ID: 1000044739

View in Genome Browser
Species Human (GRCh38)
Location 5:157512905-157512927
Sequence CAGGGATTCTCTGACTTAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 183
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 171}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000044739_1000044745 -5 Left 1000044739 5:157512905-157512927 CCTCCTAAGTCAGAGAATCCCTG 0: 1
1: 0
2: 0
3: 11
4: 171
Right 1000044745 5:157512923-157512945 CCCTGGGCTTTGTATCTGGAAGG 0: 1
1: 0
2: 2
3: 15
4: 213
1000044739_1000044751 30 Left 1000044739 5:157512905-157512927 CCTCCTAAGTCAGAGAATCCCTG 0: 1
1: 0
2: 0
3: 11
4: 171
Right 1000044751 5:157512958-157512980 CCTTAAAGGATTCTTAAACTGGG 0: 1
1: 0
2: 2
3: 21
4: 258
1000044739_1000044747 16 Left 1000044739 5:157512905-157512927 CCTCCTAAGTCAGAGAATCCCTG 0: 1
1: 0
2: 0
3: 11
4: 171
Right 1000044747 5:157512944-157512966 GGAACCTTAAAGAACCTTAAAGG No data
1000044739_1000044749 29 Left 1000044739 5:157512905-157512927 CCTCCTAAGTCAGAGAATCCCTG 0: 1
1: 0
2: 0
3: 11
4: 171
Right 1000044749 5:157512957-157512979 ACCTTAAAGGATTCTTAAACTGG 0: 1
1: 0
2: 1
3: 10
4: 142
1000044739_1000044743 -9 Left 1000044739 5:157512905-157512927 CCTCCTAAGTCAGAGAATCCCTG 0: 1
1: 0
2: 0
3: 11
4: 171
Right 1000044743 5:157512919-157512941 GAATCCCTGGGCTTTGTATCTGG 0: 1
1: 0
2: 0
3: 18
4: 112

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000044739 Original CRISPR CAGGGATTCTCTGACTTAGG AGG (reversed) Intronic
900931480 1:5740700-5740722 CAGGGATTCACTGAATCAAGAGG - Intergenic
901371725 1:8804497-8804519 CAGGGGTTCTCTTACTCTGGAGG - Intronic
903516628 1:23915620-23915642 CAGGCATTCTCTGTCTTATCTGG + Intergenic
905693012 1:39956297-39956319 CAGGGATGCTCTGGGATAGGTGG + Intronic
906557496 1:46725119-46725141 CAGGGCTCTTCTGACTGAGGAGG + Intergenic
909282144 1:73770151-73770173 CTGGGATCCTCTGCCTTGGGAGG + Intergenic
909467053 1:75984174-75984196 CAGGGATTCTCTGAGTTTCTTGG + Intergenic
911455579 1:98118672-98118694 CAGGAATTCTCAGACTGATGTGG + Intergenic
912404121 1:109422443-109422465 TAGAGATTGTCTGAATTAGGGGG - Intronic
913362133 1:117993118-117993140 CAGGGATCCTCAGACTCTGGAGG - Intronic
914441759 1:147713691-147713713 AAGGGATTCTCTGTCTTTGCTGG + Intergenic
915087085 1:153396185-153396207 CAGGGAGTCCCTGTCTGAGGAGG - Intergenic
917212974 1:172648806-172648828 CAGGGATTATCTCACCTAGATGG + Intergenic
917512372 1:175678998-175679020 CGGGGAATCTCTGAGTCAGGTGG + Intronic
917930327 1:179818275-179818297 CTGGGAGTCTCGGCCTTAGGCGG + Intergenic
918594626 1:186278797-186278819 CAGGGATTCTTTGCATTAGAAGG - Intergenic
920956742 1:210626530-210626552 CAGACATTCCCTGACTCAGGAGG - Intronic
1063907604 10:10797180-10797202 CAGAGATTCTCTTTCTTAGAAGG + Intergenic
1064680857 10:17809544-17809566 CAGGGGATCTCTGACCTGGGGGG + Intronic
1070054301 10:72920140-72920162 CAGGGATTCACAGTCTTGGGAGG + Intronic
1072657753 10:97342317-97342339 CTGGGATTCTGTGAAATAGGGGG - Intergenic
1074143060 10:110693389-110693411 CAGGGATTTTCTTTGTTAGGAGG + Intronic
1074688713 10:115983060-115983082 CAGAGGTTCTCAGACTAAGGTGG - Intergenic
1075075186 10:119345951-119345973 CAGGGATCCACTGACATTGGAGG - Intronic
1076149556 10:128151120-128151142 CAGGGTTGCTCTGAGTTACGGGG - Intergenic
1076351601 10:129818932-129818954 CAGGGATTGTCTGAGTAATGAGG - Intergenic
1077534120 11:3111157-3111179 CAGGGATTCTCTGTGGCAGGGGG - Intronic
1078385187 11:10884531-10884553 CTGGGATTGTCTGTCTTATGTGG - Intergenic
1078731469 11:13978963-13978985 CAGGGATTATCTGTCTTGGCTGG + Intronic
1079248112 11:18768257-18768279 CTGTGATTCTCTGACTTCTGTGG - Intronic
1080794578 11:35551709-35551731 CAGGGCTTCCCTCACCTAGGAGG + Intergenic
1083058673 11:59847336-59847358 CATGGGTCCTCTGGCTTAGGAGG - Intergenic
1087439020 11:98159172-98159194 CTGGGAGTGTCTGTCTTAGGCGG - Intergenic
1087830295 11:102812635-102812657 CAGGGATTATGTGACTTATGTGG + Intergenic
1093582924 12:20804961-20804983 CAGGTAATTTATGACTTAGGAGG + Intergenic
1095240242 12:39849543-39849565 CAGTGCTTCTCTGACTGAGGTGG + Intronic
1096185055 12:49573721-49573743 CTGTGATTCTCTTACCTAGGGGG - Intronic
1096805590 12:54139184-54139206 CAGGGATGTTCTGACATAAGGGG - Intergenic
1097082520 12:56443317-56443339 CTGGGATTATCTGTCTTATGCGG + Intronic
1098210229 12:68156088-68156110 CAGTGGTTCTCAAACTTAGGTGG - Intronic
1098907493 12:76177228-76177250 CAGGGATTCTCTTGCTAAGGAGG + Intergenic
1099279863 12:80630246-80630268 CAGGGAGTCTATGACATAGGGGG - Intronic
1101883905 12:108645024-108645046 CATAGCTTCTCTGACTTTGGTGG - Intergenic
1102953417 12:117044977-117044999 CAGGGATTGTTTGTCTTTGGCGG + Intronic
1103639192 12:122335418-122335440 GAAGGATACTCTAACTTAGGGGG + Intronic
1110264202 13:73519485-73519507 CAGGGAGTCTCTCCCTGAGGCGG + Intergenic
1112157080 13:96829940-96829962 CAGGAAGTCTCTGATTTATGAGG + Intronic
1113968749 13:114172034-114172056 CAGGATTTCTCTGACTCACGAGG + Intergenic
1115085177 14:29506893-29506915 CTGGGATTGTCTGTCTTATGCGG - Intergenic
1115476793 14:33822329-33822351 CAGAGATTCTGTTAGTTAGGGGG + Intergenic
1118013309 14:61632261-61632283 AAGGGGTTCTCTTACTAAGGAGG - Intronic
1120369997 14:83621197-83621219 CAGGGATGCTCAGACCTAGAAGG - Intergenic
1121414264 14:93768205-93768227 CAGGGGTTCTGTGTCTTATGTGG - Intronic
1122064328 14:99161379-99161401 CAGGGATTCTCTTTCTTTTGTGG - Intergenic
1123429944 15:20206006-20206028 CAGGCATTCTCTGGCTTACAAGG - Intergenic
1124362324 15:29046706-29046728 CAGTGATTCGCTCACTTTGGTGG - Intronic
1126115689 15:45205427-45205449 CAGGGATTCTCTGGGTAATGAGG + Intergenic
1128364285 15:66986381-66986403 CAGGGATCCCCTGCCTGAGGAGG + Intergenic
1128447438 15:67776429-67776451 CAGGGATTCCATGGCTTATGTGG + Intronic
1131704906 15:94983185-94983207 CTGGGCTTCGCTGGCTTAGGAGG - Intergenic
1131770078 15:95727694-95727716 CAGGGATTCTCTGACTGGTAGGG - Intergenic
1132005914 15:98226780-98226802 CAGGGCATCTCTGACTCATGTGG - Intergenic
1135161566 16:20101294-20101316 AAAGGATTCTCTGACTTTGGAGG + Intergenic
1136027809 16:27481289-27481311 CAGTGGTTCTCGGACTTAGCTGG - Intronic
1136690529 16:32025116-32025138 CAGAGATCCCCTGACTTGGGAGG - Intergenic
1136791116 16:32968676-32968698 CAGAGATCCCCTGACTTGGGAGG - Intergenic
1136854691 16:33645209-33645231 CAGGCATTCTCTGGCTTACAAGG + Intergenic
1136878698 16:33885256-33885278 CAGAGATCCCCTGACTTGGGAGG + Intergenic
1138155727 16:54701300-54701322 AAGGGATTCTCTGACTTCCGAGG + Intergenic
1139256668 16:65549479-65549501 CTGGGAATCTTTGAGTTAGGTGG - Intergenic
1140687947 16:77451594-77451616 CAGGGATTCTCAAACTTTAGTGG - Intergenic
1203093324 16_KI270728v1_random:1230137-1230159 CAGAGATCCCCTGACTTGGGAGG - Intergenic
1203116266 16_KI270728v1_random:1493682-1493704 CAGGCATTCTCTGGCTTACAAGG + Intergenic
1144673695 17:17147366-17147388 CAGGGATTCAGTGGCTGAGGAGG + Exonic
1144941618 17:18946235-18946257 CAGGGAAACACTTACTTAGGAGG + Intergenic
1145365915 17:22266728-22266750 CAGGGTTGCTCTCTCTTAGGTGG + Intergenic
1146597214 17:34179857-34179879 CAGGGATTCTCTGAGTGGAGTGG + Intergenic
1147518120 17:41141554-41141576 GAGGAATCCTCTCACTTAGGGGG + Intergenic
1148384656 17:47225455-47225477 CAGAGTTTCTCTGGCTGAGGAGG + Intergenic
1151151347 17:72090236-72090258 CAGGGAAGCTCTGACTTGGCTGG + Intergenic
1151418003 17:73979243-73979265 CAGAGATTCTCTCACTAAGGAGG + Intergenic
1152072886 17:78142773-78142795 AAGGGATGCTCTGATTCAGGAGG - Exonic
1152855742 17:82663917-82663939 CAGGGCTTCTCTGAAGGAGGTGG - Intronic
1157922722 18:51730499-51730521 AAGGGATTGGCTGACCTAGGTGG - Intergenic
1159815707 18:73071783-73071805 CTGGGATTGTCTGTCTTATGTGG + Intergenic
1161585751 19:5104587-5104609 CAGGGATGCTCTGTCTTGGAAGG + Intronic
1167454785 19:49592329-49592351 CTAGGATTCTCTGCCTTTGGGGG - Intronic
1168353131 19:55687705-55687727 CAGGGATTGACGGACTTGGGTGG - Intronic
1168594486 19:57664412-57664434 CAAGGATTCCCTGACCTGGGCGG - Intergenic
926383978 2:12317821-12317843 CAGGGAGCCACGGACTTAGGTGG + Intergenic
926612199 2:14957828-14957850 CAGGTATTCTCGGACTGAGTTGG - Intergenic
929108683 2:38388241-38388263 CAGGGCCTATGTGACTTAGGTGG + Intergenic
929922437 2:46182241-46182263 GAGGGATTCACTGACTGGGGAGG - Intronic
929961724 2:46502282-46502304 CAGTGATTCTCTCACATAGAGGG + Intronic
930194945 2:48500081-48500103 CAGGTATGCTCTGAATGAGGTGG - Intronic
930339982 2:50100133-50100155 CAGAGATTCTCCAATTTAGGAGG + Intronic
933322243 2:80791631-80791653 CACCAATTTTCTGACTTAGGTGG - Intergenic
934513894 2:94972018-94972040 CAGGGTTTCTCTGTGTTTGGAGG - Intergenic
936072511 2:109380751-109380773 CAGGGATTGCCTGGCTAAGGTGG - Intronic
944536607 2:200716665-200716687 CTGGGACTCTATGACTTTGGAGG - Intergenic
1169362359 20:4961801-4961823 TAGAGATTCTCTGGCTGAGGGGG - Intronic
1171957882 20:31473875-31473897 CAGGGGTTCTCAAACTTTGGCGG - Intronic
1172449373 20:35010896-35010918 CAGACATTTCCTGACTTAGGAGG + Intronic
1172526365 20:35602355-35602377 CAGGGCTTCTCTGGCTCAGCAGG + Intergenic
1173194077 20:40899621-40899643 AAGGGATTATCTGAGTCAGGGGG - Intergenic
1173361526 20:42348977-42348999 AAAGACTTCTCTGACTTAGGGGG + Intronic
1176121651 20:63456814-63456836 CAGGGAATTTCTGCCTAAGGAGG - Intronic
1181419640 22:22788896-22788918 CAGGCATACTGTGACTCAGGGGG + Intronic
1181817125 22:25446903-25446925 CAGGGATCATCCGACTGAGGAGG + Intergenic
1183774032 22:39950937-39950959 CTGGGATTCTCTGACTTGTTTGG + Intronic
950106321 3:10391392-10391414 CATTGGTTCTCTGGCTTAGGTGG + Intronic
950339306 3:12228687-12228709 CAGGTATTGCCTGACTTAGCTGG + Intergenic
951107312 3:18760063-18760085 CAGGGGATCCCTGACTCAGGGGG + Intergenic
951937831 3:28041654-28041676 CTGGGATTCTCCGAGTTATGGGG + Intergenic
953085794 3:39665660-39665682 TCTGGATTCTGTGACTTAGGAGG + Intergenic
953531703 3:43745555-43745577 CAGGGACTCTCTGACATTTGTGG + Intergenic
953626997 3:44579759-44579781 CAGGGATTCAGTGGCTGAGGAGG - Intronic
955860313 3:63322611-63322633 CAATGATTCTGTGACTTAGGTGG + Intronic
956310206 3:67870513-67870535 GAGGACTTCTCTGACTTTGGAGG - Intergenic
956496280 3:69830184-69830206 CAGTGATTCTTTGACTTTGAGGG - Intronic
959668058 3:108943455-108943477 GAGGGAGAATCTGACTTAGGAGG + Intronic
961918865 3:130405061-130405083 CACGGATAGTCTGACTTTGGGGG + Intronic
961937614 3:130602154-130602176 CAGGGAAACTATGACTTAAGGGG + Intronic
969285225 4:6198881-6198903 GCGGGTTACTCTGACTTAGGGGG + Intronic
969476226 4:7423971-7423993 CAGGCATGCTGTGGCTTAGGAGG + Intronic
971232765 4:24813231-24813253 AAGAGATTCTGTGACTCAGGAGG - Intronic
971293206 4:25363868-25363890 GAGGGATGCTGTGACTTAGTAGG + Intronic
973278502 4:48335196-48335218 TAGGGATTCTGTGACTTGGCAGG - Intergenic
974230831 4:59111652-59111674 CTGGGATTTTCTGTCTTATGTGG + Intergenic
974928080 4:68326528-68326550 AAGGGACTCTCTGACCTAAGTGG + Intronic
975341503 4:73246380-73246402 CTAGAATTCTCTGAATTAGGAGG + Intronic
983884963 4:172970394-172970416 CTGGGATTGTCTGTCTTATGTGG - Intronic
985440382 4:189979520-189979542 AAGGGAATCTCTGTCCTAGGGGG - Intergenic
986396009 5:7331500-7331522 CAGATGTTCTCTGCCTTAGGTGG + Intergenic
987583660 5:19826363-19826385 CAGGGATTCTCTGCCTTTCTTGG - Intronic
989737559 5:44727058-44727080 CAGGGAGGCATTGACTTAGGAGG + Intergenic
991047175 5:62234961-62234983 CAGGCATTCTCTGGCTTACAAGG - Intergenic
992376254 5:76190544-76190566 CGGGGATTCGCTGACTTGGCAGG + Intronic
993001403 5:82384939-82384961 CAGGGGTTTTCTGAGTTGGGAGG + Intronic
1000044739 5:157512905-157512927 CAGGGATTCTCTGACTTAGGAGG - Intronic
1002061122 5:176626676-176626698 CAGCCCTTCTCTCACTTAGGCGG - Intronic
1003420538 6:5953762-5953784 CAGGGATCTTATTACTTAGGTGG - Intergenic
1003481045 6:6533871-6533893 CAGGGATTCTGAGAATTAGGAGG - Intergenic
1004034615 6:11911187-11911209 CAGGCAGTCCCTGACTTAGATGG + Intergenic
1007727745 6:43926883-43926905 CCCGGCTTCTCTGACTCAGGCGG - Intergenic
1007842155 6:44725430-44725452 CAGGGGTTCTCTGAATTTGAAGG + Intergenic
1011543638 6:88461137-88461159 CAGGGATTCTCTGGATAAAGTGG - Intergenic
1013386579 6:109637851-109637873 CAGTGGTTCTCAGACTTAAGTGG + Intronic
1013414999 6:109917235-109917257 CTGGGTCTCTCTGGCTTAGGTGG + Intergenic
1013828435 6:114243515-114243537 CAGGGATTCTAGGACTTAAGTGG + Intronic
1014038634 6:116798245-116798267 CAGGGAAGCTCTCACTGAGGTGG + Intronic
1022299661 7:29091288-29091310 CAGTGATGCTCTGTCTTAGAGGG + Intronic
1022757557 7:33309900-33309922 TAGGGATTCTCATAATTAGGAGG + Intronic
1023514510 7:40987569-40987591 AAGGAATTCTATGACTTTGGAGG + Intergenic
1026849622 7:73716808-73716830 CAGGGAGTCTCTGAGTTGAGGGG + Intronic
1030322611 7:108185155-108185177 CAAGCATTCTCTGACTTTGTAGG + Intronic
1032617439 7:133489846-133489868 CAGGGACTCTATGAATTTGGAGG - Intronic
1032797801 7:135291532-135291554 CAGGGATTCCCTGACCTACAAGG + Intergenic
1038339644 8:26674576-26674598 CAGGGATTCTCTTGCATAGATGG - Intergenic
1039105393 8:33984055-33984077 CATGGATTCTGTAAGTTAGGGGG + Intergenic
1039598438 8:38811996-38812018 CTGGGAGTCTCTGTCTTATGCGG + Intronic
1040887160 8:52277105-52277127 CAGGCAGTCTCTGACCTAAGAGG - Intronic
1041401496 8:57450160-57450182 CAGGGACTCTCTCTCTTTGGCGG - Intergenic
1042944857 8:74144730-74144752 CAGGGATTCCCTCACGCAGGTGG + Intergenic
1044995806 8:97837088-97837110 CAGGTATTGCCTGACTAAGGGGG + Intronic
1047236224 8:123044141-123044163 CAGGGGTTATCTGGCTTAGGTGG + Intronic
1047396284 8:124502140-124502162 CAGGGATTCACTGTGTTAGCCGG - Intronic
1051217696 9:14816332-14816354 CAGGTATCCTCTCACTTTGGAGG + Intronic
1051498055 9:17746941-17746963 CAACCATTCCCTGACTTAGGTGG - Intronic
1051621511 9:19054606-19054628 AAGGGTTTCTCAGACTTGGGTGG + Exonic
1052301599 9:26958437-26958459 CAGGGCATCACTGACTCAGGTGG - Intronic
1052810334 9:33052804-33052826 CAGTGTTTGTCTGAGTTAGGGGG - Intronic
1053364940 9:37516117-37516139 CAGGGATTCACAGACTGAGTGGG + Intronic
1059551933 9:115237720-115237742 CAGGAATGCTTTGACTTTGGAGG - Intronic
1061529502 9:131198934-131198956 CAGGGAGGCTCTGTCTTTGGTGG + Exonic
1062056127 9:134470528-134470550 CAGGAGGACTCTGACTTAGGAGG - Intergenic
1062258864 9:135647462-135647484 CAGGGATTCTCTGGGGTAGAAGG - Intergenic
1187573922 X:20533895-20533917 CAGAGATTCTTTGACTTCTGGGG + Intergenic
1195258321 X:103109709-103109731 CTGGGATTGTCTGTCTTATGCGG - Intergenic
1195610701 X:106863557-106863579 GCGGGACTTTCTGACTTAGGTGG - Intronic
1196465574 X:115968872-115968894 CAGGGGTTCTGTGCCATAGGCGG - Intergenic
1201326392 Y:12764935-12764957 CATGGATTTTCTGACTTTGTGGG - Intronic
1201326399 Y:12764979-12765001 CATGGATTTTCTGACTTTGTAGG - Intronic