ID: 1000044739

View in Genome Browser
Species Human (GRCh38)
Location 5:157512905-157512927
Sequence CAGGGATTCTCTGACTTAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 183
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 171}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000044739_1000044747 16 Left 1000044739 5:157512905-157512927 CCTCCTAAGTCAGAGAATCCCTG 0: 1
1: 0
2: 0
3: 11
4: 171
Right 1000044747 5:157512944-157512966 GGAACCTTAAAGAACCTTAAAGG No data
1000044739_1000044749 29 Left 1000044739 5:157512905-157512927 CCTCCTAAGTCAGAGAATCCCTG 0: 1
1: 0
2: 0
3: 11
4: 171
Right 1000044749 5:157512957-157512979 ACCTTAAAGGATTCTTAAACTGG 0: 1
1: 0
2: 1
3: 10
4: 142
1000044739_1000044751 30 Left 1000044739 5:157512905-157512927 CCTCCTAAGTCAGAGAATCCCTG 0: 1
1: 0
2: 0
3: 11
4: 171
Right 1000044751 5:157512958-157512980 CCTTAAAGGATTCTTAAACTGGG 0: 1
1: 0
2: 2
3: 21
4: 258
1000044739_1000044743 -9 Left 1000044739 5:157512905-157512927 CCTCCTAAGTCAGAGAATCCCTG 0: 1
1: 0
2: 0
3: 11
4: 171
Right 1000044743 5:157512919-157512941 GAATCCCTGGGCTTTGTATCTGG 0: 1
1: 0
2: 0
3: 18
4: 112
1000044739_1000044745 -5 Left 1000044739 5:157512905-157512927 CCTCCTAAGTCAGAGAATCCCTG 0: 1
1: 0
2: 0
3: 11
4: 171
Right 1000044745 5:157512923-157512945 CCCTGGGCTTTGTATCTGGAAGG 0: 1
1: 0
2: 2
3: 15
4: 213

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000044739 Original CRISPR CAGGGATTCTCTGACTTAGG AGG (reversed) Intronic