ID: 1000044737

View in Genome Browser
Species Human (GRCh38)
Location 5:157512896-157512918
Sequence TCTGACTTAGGAGGGAATTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000044737_1000044743 0 Left 1000044737 5:157512896-157512918 CCTCAATTCCCTCCTAAGTCAGA No data
Right 1000044743 5:157512919-157512941 GAATCCCTGGGCTTTGTATCTGG 0: 1
1: 0
2: 0
3: 18
4: 112
1000044737_1000044747 25 Left 1000044737 5:157512896-157512918 CCTCAATTCCCTCCTAAGTCAGA No data
Right 1000044747 5:157512944-157512966 GGAACCTTAAAGAACCTTAAAGG No data
1000044737_1000044745 4 Left 1000044737 5:157512896-157512918 CCTCAATTCCCTCCTAAGTCAGA No data
Right 1000044745 5:157512923-157512945 CCCTGGGCTTTGTATCTGGAAGG 0: 1
1: 0
2: 2
3: 15
4: 213

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000044737 Original CRISPR TCTGACTTAGGAGGGAATTG AGG (reversed) Intronic