ID: 1000044744

View in Genome Browser
Species Human (GRCh38)
Location 5:157512923-157512945
Sequence CCTTCCAGATACAAAGCCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000044744_1000044751 12 Left 1000044744 5:157512923-157512945 CCCTGGGCTTTGTATCTGGAAGG No data
Right 1000044751 5:157512958-157512980 CCTTAAAGGATTCTTAAACTGGG 0: 1
1: 0
2: 2
3: 21
4: 258
1000044744_1000044747 -2 Left 1000044744 5:157512923-157512945 CCCTGGGCTTTGTATCTGGAAGG No data
Right 1000044747 5:157512944-157512966 GGAACCTTAAAGAACCTTAAAGG No data
1000044744_1000044749 11 Left 1000044744 5:157512923-157512945 CCCTGGGCTTTGTATCTGGAAGG No data
Right 1000044749 5:157512957-157512979 ACCTTAAAGGATTCTTAAACTGG 0: 1
1: 0
2: 1
3: 10
4: 142

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000044744 Original CRISPR CCTTCCAGATACAAAGCCCA GGG (reversed) Intronic