ID: 1000044738

View in Genome Browser
Species Human (GRCh38)
Location 5:157512904-157512926
Sequence AGGGATTCTCTGACTTAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 221
Summary {0: 1, 1: 0, 2: 3, 3: 13, 4: 204}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000044738_1000044743 -8 Left 1000044738 5:157512904-157512926 CCCTCCTAAGTCAGAGAATCCCT 0: 1
1: 0
2: 3
3: 13
4: 204
Right 1000044743 5:157512919-157512941 GAATCCCTGGGCTTTGTATCTGG 0: 1
1: 0
2: 0
3: 18
4: 112
1000044738_1000044747 17 Left 1000044738 5:157512904-157512926 CCCTCCTAAGTCAGAGAATCCCT 0: 1
1: 0
2: 3
3: 13
4: 204
Right 1000044747 5:157512944-157512966 GGAACCTTAAAGAACCTTAAAGG No data
1000044738_1000044745 -4 Left 1000044738 5:157512904-157512926 CCCTCCTAAGTCAGAGAATCCCT 0: 1
1: 0
2: 3
3: 13
4: 204
Right 1000044745 5:157512923-157512945 CCCTGGGCTTTGTATCTGGAAGG 0: 1
1: 0
2: 2
3: 15
4: 213
1000044738_1000044749 30 Left 1000044738 5:157512904-157512926 CCCTCCTAAGTCAGAGAATCCCT 0: 1
1: 0
2: 3
3: 13
4: 204
Right 1000044749 5:157512957-157512979 ACCTTAAAGGATTCTTAAACTGG 0: 1
1: 0
2: 1
3: 10
4: 142

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000044738 Original CRISPR AGGGATTCTCTGACTTAGGA GGG (reversed) Intronic
902443679 1:16448011-16448033 AGGTTTTCTCTGCCTTTGGAAGG + Intronic
903247664 1:22027927-22027949 AGAGATTCTCTGAGGTGGGAAGG + Intergenic
904404846 1:30280182-30280204 AGACAGCCTCTGACTTAGGATGG - Intergenic
905037352 1:34926823-34926845 GGGGCTTGTCTGATTTAGGAAGG - Intronic
906557497 1:46725120-46725142 AGGGCTCTTCTGACTGAGGAGGG + Intergenic
907561536 1:55394514-55394536 AGGCAGTCCCTGACTTATGATGG + Intergenic
910234295 1:85019553-85019575 AGAGGTTCTCGGACTTGGGATGG - Intronic
911140696 1:94499018-94499040 AGGGAATTTCTGACCTAGTAAGG + Exonic
916557651 1:165907274-165907296 AGGGATGCTCTGTCTTAGGATGG + Intronic
917611447 1:176692764-176692786 AGGGCTTCCCTGACTTACGTAGG + Intronic
1066254534 10:33665494-33665516 ACTGAATCTCTGACTCAGGATGG - Intergenic
1070009877 10:72462356-72462378 AGGGCATTTCTGACTTATGATGG + Intronic
1070054302 10:72920141-72920163 AGGGATTCACAGTCTTGGGAGGG + Intronic
1070426302 10:76291145-76291167 AGTTTTTCTCTGTCTTAGGAGGG + Intronic
1070726353 10:78793870-78793892 ATGGGTTCTTTGACTTAGCAAGG - Intergenic
1071106789 10:82107168-82107190 AGGGATTTTCAGATTTGGGATGG - Intronic
1072122055 10:92413176-92413198 AGGCAGTGTCTGACTTAGGTAGG + Intergenic
1076351600 10:129818931-129818953 AGGGATTGTCTGAGTAATGAGGG - Intergenic
1077484718 11:2833435-2833457 AGGGAGTCTCAGCCTTAGGGTGG + Intronic
1078569105 11:12442398-12442420 AGTGAGACTCTAACTTAGGATGG + Intronic
1078807891 11:14725047-14725069 AAGGATTATGTGACTGAGGAAGG + Intronic
1078862156 11:15258728-15258750 AGGGACTCTCTGACCTGGGGCGG + Intergenic
1079996307 11:27298703-27298725 AGTGTTCCTCTGAATTAGGAAGG + Intergenic
1080528294 11:33149170-33149192 AGGGATTCTGTGAAATTGGATGG - Intronic
1080794579 11:35551710-35551732 AGGGCTTCCCTCACCTAGGAGGG + Intergenic
1083058672 11:59847335-59847357 ATGGGTCCTCTGGCTTAGGAGGG - Intergenic
1085355388 11:75832085-75832107 AGACAGTCCCTGACTTAGGACGG - Intronic
1089684160 11:120136439-120136461 AGCTAGTCCCTGACTTAGGATGG - Intronic
1090899291 11:131013088-131013110 AGACAGTCTCTGACTTATGATGG + Intergenic
1091221161 11:133930851-133930873 AGGGCTGCACTGACTTAGGAAGG + Intronic
1092986019 12:13847316-13847338 AGGGAATCTCTGCCGTGGGATGG + Intronic
1095506219 12:42901878-42901900 AGGTAGTATCTGACTCAGGAAGG + Intergenic
1095525338 12:43118299-43118321 TGGGATTCTCTAAGTTGGGATGG - Intergenic
1095876463 12:47084393-47084415 AGACAGTCTCTGACTTATGATGG - Intronic
1098082392 12:66802063-66802085 AGGGCTTCTCTGAATTGGGTAGG - Intronic
1098198698 12:68031649-68031671 AGAAACTCTCTGACTTATGATGG + Intergenic
1098771214 12:74555701-74555723 AGATATTCCCTGACTTATGATGG - Intergenic
1099279862 12:80630245-80630267 AGGGAGTCTATGACATAGGGGGG - Intronic
1101414191 12:104494520-104494542 AGGAATATTCTGACTTAGAACGG - Intronic
1103946054 12:124527143-124527165 AGGGATTTGCTGAATCAGGATGG - Intronic
1103946190 12:124528011-124528033 AGGGATTTGCTGAATCAGGATGG + Intronic
1106638229 13:31554152-31554174 AGGTAGTCTCTGACTTGCGATGG - Intergenic
1106766773 13:32921268-32921290 AAGGAACCTCTGACTTATGAAGG + Intergenic
1107188925 13:37556610-37556632 AGGGTTTCACTGTGTTAGGATGG + Intergenic
1108120602 13:47181835-47181857 GGGGATTCACTGACATAAGAGGG - Intergenic
1108289306 13:48942364-48942386 AGGGAGTATCTGAGTGAGGAGGG + Intergenic
1109850337 13:68055496-68055518 TGGGATTCTCTGCTTAAGGAAGG - Intergenic
1110470492 13:75854496-75854518 AGGGCTTTTCTGACCTAAGAAGG + Intronic
1111148444 13:84216050-84216072 ATGGATTCTGAGACTTAGAATGG + Intergenic
1112157081 13:96829941-96829963 AGGAAGTCTCTGATTTATGAGGG + Intronic
1112339974 13:98544632-98544654 GTGGATTCTTTGGCTTAGGAGGG - Intronic
1112785032 13:102942366-102942388 AGGCGTTCTCTGACTAAAGATGG - Intergenic
1118393480 14:65316096-65316118 AGAGTTTCTCTGACTTAGGGAGG - Intergenic
1119387694 14:74267999-74268021 AGGGAGTCTCTGTCACAGGAAGG + Intergenic
1120056600 14:79931509-79931531 AGGAATTGGCTCACTTAGGAGGG + Intergenic
1122603856 14:102934812-102934834 AGGGTTTCACTGTGTTAGGATGG - Intronic
1124208234 15:27741385-27741407 AGGGATTCTCTTTCATAGGGAGG + Intergenic
1124452068 15:29803262-29803284 AGACAGTCCCTGACTTAGGATGG + Intronic
1126742645 15:51793281-51793303 AGAGAGTCCCTGACTTACGATGG - Intronic
1127406981 15:58659923-58659945 AGGGTTTCACTGTGTTAGGAAGG + Intronic
1127907566 15:63387607-63387629 AGGTTTGCTTTGACTTAGGAAGG + Intergenic
1128992095 15:72269502-72269524 AGTGATTCTCTGACTGGGGTTGG + Intronic
1129987739 15:79933506-79933528 AGGGATTCTGTGCCTTGGCAGGG + Intergenic
1130098397 15:80873202-80873224 AGGGATTCTGTTACCGAGGAAGG + Intronic
1130377152 15:83339394-83339416 AGTTAGTCTCTGACTTATGATGG + Intergenic
1131041901 15:89276329-89276351 AGAGAATCTCTGTCTTTGGAGGG + Intronic
1131164142 15:90130116-90130138 AGGAGTTCTTTGACTTAGGTTGG + Intergenic
1131959367 15:97772892-97772914 AAGGATCCTCTGCCTTTGGAAGG - Intergenic
1133654142 16:7843365-7843387 AGTGATTCTCTGACTTTGGGTGG - Intergenic
1135161567 16:20101295-20101317 AAGGATTCTCTGACTTTGGAGGG + Intergenic
1136690528 16:32025115-32025137 AGAGATCCCCTGACTTGGGAGGG - Intergenic
1136791115 16:32968675-32968697 AGAGATCCCCTGACTTGGGAGGG - Intergenic
1136878699 16:33885257-33885279 AGAGATCCCCTGACTTGGGAGGG + Intergenic
1137795168 16:51211154-51211176 AGTGATTCTATGACTTAGTGTGG + Intergenic
1138939809 16:61776608-61776630 AGAGATTCTCTGGATTAGGTTGG + Intronic
1139246420 16:65448874-65448896 AGGAATCATCTGACTCAGGACGG + Intergenic
1141746416 16:85929420-85929442 AGGGGCTCTCTGCCTAAGGATGG + Intergenic
1203093323 16_KI270728v1_random:1230136-1230158 AGAGATCCCCTGACTTGGGAGGG - Intergenic
1143982262 17:10880153-10880175 AGGGAGTGGCTGAGTTAGGATGG + Intergenic
1147284052 17:39386999-39387021 AGGTGTTCCCTGACTTACGATGG + Intronic
1148343204 17:46885877-46885899 AGGGATTCTGAGAGTTGGGAAGG - Intronic
1148841025 17:50497278-50497300 AGGGTTTCACTGTATTAGGATGG - Intergenic
1149790144 17:59469723-59469745 AGAAGGTCTCTGACTTAGGATGG - Intergenic
1151267230 17:72966194-72966216 AGGGAACCTCTGACTGAGAAAGG - Intronic
1157575546 18:48740730-48740752 AGAGATGCTCTGGCTTTGGAAGG + Intronic
1160070882 18:75626692-75626714 AGGGAGTGTCTGACCTAGAAAGG + Intergenic
1160123566 18:76151132-76151154 GGGGATTCTCTGGCCTAGCATGG - Intergenic
1161292168 19:3500448-3500470 AGGGATTCGTTGACTGTGGATGG - Intronic
1161585752 19:5104588-5104610 AGGGATGCTCTGTCTTGGAAGGG + Intronic
1165018187 19:32899737-32899759 AGGCATTCCCTGACTTACGATGG - Intronic
1165559076 19:36663371-36663393 AGTGATTCACTGATTTAGAAAGG - Intronic
1165947677 19:39454535-39454557 AGGGTTTCACTGTGTTAGGATGG + Intronic
1167541415 19:50090280-50090302 AGGGTTTCACTGTGTTAGGATGG - Intergenic
1167628675 19:50609233-50609255 AGGGTTTCACTGTGTTAGGATGG + Intergenic
1168541651 19:57217203-57217225 AGACAGTCCCTGACTTAGGATGG - Exonic
1168709840 19:58492865-58492887 AGTGATTCACTGTCCTAGGAAGG - Intronic
925705059 2:6676956-6676978 AAGGATTCTCAGACTTTGGAAGG + Intergenic
927225969 2:20766889-20766911 AGGGTTTCTGTGCCTCAGGAGGG + Intronic
929055603 2:37873833-37873855 AGGGAATCTCAAACATAGGATGG - Intergenic
929088397 2:38191231-38191253 TTGGATTCTTTGACTTAGGATGG - Intergenic
929421198 2:41791660-41791682 AGACAGTCCCTGACTTAGGATGG - Intergenic
929805819 2:45144092-45144114 AGGGATTCTCTGACCCAATAGGG + Intergenic
930426632 2:51221320-51221342 AGAGATTCACTGACTTACAAGGG + Intergenic
931128829 2:59308539-59308561 TGTGCTTCTCTGACTTTGGAAGG - Intergenic
933589567 2:84217130-84217152 AGATAATCTCTGACTTATGATGG - Intergenic
935422100 2:102879976-102879998 AGGCATTGCCTGACTCAGGAAGG - Intergenic
938051303 2:128174805-128174827 TTGGATCCTCAGACTTAGGAAGG + Exonic
938879807 2:135573510-135573532 AAGAATTTTCAGACTTAGGATGG - Intronic
943698563 2:190963750-190963772 AGGCATTTTCTGACTTACTATGG - Exonic
945183140 2:207112110-207112132 AGGGATATTCTGACTTCTGATGG + Intronic
946602710 2:221369809-221369831 AAGGCTTCTCTGACTCAGTAAGG + Intergenic
948060167 2:235037237-235037259 AGGGATTCTCTGGCATTTGATGG + Intronic
948204755 2:236157551-236157573 GGAGATTCTTTGACTAAGGATGG + Intergenic
1171339702 20:24417837-24417859 AGTGATGCTCTAATTTAGGATGG - Intergenic
1171401951 20:24879470-24879492 AGGGATTCTCAGTCTCACGAAGG - Intergenic
1172192767 20:33071892-33071914 AGAGATTCTGTGATTTAGGCTGG - Intronic
1172526366 20:35602356-35602378 AGGGCTTCTCTGGCTCAGCAGGG + Intergenic
1173194076 20:40899620-40899642 AGGGATTATCTGAGTCAGGGGGG - Intergenic
1174410646 20:50332787-50332809 AGTGATTGACTGATTTAGGAGGG - Intergenic
1175394490 20:58649587-58649609 AGGGCCTCTCTGTCTTTGGATGG + Intergenic
1176212680 20:63932710-63932732 AGGGACCCTCTGGCTCAGGAGGG + Exonic
1177193212 21:17874671-17874693 TGGGATTCTATGAATTGGGATGG - Intergenic
1178293826 21:31391842-31391864 AGAGAGTCCCTGATTTAGGACGG + Intronic
1180113710 21:45681435-45681457 AGAGGCTCCCTGACTTAGGATGG + Intronic
1181442042 22:22941757-22941779 AGGGATTATCTGATGCAGGAGGG - Intergenic
1182554319 22:31120834-31120856 AGGGCTCCTCTGCCTCAGGAGGG - Intergenic
1182587223 22:31351309-31351331 AGGGTTTCACTGTGTTAGGATGG - Intergenic
1184004418 22:41697906-41697928 GGGGACTCTCTGTCTTAGGAAGG - Exonic
1185001701 22:48250326-48250348 GGGGAATCTGTGACTGAGGAAGG - Intergenic
951722972 3:25721554-25721576 AGGGTTTCACTGTGTTAGGATGG - Intronic
952179270 3:30900898-30900920 AGGGACTCTCACACGTAGGAAGG + Intergenic
953796017 3:45986565-45986587 AGGGCTTCTCTGGCTTAGGAAGG + Intronic
953891778 3:46756418-46756440 ACGGAATCTCTGACCTTGGAAGG - Exonic
954253825 3:49389742-49389764 TGGGATTCACTGTGTTAGGATGG - Intronic
956137044 3:66109753-66109775 AGTGCTGCTCTGATTTAGGAGGG - Intergenic
957437975 3:80203891-80203913 AGACAGTCTCTGACTTATGATGG - Intergenic
957617531 3:82550470-82550492 AGACACTCTCTGGCTTAGGATGG - Intergenic
957659628 3:83130702-83130724 AGATATTCCCTGACTTACGATGG + Intergenic
968798091 4:2722532-2722554 AGTGATTGTCAGAGTTAGGAGGG + Intronic
969084167 4:4642957-4642979 AGGGACTCTCTGGGCTAGGATGG - Intergenic
969285226 4:6198882-6198904 CGGGTTACTCTGACTTAGGGGGG + Intronic
969651472 4:8470721-8470743 AGGGTTTCTCAGACTAAAGAAGG - Intronic
971232764 4:24813230-24813252 AGAGATTCTGTGACTCAGGAGGG - Intronic
973278501 4:48335195-48335217 AGGGATTCTGTGACTTGGCAGGG - Intergenic
975083840 4:70312639-70312661 AGGGATTCTGTGTCTGAAGATGG + Intergenic
976075297 4:81291502-81291524 AGTGATTCTCAAACTTTGGAAGG + Intergenic
977215839 4:94282574-94282596 AGGGATTGTCTTAATAAGGACGG + Intronic
978571780 4:110145675-110145697 AGACAGTCTCTGACTAAGGAAGG - Intronic
978647820 4:110961012-110961034 AGGGATTTTCTCACACAGGAAGG - Intergenic
980870825 4:138609123-138609145 AGGGGTTCTCTGAGTTTGGCTGG + Intergenic
981228597 4:142325971-142325993 AGTGATTCTCTGATAAAGGAAGG - Intronic
982684989 4:158477445-158477467 AGGAATTTACTGACTGAGGAGGG + Intronic
983002411 4:162433502-162433524 AGCTATTCCCTGACTTATGATGG - Intergenic
985916803 5:2926743-2926765 AGACAGTCTCTGACTTATGATGG - Intergenic
986545671 5:8894056-8894078 GATGATTCTCTAACTTAGGAAGG + Intergenic
986953437 5:13120280-13120302 AGGCATTCTCTTCCTTAGGCTGG - Intergenic
987549184 5:19356640-19356662 ACCTATTCTCCGACTTAGGATGG - Intergenic
988865072 5:35325148-35325170 AGGAATTCACTGACTTAGAGTGG - Intergenic
989677304 5:43986672-43986694 AGACAGTCCCTGACTTAGGATGG - Intergenic
990193543 5:53288429-53288451 TGGGACTCTGAGACTTAGGATGG - Intergenic
993001404 5:82384940-82384962 AGGGGTTTTCTGAGTTGGGAGGG + Intronic
993169128 5:84394320-84394342 AGGGTTTCACTGTGTTAGGATGG - Intergenic
994019605 5:95007492-95007514 AGTTATTCTCTGATTGAGGAAGG - Intronic
996097321 5:119412493-119412515 AGGGATTATACGACTTGGGAAGG + Intergenic
996640572 5:125747272-125747294 TGGGATTCTATTACTAAGGAAGG + Intergenic
996676356 5:126179428-126179450 AAGGATTCTCTGCCTGAGAAAGG + Intergenic
1000044738 5:157512904-157512926 AGGGATTCTCTGACTTAGGAGGG - Intronic
1000263560 5:159613453-159613475 AGGGATTTTATAACTTTGGATGG + Intergenic
1006785679 6:36665259-36665281 AGATAGTCTCTGACTTATGATGG + Intergenic
1006835554 6:36996903-36996925 AGGGATAGTCTGAATCAGGATGG - Intergenic
1008919416 6:56826034-56826056 ACGGATCCTTTGGCTTAGGATGG + Intronic
1010280251 6:74014988-74015010 ATACATTCTCTGACTGAGGATGG + Intergenic
1010607025 6:77903199-77903221 AGAGAGTCTCTGACTTGTGATGG + Intronic
1012423775 6:99092733-99092755 ACGGATTTACTGACTTCGGATGG + Intergenic
1014933201 6:127358112-127358134 TGGCATTTTCTAACTTAGGAAGG + Intergenic
1015148207 6:130010881-130010903 AGGGCTCCTTTGAGTTAGGATGG + Intergenic
1015309885 6:131755048-131755070 ATGGATTCTCTGTCATTGGAAGG - Intergenic
1015705077 6:136079202-136079224 AGGGGGTCACTGACTTAGGAAGG - Intronic
1023416362 7:39936940-39936962 GGGAATTCTCTTACATAGGAAGG - Intergenic
1024689626 7:51785308-51785330 AGCAATTCTCTCACTTAGGCTGG + Intergenic
1024690008 7:51789852-51789874 AGGAAGACTCTGTCTTAGGAGGG + Intergenic
1026296615 7:69058527-69058549 AAGCAGTCTCTGACTTATGATGG + Intergenic
1028131034 7:87173628-87173650 AAGGATTCTCTGACTAATAAAGG + Exonic
1028575227 7:92341718-92341740 AGATAGTCCCTGACTTAGGATGG + Intronic
1028977826 7:96933608-96933630 AGATATTCACTGTCTTAGGAAGG + Intergenic
1033515612 7:142102708-142102730 AGGGTTCCACTGGCTTAGGAGGG + Intronic
1034954362 7:155325340-155325362 AGGGATTCCTTTACTTGGGATGG - Intergenic
1038022822 8:23564339-23564361 AGGGCTTCTCTGATTGAAGATGG - Intronic
1038192100 8:25332082-25332104 AGGTTTTCTCTGACTTAGATAGG + Intronic
1039043353 8:33428373-33428395 AGGGAATGTCTGACTTTAGAAGG + Intronic
1039840674 8:41290766-41290788 AGGGAGTCTCTGAGTGAGGGTGG - Intronic
1041011030 8:53543783-53543805 ATGGGTTCTCTCACTTTGGATGG - Intergenic
1042990133 8:74629989-74630011 AGGAATTCTCTGACTGAAGAAGG + Intronic
1044714009 8:95083928-95083950 AGGGGTTCTGTGATTTTGGATGG - Intronic
1048488155 8:134867529-134867551 GGGGATCCTCTGACTTGGGATGG + Intergenic
1051818154 9:21133860-21133882 AAGGAGGCTCTGACTGAGGAAGG - Intergenic
1052632844 9:31062639-31062661 AGTCAGTCTCTGACTTAAGATGG + Intergenic
1055553009 9:77448283-77448305 AACGATTTTCTGACTTACGATGG + Intronic
1056104043 9:83329283-83329305 AGAGATTCTATGAGTTTGGAAGG + Intronic
1056256152 9:84801407-84801429 AGACAGTCCCTGACTTAGGATGG + Intronic
1057730492 9:97604361-97604383 AGGGATTCTGTGAATTTGGATGG - Intronic
1058810460 9:108634069-108634091 TGGGATTTTCTTACTAAGGAGGG - Intergenic
1059112761 9:111572395-111572417 AGGGTTTCACTGTGTTAGGATGG - Intronic
1059441360 9:114308849-114308871 AGGGATCTTGGGACTTAGGAAGG + Intronic
1060684415 9:125595666-125595688 TAGGAGACTCTGACTTAGGACGG - Intronic
1062056126 9:134470527-134470549 AGGAGGACTCTGACTTAGGAGGG - Intergenic
1062258863 9:135647461-135647483 AGGGATTCTCTGGGGTAGAAGGG - Intergenic
1203490718 Un_GL000224v1:102508-102530 CGGGATTCTCTGACGGAAGATGG - Intergenic
1203503342 Un_KI270741v1:44386-44408 CGGGATTCTCTGACGGAAGATGG - Intergenic
1185603360 X:1354077-1354099 AGGGATTCCATGACTCATGATGG - Intronic
1186504076 X:10076167-10076189 AGGTATTCTGTCACTTATGATGG + Intronic
1186574311 X:10749380-10749402 AGGCATGCTCTGACTCAGCAGGG - Intronic
1188335525 X:28927570-28927592 AGGGCTTCCCTGACATAGGCTGG + Intronic
1188974302 X:36654826-36654848 AGTGATTCAATCACTTAGGATGG - Intergenic
1191844710 X:65538368-65538390 AGGGATACTCTGTCTCAGAAAGG + Intergenic
1193652967 X:84161301-84161323 AGAGAGTATCTGACTCAGGATGG - Intronic
1195383931 X:104296044-104296066 GGGGACTCTCAGACTAAGGAGGG + Intergenic
1198840876 X:140856571-140856593 AGTGATTCTCTGAATAAAGATGG + Intergenic
1200702926 Y:6417459-6417481 AGGGATTCTTTGAGAAAGGAAGG + Intergenic
1201031184 Y:9747238-9747260 AGGGATTCTTTGAGAAAGGAAGG - Intergenic
1201326398 Y:12764978-12765000 ATGGATTTTCTGACTTTGTAGGG - Intronic