ID: 1000044741

View in Genome Browser
Species Human (GRCh38)
Location 5:157512907-157512929
Sequence TCCTAAGTCAGAGAATCCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 170
Summary {0: 1, 1: 0, 2: 2, 3: 9, 4: 158}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000044735_1000044741 -3 Left 1000044735 5:157512887-157512909 CCTGACCTACCTCAATTCCCTCC 0: 1
1: 0
2: 2
3: 15
4: 239
Right 1000044741 5:157512907-157512929 TCCTAAGTCAGAGAATCCCTGGG 0: 1
1: 0
2: 2
3: 9
4: 158
1000044733_1000044741 1 Left 1000044733 5:157512883-157512905 CCACCCTGACCTACCTCAATTCC 0: 1
1: 0
2: 2
3: 26
4: 281
Right 1000044741 5:157512907-157512929 TCCTAAGTCAGAGAATCCCTGGG 0: 1
1: 0
2: 2
3: 9
4: 158
1000044732_1000044741 2 Left 1000044732 5:157512882-157512904 CCCACCCTGACCTACCTCAATTC 0: 1
1: 0
2: 2
3: 16
4: 230
Right 1000044741 5:157512907-157512929 TCCTAAGTCAGAGAATCCCTGGG 0: 1
1: 0
2: 2
3: 9
4: 158
1000044736_1000044741 -8 Left 1000044736 5:157512892-157512914 CCTACCTCAATTCCCTCCTAAGT 0: 1
1: 0
2: 0
3: 18
4: 252
Right 1000044741 5:157512907-157512929 TCCTAAGTCAGAGAATCCCTGGG 0: 1
1: 0
2: 2
3: 9
4: 158
1000044734_1000044741 -2 Left 1000044734 5:157512886-157512908 CCCTGACCTACCTCAATTCCCTC 0: 1
1: 0
2: 0
3: 18
4: 276
Right 1000044741 5:157512907-157512929 TCCTAAGTCAGAGAATCCCTGGG 0: 1
1: 0
2: 2
3: 9
4: 158

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000044741 Original CRISPR TCCTAAGTCAGAGAATCCCT GGG Intronic