic
1040330230 8:46382121-46382143 ACTCAGGAGGACATTGAGGCAGG + Intergenic
1040330987 8:46385660-46385682 ACTCAGGGGGACATTGAGGTAGG + Intergenic
1040334485 8:46409130-46409152 ACTCAGGAGGACATTGAGGCAGG + Intergenic
1040336602 8:46419212-46419234 ACTTAGGGGGACATTGAGGCAGG + Intergenic
1040337878 8:46425321-46425343 ACTCAGGGGGAAATTGAGGCAGG + Intergenic
1040342350 8:46447375-46447397 ACTTAGGGGGCAGTTGAGGCAGG - Intergenic
1041378788 8:57230039-57230061 ACCTAGGAGGAAAGTGAGGCAGG - Intergenic
1041765578 8:61414985-61415007 AGTTAGGAGCCATTTGAGGTTGG + Intronic
1042210424 8:66375181-66375203 CCTTGGGTGGGAATTGAGGAAGG - Intergenic
1044352334 8:91181376-91181398 AATTAGGAGGGGAATGAGGAAGG - Intronic
1044580398 8:93820314-93820336 GCTTTGGAGGGCAATGAGGTTGG + Intergenic
1045331288 8:101157823-101157845 ACTGGGGAGAGAATGGAGGTGGG - Intergenic
1048116166 8:131525658-131525680 ACCTAGGAGGAAAATGAGCTTGG + Intergenic
1048814595 8:138320435-138320457 AGTGATGAGGAAATTGAGGTGGG - Intronic
1048882993 8:138885514-138885536 AGGTAGGAGGGATTTGAGGCAGG - Intronic
1050199866 9:3132777-3132799 ATTTAGGTGGGAACTGGGGTGGG + Intergenic
1050896191 9:10887671-10887693 ACTAAGGAGGGAGTAGAGGGAGG - Intergenic
1052644766 9:31219609-31219631 ACTTATGAGCCAATTTAGGTTGG - Intergenic
1054699255 9:68396169-68396191 TTTTATGAGGTAATTGAGGTAGG + Intronic
1055523038 9:77101232-77101254 ACTTAGCTGGGCATTGTGGTGGG + Intergenic
1058101140 9:100918859-100918881 ACTGAGGAGAGAACTCAGGTGGG - Intergenic
1058206794 9:102118600-102118622 AGTGAGAAGGGAATTGAAGTGGG + Intergenic
1058387605 9:104457092-104457114 ACTTGGGAGAGAGATGAGGTTGG - Intergenic
1059445567 9:114335922-114335944 ACTGCGGAGGGCCTTGAGGTGGG - Exonic
1059883187 9:118715043-118715065 ATTTAGGAGGGAATAGATGCAGG + Intergenic
1060729556 9:126028761-126028783 AATTAGGAGGGCATGGTGGTGGG - Intergenic
1186818375 X:13260590-13260612 ACTAAGGTGGGAAGGGAGGTTGG - Intergenic
1187225525 X:17372772-17372794 ACATGGGAGGGACTTGAGTTGGG + Intergenic
1189566382 X:42245948-42245970 CATTTGGAGGGAATTGGGGTAGG - Intergenic
1194722161 X:97352986-97353008 ACTCAGGAGGGTTTTGTGGTAGG + Intronic
1195432017 X:104799438-104799460 ACTTAGGAGGTTATGGAGCTTGG + Intronic
1197257587 X:124280492-124280514 ACTTAGGTGAGAAATGAGGTGGG - Intronic
1198335123 X:135658254-135658276 TCTTAGGGGGGAATTGAGGCAGG + Intergenic
1198363756 X:135921067-135921089 TCTTAGGGGGGAATTGAGGCAGG - Intergenic
1199188995 X:144949180-144949202 AGTTAGGGGGGAAATGATGTAGG - Intergenic
1201955571 Y:19618702-19618724 ACACAGGAGGGAAGTGAGTTGGG - Intergenic