ID: 1000044743

View in Genome Browser
Species Human (GRCh38)
Location 5:157512919-157512941
Sequence GAATCCCTGGGCTTTGTATC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 131
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 112}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000044734_1000044743 10 Left 1000044734 5:157512886-157512908 CCCTGACCTACCTCAATTCCCTC 0: 1
1: 0
2: 0
3: 18
4: 276
Right 1000044743 5:157512919-157512941 GAATCCCTGGGCTTTGTATCTGG 0: 1
1: 0
2: 0
3: 18
4: 112
1000044732_1000044743 14 Left 1000044732 5:157512882-157512904 CCCACCCTGACCTACCTCAATTC 0: 1
1: 0
2: 2
3: 16
4: 230
Right 1000044743 5:157512919-157512941 GAATCCCTGGGCTTTGTATCTGG 0: 1
1: 0
2: 0
3: 18
4: 112
1000044739_1000044743 -9 Left 1000044739 5:157512905-157512927 CCTCCTAAGTCAGAGAATCCCTG 0: 1
1: 0
2: 0
3: 11
4: 171
Right 1000044743 5:157512919-157512941 GAATCCCTGGGCTTTGTATCTGG 0: 1
1: 0
2: 0
3: 18
4: 112
1000044737_1000044743 0 Left 1000044737 5:157512896-157512918 CCTCAATTCCCTCCTAAGTCAGA 0: 1
1: 2
2: 2
3: 26
4: 199
Right 1000044743 5:157512919-157512941 GAATCCCTGGGCTTTGTATCTGG 0: 1
1: 0
2: 0
3: 18
4: 112
1000044735_1000044743 9 Left 1000044735 5:157512887-157512909 CCTGACCTACCTCAATTCCCTCC 0: 1
1: 0
2: 2
3: 15
4: 239
Right 1000044743 5:157512919-157512941 GAATCCCTGGGCTTTGTATCTGG 0: 1
1: 0
2: 0
3: 18
4: 112
1000044736_1000044743 4 Left 1000044736 5:157512892-157512914 CCTACCTCAATTCCCTCCTAAGT 0: 1
1: 0
2: 0
3: 18
4: 252
Right 1000044743 5:157512919-157512941 GAATCCCTGGGCTTTGTATCTGG 0: 1
1: 0
2: 0
3: 18
4: 112
1000044738_1000044743 -8 Left 1000044738 5:157512904-157512926 CCCTCCTAAGTCAGAGAATCCCT 0: 1
1: 0
2: 3
3: 13
4: 204
Right 1000044743 5:157512919-157512941 GAATCCCTGGGCTTTGTATCTGG 0: 1
1: 0
2: 0
3: 18
4: 112
1000044733_1000044743 13 Left 1000044733 5:157512883-157512905 CCACCCTGACCTACCTCAATTCC 0: 1
1: 0
2: 2
3: 26
4: 281
Right 1000044743 5:157512919-157512941 GAATCCCTGGGCTTTGTATCTGG 0: 1
1: 0
2: 0
3: 18
4: 112

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000044743 Original CRISPR GAATCCCTGGGCTTTGTATC TGG Intronic
902932877 1:19743756-19743778 AAAACCCTGGGCATTGGATCAGG + Intronic
903865315 1:26393334-26393356 GACTCCCAGGGCTTTGTCTTGGG - Intergenic
904310266 1:29624870-29624892 GAAGGCCTGGGCTCTGTGTCTGG - Intergenic
905768923 1:40624982-40625004 GCAGCCCTTGGGTTTGTATCTGG - Exonic
907134536 1:52127406-52127428 GAATCTCTGGGCTTTTCCTCAGG - Intergenic
910555563 1:88528518-88528540 GAATACCTATGCTTTGAATCAGG + Intergenic
914923538 1:151864063-151864085 GCAAACCTGGGATTTGTATCTGG - Intergenic
915169001 1:153964603-153964625 GAATTACTGGGCTTCGTTTCTGG - Intronic
916147251 1:161750598-161750620 GGATCCCTGGGCTTTGCCTAGGG + Intronic
916832475 1:168507202-168507224 GAATCACAGGGCTTTGCAGCTGG - Intergenic
917038582 1:170777337-170777359 AAAACCCTGGGCTTTGAAGCAGG + Intergenic
919758361 1:201080250-201080272 GTATCCCTGAGCTTTGTCTTGGG - Intronic
921293161 1:213677622-213677644 GATTCACTGGGCATTGTATGTGG + Intergenic
922700776 1:227759059-227759081 TCTTCCCTGGGCTTTGTTTCCGG - Exonic
922816730 1:228454381-228454403 CAATCTGTGGCCTTTGTATCTGG + Intergenic
1064749995 10:18518800-18518822 GAAAACCTGAGCTTTGCATCTGG - Intronic
1066099794 10:32107575-32107597 GAATCTGAGGGCTTTGTAGCAGG - Intergenic
1066517794 10:36183293-36183315 GAATGCTTGGGCTTTGAATCAGG + Intergenic
1070380483 10:75876607-75876629 AGATCCCTGGGCTATATATCAGG - Intronic
1078599129 11:12715256-12715278 CCATCCCTGGGTTTTGTCTCTGG - Intronic
1080015337 11:27500229-27500251 GCAGCCCTGGGCTTTAGATCTGG + Intronic
1082879959 11:58027852-58027874 GAACCTGTGGCCTTTGTATCAGG - Intronic
1084829053 11:71754396-71754418 AAACCCCTGTGCTTTGTGTCAGG + Intergenic
1090967275 11:131609950-131609972 GTATCCCTGCTCTTTGTAACAGG + Intronic
1091855096 12:3733025-3733047 GAATCCCAGCGCTCTGGATCCGG + Exonic
1093058510 12:14578910-14578932 GAACTCCTGGGCCTAGTATCTGG - Intergenic
1093778896 12:23111241-23111263 GAATCTCTGGGCTTTGACACTGG + Intergenic
1094458137 12:30661788-30661810 TAATTTCTGGGCTTTGAATCAGG - Intronic
1100120063 12:91359317-91359339 GGAGCCCTGGGCTTTATCTCTGG - Intergenic
1103560846 12:121792746-121792768 GATTGCCTGGGCTGTGTGTCTGG - Intronic
1107030945 13:35853235-35853257 GAATTATTGGGCTTTCTATCTGG + Intronic
1107201735 13:37728635-37728657 ATATCACTGGGCTTTGTATAGGG - Intronic
1108021487 13:46132309-46132331 GCACCCCTGGGCTATGTAACTGG + Intronic
1109798722 13:67347285-67347307 GAGTCCCTGGGCTTTTTACTGGG + Intergenic
1110609553 13:77473913-77473935 GAAGCCCTGGGTTTTGCCTCTGG + Intergenic
1113520106 13:110934551-110934573 GCATCCCAGGGCTTTTTATCAGG - Intergenic
1113848000 13:113403456-113403478 GAAGCTCTGGGCTTTGTACTTGG + Intergenic
1114759219 14:25293460-25293482 CAATACCTGAGCTTTGTATATGG + Intergenic
1118348001 14:64953732-64953754 GAATCCCTGGGCATAGTGCCTGG - Intronic
1118750759 14:68806601-68806623 GAAAGCCTGGGCTCTGTATCTGG + Intergenic
1118806072 14:69237928-69237950 CAATTCCTGTGCTTTGTACCTGG - Exonic
1119679692 14:76583564-76583586 GAGTACCTGGGCTTTGGAGCAGG - Intergenic
1120752508 14:88210883-88210905 GAATCCCTGGGCATTGTTGGTGG + Intronic
1128097595 15:64969840-64969862 GAATCCCTGGGCATGGGATCTGG - Intronic
1128337444 15:66796362-66796384 GAATCCCAGCCCTTTGTATGAGG - Intergenic
1131285783 15:91056080-91056102 AGATCCCTGGGCATTGTACCGGG - Intergenic
1134245276 16:12535041-12535063 GAGTCCCAGTGCTTTGTAGCTGG - Intronic
1139143141 16:64292599-64292621 GATTCCTTGGTCATTGTATCAGG - Intergenic
1142118368 16:88373057-88373079 GAATCCCCTGGCTTGGTACCAGG + Intergenic
1145230467 17:21169957-21169979 CAATCCCAGGTCTTTGTACCAGG - Intronic
1146952984 17:36919479-36919501 TAATCCCTGGGCTATGTATGGGG + Intergenic
1147645010 17:42028143-42028165 GACTCTCTTGGCTTTGTGTCCGG + Exonic
1156956360 18:42969430-42969452 AAATCACAGGGCTTTATATCTGG + Intronic
1158886519 18:61832803-61832825 GAAACCATGTTCTTTGTATCTGG - Intronic
1158983402 18:62788207-62788229 GAACCCCTAGGCTTTATCTCCGG + Intronic
1162148970 19:8631520-8631542 TAATCCCTGGGCTTTGTCCCAGG - Intergenic
1162917025 19:13880240-13880262 GAACTCCTGTGCTTTGTCTCGGG + Intronic
1165087966 19:33364522-33364544 GAATCCCTGTGCTTAGCGTCAGG - Intergenic
1165318105 19:35068900-35068922 GAACCCCTGGGGTCTGGATCAGG - Intergenic
1166267825 19:41695969-41695991 GATTCCCAGGGCTCTGTATGTGG + Intronic
1168455506 19:56504748-56504770 GAATCCCTGGGCTGTAAATCAGG + Intergenic
929279763 2:40065084-40065106 GCAGACCTGGGCTTTGTGTCCGG + Intergenic
929752640 2:44731866-44731888 GAATGCATGGGCTTTGTAGCTGG - Intronic
930129494 2:47835049-47835071 GAAACCCTGTTCTTTGTTTCTGG - Intronic
930674639 2:54187434-54187456 GAATCCCTGGACGTAGTCTCAGG - Intronic
931444392 2:62314624-62314646 CAATTCCTGGCCTTTGGATCAGG - Intergenic
931673318 2:64669117-64669139 GATTGACAGGGCTTTGTATCTGG - Intronic
932751401 2:74373894-74373916 CAATCCCCAGGATTTGTATCAGG - Intronic
934756866 2:96830396-96830418 GAGTCCCTGGGCCTTCTCTCTGG - Intronic
942578923 2:177395393-177395415 GAAGCCCTGGTCTTTGGTTCGGG + Intronic
944572568 2:201059387-201059409 GAATGCCTGGCCCTGGTATCAGG + Intronic
947864842 2:233389400-233389422 GAATACCTGTGTTTTTTATCAGG + Intronic
1175637170 20:60595304-60595326 GAATCCCTGGGATTTATTGCAGG + Intergenic
1176003262 20:62844181-62844203 GAATCCCTGTGCTTTGCCGCTGG - Intronic
1180955898 22:19741062-19741084 GTATCCCTGGGCTCTGGGTCAGG - Intergenic
1183226449 22:36553509-36553531 CAATCCCTGGGCCTTGGACCAGG - Intergenic
1184279433 22:43428576-43428598 GCCACCCTGGGCTTTGTCTCCGG + Intronic
1184763655 22:46560621-46560643 GACTCCCTGGGCTTTACTTCTGG - Intergenic
1184838956 22:47041320-47041342 GTCTCCCTGGGCTTCGGATCTGG + Intronic
953011511 3:39029873-39029895 GAATGCCTGTGCTTTCTATAGGG + Intergenic
953278603 3:41529874-41529896 CAATACCTGGTCTTTGTGTCTGG - Intronic
954456288 3:50601425-50601447 GGATCCCTGGGCCTTGTGTAGGG - Intergenic
957690612 3:83561571-83561593 GAACCCCTGGGCTCAGTTTCTGG - Intergenic
961041149 3:123679391-123679413 GATACCCTGGGATTTGTTTCTGG - Intronic
961977176 3:131038460-131038482 GAATCCGTGTGCTTTCTATCTGG + Intronic
965384060 3:168024737-168024759 GACATCCTGGGCTTTGTATTGGG - Intronic
966109319 3:176379204-176379226 CAATCCCTGGGCTTTTGATGTGG + Intergenic
966357434 3:179096074-179096096 GAATTCCTGGGCTTTGTTCCAGG - Intergenic
968575547 4:1364416-1364438 GCACACCTGGGCTTTGTCTCTGG + Intronic
969750907 4:9110178-9110200 AAAGCCCTGTGCTTTGTGTCAGG + Intergenic
971343748 4:25793575-25793597 GAATCACTGAGCTTTGCAGCAGG + Intronic
972156777 4:36172855-36172877 AATTCTCTGGGTTTTGTATCTGG - Intronic
973249488 4:48046642-48046664 TAAGACCTGGGCTTTGTATTTGG + Intergenic
974546955 4:63323617-63323639 GACTCCCAGGTCTTTGTATCTGG - Intergenic
978423657 4:108560273-108560295 AAATCCCTGGGCTTGTTTTCTGG - Intergenic
980275754 4:130647996-130648018 AAATCCATGAACTTTGTATCAGG + Intergenic
986425388 5:7626431-7626453 GAAACCCTGGGCTCTGCACCTGG + Intronic
986931322 5:12826288-12826310 GAATCCTTGGGCTTTGGTTCTGG + Intergenic
987600138 5:20057252-20057274 GAATTCCTGGGATTTTTATATGG - Intronic
999886605 5:155930909-155930931 TAATCCCTGACATTTGTATCAGG + Intronic
1000044743 5:157512919-157512941 GAATCCCTGGGCTTTGTATCTGG + Intronic
1001684308 5:173581930-173581952 GGAGCCCTGGGCTTTGACTCTGG + Intergenic
1003260910 6:4515389-4515411 GAACCCCTAGCCTTTGTATATGG - Intergenic
1004757981 6:18633932-18633954 TAATTCCAGGGCTTTGTGTCTGG + Intergenic
1006716805 6:36125614-36125636 GAATCCTTGGGCTGAGTATCTGG + Intergenic
1007339983 6:41185229-41185251 TTATCCCTTGGCTTTCTATCTGG + Intergenic
1010060773 6:71620285-71620307 GAATCTCTGGGGTTGGGATCTGG - Intergenic
1013180431 6:107712666-107712688 GAATCTATGTGCTTTGGATCAGG - Intronic
1015427069 6:133083259-133083281 GAATCACTGGGCTTGTTATTTGG + Intergenic
1016377820 6:143441665-143441687 GAATCCCTGGTATTAGTAGCAGG - Intronic
1018085696 6:160299727-160299749 GCATCCCTGGTCTTTGTATGCGG - Intergenic
1021200467 7:17723363-17723385 GAAGCCCTGGTCTTTGTTTTTGG + Intergenic
1022855295 7:34308439-34308461 GAATGCCTGGACTTTGATTCTGG + Intergenic
1023221981 7:37928941-37928963 GAACCCCTGGGGTTTCTATGTGG - Intronic
1031995956 7:128231147-128231169 GAATCGCTGGGCTTTGTGACAGG - Intergenic
1034321514 7:150187731-150187753 GAATCCATGTGCATTGTATCAGG + Intergenic
1034771240 7:153779551-153779573 GAATCCATGTGCATTGTATCAGG - Intergenic
1035265568 7:157688905-157688927 GAACCCTTGGCCTTTGTGTCCGG - Intronic
1038173606 8:25161239-25161261 GAAGCCCAGGGCTTGGAATCAGG - Intergenic
1040314614 8:46254414-46254436 GATTCCCTAGGCTTTGGATCAGG + Intergenic
1040516147 8:48136646-48136668 GAGTCCCTGGGCATTGTCGCAGG + Intergenic
1042185651 8:66134308-66134330 GAATTCCTGGGGTTTATATAAGG + Intronic
1046511296 8:115207581-115207603 GAATCTCTGCTCTTTGTAACAGG + Intergenic
1046684495 8:117209906-117209928 GAATGCCTGTGTTTTGTGTCAGG + Intergenic
1048067370 8:130984054-130984076 GAATGTCTGGGCTTCCTATCAGG + Intronic
1048737239 8:137515379-137515401 GAATGGCTGAACTTTGTATCAGG + Intergenic
1049160460 8:141094643-141094665 GACTCCATTGGCCTTGTATCAGG - Intergenic
1057611793 9:96551081-96551103 CAAAACCTAGGCTTTGTATCAGG - Intronic
1195103030 X:101574257-101574279 GAAGCCCTGGGCTTTGGGGCTGG - Intergenic
1195288726 X:103410592-103410614 GAACCCCTGGGCTTTTTGTTTGG + Intergenic
1196059112 X:111388463-111388485 GAATCACTGGTCTTTGCCTCAGG - Intronic