ID: 1000044737

View in Genome Browser
Species Human (GRCh38)
Location 5:157512896-157512918
Sequence TCTGACTTAGGAGGGAATTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 230
Summary {0: 1, 1: 2, 2: 2, 3: 26, 4: 199}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000044737_1000044747 25 Left 1000044737 5:157512896-157512918 CCTCAATTCCCTCCTAAGTCAGA 0: 1
1: 2
2: 2
3: 26
4: 199
Right 1000044747 5:157512944-157512966 GGAACCTTAAAGAACCTTAAAGG No data
1000044737_1000044745 4 Left 1000044737 5:157512896-157512918 CCTCAATTCCCTCCTAAGTCAGA 0: 1
1: 2
2: 2
3: 26
4: 199
Right 1000044745 5:157512923-157512945 CCCTGGGCTTTGTATCTGGAAGG 0: 1
1: 0
2: 2
3: 15
4: 213
1000044737_1000044743 0 Left 1000044737 5:157512896-157512918 CCTCAATTCCCTCCTAAGTCAGA 0: 1
1: 2
2: 2
3: 26
4: 199
Right 1000044743 5:157512919-157512941 GAATCCCTGGGCTTTGTATCTGG 0: 1
1: 0
2: 0
3: 18
4: 112

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000044737 Original CRISPR TCTGACTTAGGAGGGAATTG AGG (reversed) Intronic
901078517 1:6570472-6570494 TCTGCACAAGGAGGGAATTGAGG + Intronic
902796967 1:18806361-18806383 ACTGATTGGGGAGGGAATTGGGG - Intergenic
904247098 1:29195503-29195525 TTTGACAGAGGAGGAAATTGAGG - Intronic
905274974 1:36811663-36811685 TCTGCCCCAGGAGGGAATTTCGG + Intronic
905897468 1:41558107-41558129 TTTCACTTAGGAGGAAATGGGGG - Intronic
906679828 1:47718690-47718712 ACTGACTAAAGAGGGAACTGAGG - Intergenic
906687954 1:47774656-47774678 TCTGTCTTAGGAGTGGATGGGGG - Intronic
908828602 1:68157196-68157218 TCTCACTTAGGAGGAAACTGAGG - Intronic
910898739 1:92096300-92096322 GCTGAGTAAGGAGGGAAATGAGG - Intronic
913043319 1:115051652-115051674 TCTGACTTAGGATGGAATTGAGG - Intronic
913093499 1:115495667-115495689 TTTCACTGAGGAGGAAATTGGGG - Intergenic
915486742 1:156226710-156226732 TTTGACAGAGGAGGAAATTGAGG + Intronic
915721136 1:157986437-157986459 TCAGAGTTAGCAGGAAATTGAGG + Intergenic
916507738 1:165443360-165443382 TGGGACTGAGGTGGGAATTGAGG + Intronic
916652740 1:166846186-166846208 TCTGGGGTGGGAGGGAATTGGGG + Intronic
918179015 1:182070016-182070038 TCTCACTTAGGAGGGGAGGGAGG + Intergenic
919131994 1:193463110-193463132 ACTGACTGCGGAGGGATTTGCGG - Intergenic
920577195 1:207070262-207070284 TATGACTGTGGAGGGAAATGGGG - Exonic
922101630 1:222482040-222482062 TCTGACTCAGATGGGAACTGCGG - Intergenic
922429464 1:225534964-225534986 TGTGACTTAAGAGTGAATTTAGG - Intronic
1063512172 10:6656164-6656186 TCTGACCTAGGAGGGGAATGTGG + Intergenic
1063763282 10:9106798-9106820 TGTGAGTTAGGAGAGAAATGAGG + Intergenic
1064882865 10:20076247-20076269 TCTGGCTTAAGTAGGAATTGAGG - Intronic
1066731783 10:38442915-38442937 TCTGACTCAGATGGGAACTGCGG + Intergenic
1067406958 10:46031963-46031985 TCTGAATTGAGAGGGAATGGGGG - Intergenic
1069864093 10:71490531-71490553 TATTACATAGGAGGAAATTGAGG + Intronic
1070801095 10:79244773-79244795 TCTGGCTGAGGAGTGAGTTGGGG + Intronic
1071020054 10:81042906-81042928 TCTGAGTTAGAAGGTAATTCAGG - Intergenic
1071170548 10:82858872-82858894 ACATACCTAGGAGGGAATTGGGG + Intronic
1071240091 10:83695846-83695868 TCTGCCCTAGGAGAGAATTTAGG - Intergenic
1074425943 10:113351425-113351447 TCTTATTTCAGAGGGAATTGGGG - Intergenic
1074695644 10:116048276-116048298 TCAGACTTTTGAGGGAATGGAGG - Intergenic
1075744487 10:124717191-124717213 TTTGACTCATGAGGGAACTGAGG - Intronic
1075909184 10:126108500-126108522 TCTGACTTAGCAAGGAGATGAGG - Intronic
1076092414 10:127699290-127699312 TCTGACTTAGGAGGGAATTCAGG - Intergenic
1078183424 11:9031030-9031052 TCTGACTGAGGTGGGAACTGCGG - Intronic
1078560033 11:12363429-12363451 ACTGACCTAGGAAAGAATTGGGG + Intergenic
1078685588 11:13527935-13527957 TCTCACACATGAGGGAATTGAGG - Intergenic
1079423686 11:20319027-20319049 TCTGACCTTGGAGTGAATGGGGG + Intergenic
1080885892 11:36367884-36367906 TCTGGGTGAGGAGGGAAGTGAGG + Intronic
1082261990 11:50083496-50083518 TCTGACTGAGATGGGAACTGTGG - Intergenic
1088072477 11:105806486-105806508 CCTGACTTAGGAAAGAAATGGGG - Intronic
1089981957 11:122779998-122780020 TCTGAATTAGGAGGAGATGGTGG - Intronic
1090300110 11:125628475-125628497 TGTGACTCAGGAGAGAGTTGAGG + Intronic
1090513588 11:127400809-127400831 TATGACATGGGAGGGAACTGAGG - Intergenic
1091011805 11:132008113-132008135 TGTGACTAAGCAGGGAATTGGGG + Intronic
1091042657 11:132296526-132296548 TTTTACTAAGGAGGGAACTGAGG + Intronic
1098953053 12:76661624-76661646 TCTGGATTTGGTGGGAATTGAGG - Intergenic
1099131384 12:78836550-78836572 GCTGAGTGGGGAGGGAATTGTGG - Intergenic
1100153740 12:91772860-91772882 TCTGACTGTGGCAGGAATTGGGG + Intergenic
1100800096 12:98221862-98221884 TATGGGATAGGAGGGAATTGGGG - Intergenic
1101803531 12:108043543-108043565 TGTGAGATAGGAGGGATTTGAGG + Intergenic
1102035823 12:109769876-109769898 TCTGTGTTAGGAAGGAATGGTGG - Exonic
1103125241 12:118416465-118416487 TCTGACTTTTGAGGGTATTGAGG + Exonic
1104339270 12:127932023-127932045 TCTCCCTTTGGAGGGAATAGAGG + Intergenic
1104666146 12:130649034-130649056 TCTGAGTCAGGAGGTCATTGAGG - Intronic
1105752231 13:23432051-23432073 TCTGACACAGGAGGGAACTGAGG + Intronic
1106626274 13:31424144-31424166 TGTGACTTGGAAGGGATTTGTGG + Intergenic
1108986185 13:56591028-56591050 TCTAACTCAAGAGGGAGTTGTGG + Intergenic
1109944580 13:69416816-69416838 TCTGACTTAGGAGGTAGCTAAGG + Intergenic
1110028932 13:70580495-70580517 TCTCACTTATGAGGGAAATTGGG + Intergenic
1110100677 13:71597668-71597690 TTTGACCTAGTAGGGAACTGAGG - Intronic
1110997038 13:82123294-82123316 TCTGGATTAGGAGGGACTTAAGG - Intergenic
1113642322 13:111966475-111966497 TCTGCCTTAACAGGGAGTTGGGG - Intergenic
1115724697 14:36200338-36200360 ACTGAGATAGGAGGGAAATGGGG + Intergenic
1117745427 14:58864749-58864771 TCTCTCTTAGGAGGGACGTGTGG + Intergenic
1119936351 14:78595687-78595709 TTTGACTAAGGAGGAAACTGAGG + Intronic
1121445899 14:93978723-93978745 TCTGTCTTACAGGGGAATTGTGG + Intergenic
1121696640 14:95918681-95918703 TCTGACTCAGGAGGAAGTGGAGG - Intergenic
1123047409 14:105525877-105525899 TCTGACATAGGAGGAGACTGAGG - Intergenic
1128998767 15:72316328-72316350 ACTGAGTTGGGAAGGAATTGAGG - Intronic
1129619454 15:77130793-77130815 TCTGAAAGAGGAGGAAATTGAGG + Intronic
1130871386 15:87974859-87974881 TCTGTCTTAGGAGTGGAGTGGGG + Intronic
1131821757 15:96281076-96281098 TCTTACAGAGGAGGGAACTGAGG + Intergenic
1132069864 15:98766802-98766824 TCTGACTTAGCACAGAATTATGG - Intronic
1133547397 16:6820748-6820770 TCTGACTTAGCATCGATTTGAGG - Intronic
1136713207 16:32257184-32257206 TCTGACTGAGGAGGAATTTGGGG - Intergenic
1136754705 16:32672243-32672265 TCTGACTGAGGAGGAATTTGGGG + Intergenic
1136813407 16:33198121-33198143 TCTGACTGAGGAGGAATTTGGGG - Intronic
1136819883 16:33308201-33308223 TCTGACTGAGGAGGAATTTGGGG - Intergenic
1136826447 16:33364741-33364763 TCTGACTGAGGAGGAATTTGGGG - Intergenic
1136831513 16:33463512-33463534 TCTGACTGAGGAGGAATTTGGGG - Intergenic
1137028795 16:35503069-35503091 TCTGACAGAGGAGGAATTTGGGG + Intergenic
1138533869 16:57649457-57649479 ACTGACTCTGGAGGGAGTTGAGG + Intronic
1139359667 16:66389729-66389751 TCTGGCCTATGAGGGGATTGTGG - Intronic
1139419883 16:66843869-66843891 TCTGACAGAGGAGGGGAGTGAGG - Intronic
1140082070 16:71757620-71757642 TTTTACTTATGAGGCAATTGAGG + Intronic
1140399811 16:74662342-74662364 TCTGACTTATGAGGAAATGGGGG + Intronic
1141848284 16:86626294-86626316 ACTGACTTTGGAGGGAACTTGGG - Intergenic
1202991984 16_KI270728v1_random:21096-21118 TCTGACTGAGGAGGAATTTGGGG - Intergenic
1203056851 16_KI270728v1_random:932578-932600 TCTGACTGAGGAGGAATTTGGGG + Intergenic
1143680381 17:8471833-8471855 GCTGACTTAGGACGGCATTTTGG + Intronic
1143768612 17:9153486-9153508 TGTGTCTTAGGAGGGAATGCTGG + Intronic
1144715460 17:17432157-17432179 ACTCACTTAGGAGGCAATCGTGG + Intergenic
1144948666 17:18982537-18982559 TCTTACTTATGAGGAAACTGAGG - Intronic
1146270193 17:31480048-31480070 TTTGACTGAGGAGGAAACTGAGG + Intronic
1148761209 17:50001699-50001721 TTTGACAGAGGAGGGAACTGAGG + Intergenic
1150315723 17:64167087-64167109 TCTGCCTTTGGTGGGAAGTGAGG + Intronic
1150568982 17:66369338-66369360 GCTGTTTTAGGAGGGAATTTTGG - Intronic
1155506515 18:26538760-26538782 TTTGACTGAGGAGGAAACTGAGG + Intronic
1157488220 18:48104718-48104740 TCTGGCTTAGGAGGGCATTTCGG - Intronic
1157505055 18:48220164-48220186 TCTGCCTTCAGAGGGAACTGGGG - Intronic
1158402551 18:57133916-57133938 TCAGAGTTGGGAGGGAAATGGGG + Intergenic
1162888470 19:13714287-13714309 TCTGACTTAGGAGTTATTTAGGG - Intergenic
1163066123 19:14796976-14796998 TCTGACATAGAAGGAAAGTGTGG - Intronic
1164512472 19:28908896-28908918 TCTGACTTGGAAGGGAAGTAAGG + Intergenic
1164576393 19:29407781-29407803 TCTGACTCAGGGGGAAACTGAGG + Intergenic
1165942381 19:39421383-39421405 TCTGAATGAGAAGGGGATTGGGG + Intronic
1166120769 19:40684922-40684944 TCAGACGTAGGAGGGCATGGGGG + Intronic
1166504366 19:43361884-43361906 TCTGAGGTAGGAGGGACTGGGGG + Intronic
1168107779 19:54174690-54174712 TCTGAGGGAGGAGGGAAGTGGGG - Intronic
926829005 2:16939909-16939931 TCTGAGCTAGCAGGGTATTGTGG + Intergenic
928217756 2:29376471-29376493 TCTGTCTTAGGACTGAATTTTGG - Intronic
928243687 2:29608738-29608760 TATGCCTCAGGAGGGAATGGTGG - Intronic
929643494 2:43604849-43604871 TCTTACGTGGGAAGGAATTGTGG - Intergenic
929910410 2:46084920-46084942 TCTGACTTGGGAGGCCATGGAGG - Intronic
930713134 2:54568015-54568037 TCTGACTTAGGAGGTCTGTGGGG - Intronic
931809601 2:65841856-65841878 TGTAACTAAGGAGGGATTTGAGG + Intergenic
935571626 2:104668252-104668274 TCTGAATTTGGAGGTATTTGAGG + Intergenic
936108464 2:109645708-109645730 TTTGACTGATGAGGAAATTGAGG - Intergenic
936780510 2:116027266-116027288 CCTGACTTACTAGGGAATTTGGG + Intergenic
938706156 2:133929328-133929350 TCTGAGTTTGGGGGGAATGGAGG - Intergenic
939854847 2:147345749-147345771 TCTGACTTAGAAGGTGTTTGAGG + Intergenic
941500836 2:166273929-166273951 TCTGATTTAGGAGAAAATTCTGG + Intronic
944075426 2:195724384-195724406 TCTCACTGAGAAGGGAAATGAGG + Intronic
945543157 2:211114116-211114138 TCTGACATAGGAGAAAATTGAGG - Intergenic
947365263 2:229388030-229388052 TCAGACTCAGGAGGGAGTGGGGG + Intronic
1169329298 20:4704134-4704156 TCTGTCTTTGGAGGGAAATCTGG + Intergenic
1172872469 20:38144274-38144296 TCTTACTGAGGAGGAAATGGAGG - Intronic
1174195146 20:48767504-48767526 TCTGAGTTAGGTGGAAACTGAGG - Intronic
1176801612 21:13435883-13435905 TCTGACTGAGATGGGAACTGCGG - Intergenic
1181992603 22:26848900-26848922 TCTCACAGAGGAGGAAATTGAGG - Intergenic
1182081597 22:27533174-27533196 TCTGACTTAGCAAGAATTTGTGG - Intergenic
1185184101 22:49382268-49382290 CCTGAGTTAGGAGGGAAGTGGGG + Intergenic
953616883 3:44498993-44499015 CCTTACTTAGTAGGAAATTGGGG - Exonic
953878323 3:46678943-46678965 TCTGAACTAGGAGGGTATGGAGG + Intronic
956238040 3:67096951-67096973 TATGACTTTGGAAGGAATAGGGG + Intergenic
958191013 3:90185145-90185167 TCTGATTCAGCAGGGAATTTTGG - Intergenic
958413212 3:93844273-93844295 TCTGATTCAGCAGGGAATTTTGG - Intergenic
958858139 3:99411575-99411597 TCTGAATTTGGAAGAAATTGAGG + Intergenic
960853472 3:122079413-122079435 TCAGACTGAGGTGGGAGTTGAGG + Intronic
960993479 3:123326363-123326385 TCTGACAAGGGAGGGAGTTGAGG - Intronic
962890679 3:139670129-139670151 TCTGATTTAGCAGGGAATTGTGG + Intronic
970175870 4:13338807-13338829 TCAGAGTAAGGAGGGAATGGGGG - Intergenic
971416171 4:26432448-26432470 TCTGAGTTAGGAGACATTTGTGG - Exonic
971676356 4:29634363-29634385 TCTGTCTTAGGAGGGTGTAGGGG - Intergenic
971823359 4:31588623-31588645 TCTGCTTTTGGAGGGAAATGAGG - Intergenic
973801919 4:54486941-54486963 TATGAATTTGGAGGGAAGTGGGG - Intergenic
976435240 4:85010838-85010860 TCTGTCTACGGAGGGTATTGTGG - Intergenic
977615084 4:99079474-99079496 TCTGACTTGGAAGGGACATGAGG + Intronic
979258169 4:118625542-118625564 TCTGACTCAGATGGGAACTGCGG + Intergenic
979330180 4:119415026-119415048 TCTGACTTAGATGGGAACTGCGG - Intergenic
979388245 4:120095566-120095588 TCTGAATTATTAGGGACTTGTGG + Intergenic
979896189 4:126160991-126161013 TCTCACTAAAGAGAGAATTGGGG + Intergenic
981418648 4:144523391-144523413 TTTTACATAGGAGGGAACTGAGG + Intergenic
982987433 4:162228614-162228636 ACTGACTTAGGACGGTAATGAGG + Intergenic
984278229 4:177635982-177636004 TCTGAGTAAGGAGGGCAATGAGG - Intergenic
986083051 5:4414091-4414113 TCTGACTGAGAAGGGATTTGAGG - Intergenic
989556773 5:42806095-42806117 ACTGACTGAGGTGGGAAGTGTGG + Intronic
992369304 5:76126524-76126546 CCTGACTTGGGAGGGAGGTGTGG + Intronic
997087005 5:130813266-130813288 TATGACATAGGTGGGAAGTGAGG - Intergenic
997387729 5:133486865-133486887 TTTGACCTATGAGGAAATTGAGG + Intronic
999902327 5:156098045-156098067 TCTGAGTTGGGAGGGAATTGTGG + Intronic
999997629 5:157107284-157107306 ACTGCCCTAGGAGAGAATTGTGG + Intronic
1000044737 5:157512896-157512918 TCTGACTTAGGAGGGAATTGAGG - Intronic
1001213026 5:169828429-169828451 CCTGACTTGGAAGGGATTTGTGG + Intronic
1001381060 5:171307029-171307051 TCTCACTAATGAGGGAATTGAGG - Exonic
1002279884 5:178123930-178123952 TCTGCCTGAGGAGGGAAAGGGGG + Exonic
1002309775 5:178307271-178307293 TCAGACTTAGGAGGAAAGTAAGG + Intronic
1003381142 6:5625574-5625596 TCTGTCTTAGGAGGGATGTTTGG + Intronic
1003800111 6:9654577-9654599 ACATACATAGGAGGGAATTGAGG + Intronic
1005226810 6:23652712-23652734 TCTGTCTCAGGATGGAAATGTGG - Intergenic
1007664655 6:43507138-43507160 TGGGACTTGGGAGGGAACTGGGG - Exonic
1009549153 6:65064776-65064798 TCTACCTGAGGAGGGAATAGAGG - Intronic
1010770626 6:79825301-79825323 TCTCACCCAGGAGGGAGTTGAGG + Intergenic
1013875413 6:114820647-114820669 TCTGAGATAGGAGAAAATTGGGG + Intergenic
1015891577 6:137975022-137975044 TTTGACTTAGCAGGGAGTTCTGG - Intergenic
1016234656 6:141848774-141848796 CCTGACTTTGGAGGGATGTGGGG - Intergenic
1016367973 6:143339483-143339505 TCTTAGCTAGGAGGGAATAGGGG + Intronic
1016679633 6:146813810-146813832 TCTGAGTTAGGGAGGAAATGGGG - Intronic
1017915179 6:158826020-158826042 TCTGACCTAGCCGGGAAATGTGG - Intergenic
1019213080 6:170421963-170421985 TCTGATTTAGGAGGGCTGTGGGG + Intergenic
1021207703 7:17805856-17805878 TTTGTATTAGGAGGGAAGTGGGG + Intronic
1021284885 7:18769127-18769149 TATGACTCAGGACTGAATTGAGG + Intronic
1022238599 7:28487578-28487600 CCTGAGATAAGAGGGAATTGAGG + Intronic
1022345615 7:29511522-29511544 CCTGACTTAAGAGGAAACTGTGG + Intronic
1022395446 7:29984241-29984263 TTTGGCTTAGGAGTGAATTGGGG - Intronic
1023400153 7:39786835-39786857 TCTGACTCAGATGGGAACTGCGG + Intergenic
1024073081 7:45802586-45802608 TCTGACTCAGATGGGAACTGCGG + Intergenic
1024650251 7:51397602-51397624 TCTGACTCAGATGGGAACTGCGG - Intergenic
1024923602 7:54587861-54587883 TCTGACAGATGAGGAAATTGGGG - Intergenic
1025132447 7:56383404-56383426 TCTGACTCAGATGGGAACTGCGG - Intergenic
1025688422 7:63739112-63739134 TCTGACTGAGATGGGAACTGTGG + Intergenic
1027230430 7:76268786-76268808 TCTGTCTTGGGAGGGGGTTGAGG + Intronic
1027916824 7:84334864-84334886 TGGGACTTAGGGGGAAATTGAGG - Intronic
1028940905 7:96521178-96521200 TCTGACTGAGGCTGGAAATGGGG - Intronic
1030705790 7:112691274-112691296 TTTTACTTTGGAGGGAACTGAGG + Intergenic
1031276282 7:119727595-119727617 TCTTACTTAGGAGCCAAATGGGG - Intergenic
1032327954 7:130949993-130950015 TCTTACTGATGAGGAAATTGAGG + Intergenic
1034787354 7:153937312-153937334 TGATAGTTAGGAGGGAATTGAGG - Intronic
1035109987 7:156473439-156473461 CTTGACTTTGGAGGGAAGTGAGG - Intergenic
1035360011 7:158305479-158305501 TCTGTTTTATGTGGGAATTGGGG - Intronic
1035600204 8:892792-892814 TCAGGTTTAGGAGGGAATTTAGG + Intergenic
1036585388 8:10118802-10118824 TCTGCCTTGGGTGGGAATTGGGG - Intronic
1039169741 8:34729766-34729788 TCTGATTTTGGAGGCAGTTGTGG + Intergenic
1040562597 8:48537507-48537529 TTTGACTAAGTAGGGAATTCAGG + Intergenic
1041280661 8:56209236-56209258 GCTGATTTTGGAAGGAATTGTGG - Intronic
1041413531 8:57582378-57582400 TAAAACTGAGGAGGGAATTGTGG + Intergenic
1041751394 8:61264823-61264845 TCTGAAGTTGGTGGGAATTGGGG + Intronic
1042365756 8:67934600-67934622 GCTGACGAAGGAGAGAATTGAGG - Intergenic
1043510845 8:80948865-80948887 TCTGCCTTGGGAGGGTCTTGAGG + Intergenic
1046628034 8:116596043-116596065 TCTGTCTTTGGAGGGGACTGTGG - Intergenic
1047197377 8:122733907-122733929 TCCCACTTAGGAGGGAAGGGGGG - Intergenic
1049306066 8:141904977-141904999 TGAGACATAGGAGGGAAGTGGGG - Intergenic
1049484462 8:142846749-142846771 TCTGGCTTAGAAGGGAATAATGG - Exonic
1051743642 9:20274965-20274987 TCTGACTGAGGTGGGGATTGAGG - Intergenic
1053613353 9:39738284-39738306 TCTGAGTTAGGAGACATTTGTGG + Intergenic
1053871395 9:42496241-42496263 TCTGAGTTAGGAGACATTTGTGG + Intergenic
1054240162 9:62604117-62604139 TCTGAGTTAGGAGACATTTGTGG - Intergenic
1054554295 9:66638642-66638664 TCTGAGTTAGGAGACATTTGTGG - Intergenic
1056314889 9:85378568-85378590 TCTGACTTAGTAGGCAAATGGGG + Intergenic
1058104980 9:100959785-100959807 TCTGCCATAGGAGGGAACTAAGG + Intergenic
1058137627 9:101324648-101324670 TCTGGATTTGGAGGGTATTGGGG + Exonic
1060215190 9:121734721-121734743 TCAGATTGAGGAGGGAAATGAGG + Intronic
1187713570 X:22078485-22078507 TTTGACTAAGGACAGAATTGGGG - Intronic
1188641208 X:32507647-32507669 TTTGACAGAGGAGGGAAGTGAGG + Intronic
1193188993 X:78547129-78547151 ACTGACTGAGGAGGGAAATGTGG - Intergenic
1196794721 X:119492967-119492989 CCTGGCTTAGGACAGAATTGAGG - Intergenic
1197176598 X:123492890-123492912 TCTCTCTTAGGAGAGAATGGTGG + Intergenic
1197609181 X:128619695-128619717 TCTGCCTTCGGAGGGCAGTGTGG - Intergenic