ID: 1000044742

View in Genome Browser
Species Human (GRCh38)
Location 5:157512908-157512930
Sequence GCCCAGGGATTCTCTGACTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 169
Summary {0: 1, 1: 0, 2: 2, 3: 18, 4: 148}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000044742_1000044745 -8 Left 1000044742 5:157512908-157512930 CCTAAGTCAGAGAATCCCTGGGC 0: 1
1: 0
2: 2
3: 18
4: 148
Right 1000044745 5:157512923-157512945 CCCTGGGCTTTGTATCTGGAAGG 0: 1
1: 0
2: 2
3: 15
4: 213
1000044742_1000044751 27 Left 1000044742 5:157512908-157512930 CCTAAGTCAGAGAATCCCTGGGC 0: 1
1: 0
2: 2
3: 18
4: 148
Right 1000044751 5:157512958-157512980 CCTTAAAGGATTCTTAAACTGGG 0: 1
1: 0
2: 2
3: 21
4: 258
1000044742_1000044749 26 Left 1000044742 5:157512908-157512930 CCTAAGTCAGAGAATCCCTGGGC 0: 1
1: 0
2: 2
3: 18
4: 148
Right 1000044749 5:157512957-157512979 ACCTTAAAGGATTCTTAAACTGG 0: 1
1: 0
2: 1
3: 10
4: 142
1000044742_1000044747 13 Left 1000044742 5:157512908-157512930 CCTAAGTCAGAGAATCCCTGGGC 0: 1
1: 0
2: 2
3: 18
4: 148
Right 1000044747 5:157512944-157512966 GGAACCTTAAAGAACCTTAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000044742 Original CRISPR GCCCAGGGATTCTCTGACTT AGG (reversed) Intronic
900985029 1:6068388-6068410 GCCCTGGCACTCTCTGACTGAGG + Intronic
903013696 1:20348372-20348394 GCCCAGGGTGGCTCTTACTTAGG - Exonic
911181674 1:94866336-94866358 GCCCAAGGTCTCTCTGACTGAGG + Intronic
912187363 1:107294299-107294321 GCCTAGGGATTCTCAAATTTTGG - Intronic
913362136 1:117993121-117993143 CCCCAGGGATCCTCAGACTCTGG - Intronic
915073494 1:153291306-153291328 TTCCAGGGATCCTCTGACTCAGG - Intergenic
915847218 1:159279171-159279193 TCCCTGGTGTTCTCTGACTTGGG + Intergenic
917804662 1:178602773-178602795 GCTCAGGGATTCTCAAAATTAGG - Intergenic
919879193 1:201891126-201891148 GCCCAGGGAATATCTCACTTGGG - Intronic
1064147920 10:12840083-12840105 GCCCAGGGCTTCTCACACTTCGG + Intergenic
1064367028 10:14717469-14717491 TCCCAGGGGCTCTCAGACTTAGG - Intronic
1066223422 10:33358110-33358132 GCCCAGTGGTTCTCAAACTTCGG - Intergenic
1071331970 10:84569812-84569834 GCCCAGTGATTGTCTGATTCTGG - Intergenic
1071889475 10:89987431-89987453 GCAGAGGGCTTCTCCGACTTAGG + Intergenic
1072674978 10:97459059-97459081 GCCCAAGGATTCTTTTCCTTGGG - Intronic
1077008882 11:371288-371310 CCCCAGGGCTCCCCTGACTTGGG - Intronic
1080956126 11:37098108-37098130 GCCCAGGGATTCTCTGGCATTGG + Intergenic
1084366733 11:68706364-68706386 GGCCAAGGATGCTCTGACTGTGG - Intergenic
1084416836 11:69037368-69037390 CCCCAGGCATTCTCCGTCTTGGG + Intergenic
1086272411 11:85083238-85083260 GACCAGGGTTTCTCTGAATGGGG + Intronic
1088626720 11:111735037-111735059 CCCAAGGGACTCTCTGAGTTTGG + Intronic
1089079377 11:115763110-115763132 GCCCAGTGAGTGTCTGGCTTAGG + Intergenic
1089899026 11:121962175-121962197 CCCCAGGGAACCTCTGTCTTAGG + Intergenic
1100217040 12:92461877-92461899 GAAGAGGGACTCTCTGACTTAGG - Intergenic
1102865596 12:116371532-116371554 GCCCAGGAAGTCTATGACCTAGG + Intergenic
1102953415 12:117044974-117044996 GACCAGGGATTGTTTGTCTTTGG + Intronic
1103263339 12:119608519-119608541 GCCCAGGCTTTCTCTGTCTTTGG - Intronic
1112437688 13:99403397-99403419 GGCCAGTGGTTCTCAGACTTGGG + Intergenic
1112651058 13:101399071-101399093 GCCCAGCCAGTCACTGACTTTGG - Exonic
1113841992 13:113365632-113365654 GTTCAGGGAGTCACTGACTTAGG - Intergenic
1114443701 14:22771520-22771542 TGCCAGGGATACTTTGACTTTGG - Exonic
1117738561 14:58792028-58792050 GCCCTGGGAATCACTGACATAGG - Intergenic
1118280914 14:64427676-64427698 GCACAGGGATTCTCTGGGATGGG + Intronic
1118660798 14:68008650-68008672 GCCCTGGGATTTTCTTCCTTTGG + Intronic
1119599419 14:75965094-75965116 GCCCAGGGGTCCTCTGGGTTTGG - Intronic
1119638003 14:76292468-76292490 GCCCAGGTATTGTCTTAGTTAGG + Intergenic
1122563923 14:102637655-102637677 GCCCAGGTAGTCTCGAACTTAGG + Intronic
1123931004 15:25171650-25171672 GCCCTGGGACTCGCTGGCTTTGG + Intergenic
1123983930 15:25627738-25627760 TCCCAGGGTTTTTATGACTTGGG + Intergenic
1126664482 15:51063920-51063942 ACCCAGGGACTTTGTGACTTGGG - Intronic
1126855304 15:52833048-52833070 GCCCTGCGATTCTTTGAGTTGGG + Intergenic
1127530973 15:59843324-59843346 ACCCAGGGATTCTCTCATTCAGG + Intergenic
1128326349 15:66726417-66726439 GCCCAGGGAGACTCTGACTGGGG + Intronic
1128486386 15:68094531-68094553 GCCAAGGGCTCCTCTGACATTGG + Intronic
1129764104 15:78149938-78149960 GCCCCCGGATTCTCTCACCTGGG - Intronic
1130830855 15:87597291-87597313 TCCCATGGATTCTCTGACCGTGG - Intergenic
1132954823 16:2585989-2586011 GCCCAGGGACTCTCTGGCCTTGG + Intronic
1133654144 16:7843369-7843391 GCAAAGTGATTCTCTGACTTTGG - Intergenic
1135161564 16:20101291-20101313 GCCAAAGGATTCTCTGACTTTGG + Intergenic
1136090371 16:27915302-27915324 GCCAAGGGAGTCTGTGATTTAGG + Intronic
1138728922 16:59173256-59173278 ATCCTGGGATTCTCTGGCTTTGG + Intergenic
1138956963 16:61982864-61982886 GCCCAGAGATTCTCTGCAGTTGG + Intronic
1153337582 18:3940349-3940371 CCACAGGGATTCTGTGACTCAGG - Intronic
1157669017 18:49512666-49512688 GCTCAGCGATTCTCTCACCTCGG - Intergenic
1158221109 18:55151677-55151699 GCCCATCTAGTCTCTGACTTTGG - Intergenic
1160402396 18:78620552-78620574 GCCCAGGGATTCTCCGAGTCAGG - Intergenic
1160517030 18:79484250-79484272 GCCCAGGCATTCCCAGCCTTTGG - Intronic
1161028296 19:2046627-2046649 GACCACGGAGACTCTGACTTTGG - Exonic
1161501891 19:4620782-4620804 GCCCAGGGGTGCACAGACTTGGG + Intergenic
1161706984 19:5826797-5826819 GCCCTGGGAATCGGTGACTTGGG + Intronic
1161807797 19:6455053-6455075 CCCAAGGGATTCTCCCACTTGGG - Intronic
1163257818 19:16168238-16168260 GCCCAGGTATTCTCTGAGGATGG - Exonic
1163752154 19:19084282-19084304 GCCCACAGATGCTCTGACATAGG + Intronic
1165850629 19:38848548-38848570 GCCCAGTGATTCTCAGACAGGGG - Intronic
1166342201 19:42144897-42144919 GCCCAGGACTTCACAGACTTTGG - Intronic
931744124 2:65277025-65277047 GGCCAGTGATTCTCAAACTTTGG + Intergenic
931989856 2:67779184-67779206 GAGCAGGGCTCCTCTGACTTTGG + Intergenic
932280668 2:70489190-70489212 GCCCAGGGAGCCTCTGCCTGTGG - Intronic
932707728 2:74039584-74039606 GCCCAGGGATTCTGTGGATTGGG + Intronic
935632709 2:105224975-105224997 GCCCAGGGGTTCTCTGTCATGGG + Intergenic
936506594 2:113112608-113112630 GCCCACGCTTTCTCTTACTTTGG + Intronic
939268636 2:139909494-139909516 GGGCACAGATTCTCTGACTTTGG - Intergenic
941353740 2:164463948-164463970 GCCCAGGGCTTCACTGACAGAGG + Intergenic
942086534 2:172449195-172449217 GCCCAGACATTCCCTGACATGGG - Intronic
942902803 2:181143299-181143321 GCCTATAGATTCTCTGACTTTGG + Intergenic
943784065 2:191857301-191857323 AGCCAGGGGTTCTCAGACTTTGG - Intergenic
944256103 2:197625081-197625103 CCCCAGGGATTCTCCCACCTTGG + Intronic
947278017 2:228416863-228416885 TCCCAGTGAGTCTCTGAGTTGGG + Intergenic
1173608124 20:44346433-44346455 TCCCAGTGATTCTCAAACTTGGG - Intronic
1173723392 20:45279549-45279571 GCCCAGGGATCCACAGAATTTGG - Intergenic
1174064558 20:47855087-47855109 GCCCAAGGAGTCTCTGGCTCAGG + Intergenic
1175394487 20:58649583-58649605 CCCCAGGGCCTCTCTGTCTTTGG + Intergenic
1175662999 20:60833479-60833501 TCCCAGGGATTCTCTTAGTGAGG - Intergenic
1178164797 21:29961670-29961692 TCCCAGGCATTCTTTGGCTTGGG + Intergenic
1179835347 21:44028319-44028341 TCCCGGGGATTCTCTGAACTGGG + Intronic
1181853367 22:25765739-25765761 GCCCATGGATTCTCTTCCTTTGG - Intronic
1183225214 22:36545158-36545180 GCTTTGGGATTCTCTGACTTTGG + Intergenic
1184527012 22:45030146-45030168 GCCCAAGGGTTCTCTGGCTGTGG - Intergenic
949334952 3:2964485-2964507 GTTCAGTGTTTCTCTGACTTTGG + Intronic
955034396 3:55252091-55252113 ACCCAGTGCTTGTCTGACTTGGG - Intergenic
955087437 3:55716905-55716927 GCCCAGGGATTCCCACATTTAGG + Intronic
955825869 3:62946989-62947011 GCCCAGGGAGTCACTGGCTGTGG - Intergenic
956412995 3:68997711-68997733 GGCCAGAGATTCAGTGACTTTGG - Intronic
957470092 3:80648270-80648292 GCCCTAAGATGCTCTGACTTGGG + Intergenic
961406008 3:126680004-126680026 GCCCAGGGAAGCTGTGACCTGGG + Intergenic
964557498 3:157955723-157955745 ACCCAGTGTTTCTCTAACTTAGG + Intergenic
964665904 3:159171747-159171769 GACCAGTGATTCTCAGACTTGGG + Intronic
964702530 3:159584903-159584925 CCCCAGGCATTCCCTGACTTGGG + Intronic
966771264 3:183506046-183506068 GCCCAGGAATTGTCTGTCTGAGG - Intronic
966840375 3:184082893-184082915 GCCCAGGGATTGTCTGGTCTTGG - Intergenic
967105498 3:186252003-186252025 GCCCAGGGCATCTGTGACTATGG + Intronic
967112668 3:186308341-186308363 AACCAGGGTTTCTCTGACCTTGG + Intronic
967852712 3:194094081-194094103 GCCCAGGGATGAGCTGACTGTGG - Intergenic
969476223 4:7423968-7423990 GCCCAGGCATGCTGTGGCTTAGG + Intronic
971617384 4:28809789-28809811 GACCAGGGACTCTCTCATTTGGG + Intergenic
975850186 4:78564189-78564211 GCTCAGGGTTTCTCTGACAAAGG - Intronic
978973672 4:114842408-114842430 ACCCAGGGATTCTCAAACATAGG + Intronic
980410360 4:132410090-132410112 ACCCAGGGATACAGTGACTTAGG - Intergenic
980870823 4:138609119-138609141 TGCCAGGGGTTCTCTGAGTTTGG + Intergenic
984375479 4:178923250-178923272 GTCCAAGGATTCTGTGACATGGG + Intergenic
986104618 5:4648102-4648124 GTCCATGGATTCTCTGCTTTAGG - Intergenic
989158378 5:38366635-38366657 ACCCAGTGGTTCTGTGACTTTGG + Intronic
990122270 5:52469963-52469985 GCCCAGGGAGTCTCTGTGCTGGG + Intergenic
991909293 5:71545719-71545741 GTCCAAGGCTTCTCTCACTTGGG - Intronic
991942610 5:71867101-71867123 GCCCTGGGATAGTTTGACTTTGG + Intergenic
997004211 5:129799548-129799570 GCTCTGGGAGTCTCTGTCTTAGG - Intergenic
997032131 5:130142749-130142771 GACCATGGATTCTCTGTCTTTGG - Intronic
997203399 5:132026546-132026568 CCCCAGGGCCTCTCTGAGTTGGG - Intergenic
1000044742 5:157512908-157512930 GCCCAGGGATTCTCTGACTTAGG - Intronic
1002971452 6:2026177-2026199 GCCCAGGGGGTCTCTGGCCTAGG - Intronic
1003118115 6:3296886-3296908 ACCAAGGGCTTCTCTGATTTGGG + Intronic
1003897389 6:10620612-10620634 GCCCAGGGATCTTCTTACCTCGG + Intronic
1005025609 6:21460332-21460354 ACCCAGGCACTCCCTGACTTAGG - Intergenic
1006530628 6:34650074-34650096 CCCTAGTGTTTCTCTGACTTTGG - Intronic
1011182110 6:84632705-84632727 GCCAAAGGATTCTCTGCCATTGG + Intergenic
1015017678 6:128433988-128434010 GCCTAAGAAATCTCTGACTTGGG - Intronic
1015027962 6:128559972-128559994 GCCCAGATAATCACTGACTTAGG - Intergenic
1015296472 6:131599117-131599139 GCCCAGTGATTCTCAGAGTGTGG + Intronic
1016424666 6:143921694-143921716 ATCCAGTGATCCTCTGACTTTGG - Intronic
1020882730 7:13782607-13782629 GCACAGTGATTCTCAGACTCAGG + Intergenic
1022844530 7:34196695-34196717 CCCTCGGGATTCACTGACTTAGG - Intergenic
1022970780 7:35514783-35514805 GCCCAGTGGTTCTCAAACTTTGG - Intergenic
1023982322 7:45077241-45077263 CCCCAGGGATTCTCTGGCCCAGG + Intergenic
1027433203 7:78135430-78135452 GACCAGGGGTTCTCAAACTTTGG + Intronic
1031505617 7:122578465-122578487 GATCAGGGATTCTCCAACTTTGG + Intronic
1031940015 7:127778585-127778607 GACCTGGGTTTCTGTGACTTAGG + Intronic
1032420202 7:131772873-131772895 GCCCAGGGATTGGCTGTCATTGG + Intergenic
1032746724 7:134793580-134793602 GCTCATGGCTTCTCTGTCTTAGG + Intronic
1034954363 7:155325344-155325366 GCTCAGGGATTCCTTTACTTGGG - Intergenic
1036093065 8:5690487-5690509 GGCCAGGGTCCCTCTGACTTTGG - Intergenic
1037672109 8:21023938-21023960 GGACAGAGATTCTCTGACTTTGG - Intergenic
1037827575 8:22168433-22168455 CCCCTGGGCTTCTCTGATTTTGG - Intronic
1039403435 8:37292767-37292789 GCCCAGGAATTGGCTGAGTTTGG + Intergenic
1039902853 8:41765910-41765932 GCCCTGGGGTTCTCTCACCTGGG - Intronic
1044264074 8:90162213-90162235 GCCCAGGAGTTGTCTGACTCGGG - Intergenic
1044756231 8:95464540-95464562 ACCCAGGGATTCTCTGGAATGGG - Intergenic
1048488154 8:134867525-134867547 GGCTGGGGATCCTCTGACTTGGG + Intergenic
1049127104 8:140801142-140801164 GCCCTGTGATTCTGTGAGTTTGG - Intronic
1050018606 9:1261168-1261190 GTCCAGGAACTCTCTGAGTTTGG - Intergenic
1050694611 9:8264742-8264764 GCCCTTGGCTTCTCTGTCTTTGG + Intergenic
1050955763 9:11657346-11657368 GCACAGAGATTCTGTGGCTTAGG + Intergenic
1052584011 9:30401308-30401330 GCCAAGGGATTCTATGCATTTGG + Intergenic
1052891873 9:33708706-33708728 CCTCAGGGATGCTCTGTCTTTGG + Intergenic
1056041668 9:82674570-82674592 GCACAGGGATACTCTGCCTTTGG - Intergenic
1057930763 9:99190979-99191001 GCCCAGGGCAGCTCTGCCTTAGG - Intergenic
1058681562 9:107444863-107444885 TGCCAGGAAGTCTCTGACTTTGG - Intergenic
1060342950 9:122792930-122792952 GCCCATGGAGTCTCTTCCTTGGG + Intergenic
1060423452 9:123485947-123485969 GCCCATGGGCTCTGTGACTTGGG + Intronic
1060600145 9:124871861-124871883 GACCCAGGATTCTCTGACGTGGG - Intronic
1060624530 9:125098849-125098871 ACCCAGGAATTATCTGACTTCGG - Intronic
1062107422 9:134763599-134763621 GCACAAGGGTTCTCTGGCTTGGG - Intronic
1062372742 9:136248540-136248562 GCCCAGGGCTTATCTGCCATAGG - Intergenic
1188680772 X:33001346-33001368 GCCCAGGGCTTCAGTGACTGTGG + Intronic
1188703822 X:33301148-33301170 GGCCAGGCATTGTCTGATTTAGG + Intronic
1195197135 X:102509839-102509861 GAGCAGAAATTCTCTGACTTGGG - Intergenic
1196480111 X:116138543-116138565 GTCCAGGGATTCTTTGAAATAGG + Intergenic
1197710586 X:129664207-129664229 CTCCAGGCATTCTTTGACTTAGG + Intergenic
1198182198 X:134220803-134220825 GCCCACCAATTGTCTGACTTTGG - Intergenic
1199328661 X:146532484-146532506 GCCCCTTGATTCTCTCACTTGGG - Intergenic