ID: 1000044744

View in Genome Browser
Species Human (GRCh38)
Location 5:157512923-157512945
Sequence CCTTCCAGATACAAAGCCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 151
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 137}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000044744_1000044749 11 Left 1000044744 5:157512923-157512945 CCCTGGGCTTTGTATCTGGAAGG 0: 1
1: 0
2: 0
3: 13
4: 137
Right 1000044749 5:157512957-157512979 ACCTTAAAGGATTCTTAAACTGG 0: 1
1: 0
2: 1
3: 10
4: 142
1000044744_1000044751 12 Left 1000044744 5:157512923-157512945 CCCTGGGCTTTGTATCTGGAAGG 0: 1
1: 0
2: 0
3: 13
4: 137
Right 1000044751 5:157512958-157512980 CCTTAAAGGATTCTTAAACTGGG 0: 1
1: 0
2: 2
3: 21
4: 258
1000044744_1000044747 -2 Left 1000044744 5:157512923-157512945 CCCTGGGCTTTGTATCTGGAAGG 0: 1
1: 0
2: 0
3: 13
4: 137
Right 1000044747 5:157512944-157512966 GGAACCTTAAAGAACCTTAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000044744 Original CRISPR CCTTCCAGATACAAAGCCCA GGG (reversed) Intronic
900784046 1:4636547-4636569 CCTTCCAGTGCCACAGCCCATGG - Intergenic
901537276 1:9890723-9890745 CCTGCCAGGTGCACAGCCCATGG - Intronic
902933985 1:19751139-19751161 CCCTCCAGTTTCCAAGCCCAGGG - Intronic
903320102 1:22538073-22538095 CCTTACAGATGAGAAGCCCAAGG - Intergenic
903676354 1:25067067-25067089 CCTTAGAGATAGGAAGCCCAGGG + Intergenic
904889804 1:33771255-33771277 CATTGCAGAGACCAAGCCCAGGG - Intronic
905768922 1:40624978-40625000 CCTACCAGATACAAACCCAAGGG + Exonic
906152257 1:43594375-43594397 CCTTCCAGCTGCAAGGCACATGG + Intronic
908492846 1:64663753-64663775 CCAGCCAGAGACAAAGCGCATGG + Exonic
908901313 1:68959588-68959610 GCTTCAAGCTACACAGCCCAAGG - Intergenic
909154503 1:72055838-72055860 CTTTCAAGATAAAAAGCACAAGG + Intronic
911681282 1:100718810-100718832 CCTTGCACACACATAGCCCAAGG - Intergenic
918232813 1:182551094-182551116 CCTTCCAGAAACAAAACCTGTGG - Exonic
918429064 1:184439423-184439445 CCTTGCAGATAGATAGCCCTTGG - Intronic
920197932 1:204241914-204241936 CCTTGCAGATACAAGGAACAAGG + Intronic
920305224 1:205014301-205014323 CCTTCCAGAGCCAAAGCAGAGGG - Intronic
922340700 1:224652738-224652760 ACTTCCAGAAACCAAGCCCATGG + Intronic
924071480 1:240284847-240284869 CCTGCCAGATATAAAGCACTTGG - Intronic
1063979972 10:11444963-11444985 CCTTCCAGATGCACAGCCGTGGG - Intergenic
1066153464 10:32650175-32650197 ACTTCCAGAAGCAAAGCCAATGG - Intronic
1067901730 10:50248769-50248791 CATTCCATAGACCAAGCCCATGG + Intergenic
1076356543 10:129857682-129857704 CCATCCAGATACCAGGCCCCGGG + Intronic
1077221010 11:1416292-1416314 CCTTCCAGCCACACAGCCCGTGG + Intronic
1078056214 11:8010989-8011011 CCTTCCAGAGACTCAGCACAGGG + Intergenic
1078537964 11:12190270-12190292 TCTTCAAGAGACAAATCCCAGGG - Intronic
1078913768 11:15758490-15758512 TCTTCCAAATACAAATCCAATGG + Intergenic
1081622597 11:44627848-44627870 CCTGCCAGACACAGAGCCCAGGG - Intergenic
1084168206 11:67387005-67387027 CCTTCCAGCCCCACAGCCCAGGG + Intronic
1085513892 11:77101406-77101428 CCCTCCAGCTACAAAGCAAAAGG + Intronic
1086945284 11:92838683-92838705 CCTTCCACCCACAAAGCCCTGGG - Intronic
1088281748 11:108141861-108141883 CCTTCAATATATAAATCCCAGGG + Intronic
1088988656 11:114931201-114931223 CCTTCCAGGTAGATACCCCAGGG - Intergenic
1091319708 11:134640837-134640859 CCTTCCAGACAGAGACCCCAGGG - Intergenic
1091646504 12:2275951-2275973 CCTCTCAGATACAAAACCCAAGG + Intronic
1096228612 12:49885006-49885028 CTTTCCACATCCAAAGCCCTGGG - Intronic
1096403965 12:51329379-51329401 CCTTCCTAAGTCAAAGCCCAGGG - Intronic
1101721257 12:107352568-107352590 CCTTCCACATACCAAGCCATGGG + Intronic
1104479837 12:129097956-129097978 CTTTCCAGATACAACACCAAAGG - Intronic
1105815380 13:24031451-24031473 CTTTCCAGATACCAAGACAATGG + Intronic
1109529314 13:63620419-63620441 CGTTCCACATTCAAAGCCTAGGG + Intergenic
1110617207 13:77554439-77554461 CATTCCAGAAACAGACCCCAAGG + Intronic
1113077815 13:106485278-106485300 CCTTCCTAAAACAATGCCCAAGG + Intergenic
1117503506 14:56377339-56377361 ACTTCCAGAAATAAAGCCCATGG - Intergenic
1118391849 14:65302524-65302546 CCTACCAGATAGAAGGCCCTGGG + Intergenic
1118868164 14:69719355-69719377 CCTTTCAGAAGCAAGGCCCAGGG - Intergenic
1120891596 14:89496512-89496534 CCTTTCACTTCCAAAGCCCAAGG - Intronic
1123130782 14:105983707-105983729 CCTTCCAGACACAAAAGCCTTGG - Intergenic
1123581014 15:21714929-21714951 CCTTCCAGACACAAAAGCCTTGG - Intergenic
1123617663 15:22157552-22157574 CCTTCCAGACACAAAAGCCTTGG - Intergenic
1126813100 15:52428536-52428558 CCATCTAGATCCAAAGACCAAGG - Exonic
1127352638 15:58168493-58168515 CATTCCGGATGCACAGCCCAAGG - Intronic
1127832529 15:62763555-62763577 CCTTCCAGGGACAAGGCCCCTGG + Exonic
1131181885 15:90245914-90245936 CCTACCATACTCAAAGCCCAGGG - Intergenic
1132803486 16:1765338-1765360 CCTCCCAGAAACAGGGCCCAGGG - Intronic
1136145120 16:28312002-28312024 CCTTGCAGGGCCAAAGCCCAAGG + Intronic
1142786827 17:2230951-2230973 CCTTGTAGAGAAAAAGCCCAAGG + Intronic
1143811243 17:9473436-9473458 CCTTCCATATACAAAATCCATGG + Intronic
1147288417 17:39421738-39421760 CTTTCCAGATTCTAAGCTCATGG + Intronic
1149531643 17:57400393-57400415 CCTACCAGCTCCAAAGCCAAAGG - Intronic
1154045900 18:10904543-10904565 ACTTCCAGGTGCCAAGCCCAAGG - Intronic
1158886518 18:61832799-61832821 CTTGCCAGATACAAAGAACATGG + Intronic
1160780802 19:877180-877202 GCTGCCAGAGACAGAGCCCAAGG + Exonic
1164390316 19:27814074-27814096 CCTTCCAGATGCAGAGGACAGGG - Intergenic
1167266918 19:48487771-48487793 CCTCCCAGGTACAAAGTACAGGG - Intronic
1168543540 19:57231795-57231817 TTTTCCAGATACCAATCCCAAGG - Intronic
926328393 2:11804938-11804960 CTTTCTGGATAGAAAGCCCAAGG - Intronic
928562033 2:32499293-32499315 CCTTCCAAATACAAAACTAAGGG - Intronic
932048228 2:68371682-68371704 CCATCCAGCTCCAGAGCCCATGG + Intronic
932452330 2:71819886-71819908 TCTTACAGATCCAAAGGCCAAGG + Intergenic
934920930 2:98344840-98344862 CATTTCAGAAACAAAGTCCAAGG + Intronic
935313537 2:101808310-101808332 CCTTATAGCTACAGAGCCCATGG + Intronic
939052231 2:137321378-137321400 ACTTTCATATACAAAGCACAAGG - Intronic
939991398 2:148879260-148879282 CCTTCTACAGACAAAGCCCTGGG - Intronic
941618866 2:167754787-167754809 CCCTGCAGTTACAAAGACCAAGG + Intergenic
943113637 2:183639046-183639068 CCTTCCAGAGAAAAATCCCAAGG + Intergenic
943702939 2:191005983-191006005 CCTTCAAGATCCAAAGCCAGGGG + Intronic
945765640 2:213973498-213973520 CCTTCCAGAACCAGAGGCCAGGG + Intronic
947091982 2:226522037-226522059 CCATTCAGTTGCAAAGCCCAAGG - Intergenic
947305425 2:228740912-228740934 CCTGCCTGATACCAAGCACATGG - Intergenic
1169529258 20:6466556-6466578 CCTTCCATAAACAAAGAACAAGG + Intergenic
1170808634 20:19655823-19655845 CCTTCCATCTACAAAGCCTGTGG - Intronic
1172001807 20:31784188-31784210 TCTTCCAGATAGAAAGTTCAGGG + Intronic
1172330855 20:34075174-34075196 CATTCCAGAGACAAAGGCCAGGG - Intronic
1173519839 20:43691075-43691097 CCTTCCAGATAAAGAAACCAAGG + Intronic
1173754819 20:45506563-45506585 CCCTCCAGATCCAAAGTCCAGGG + Intergenic
1174076392 20:47940424-47940446 CCCTCCATATACAAAAGCCATGG - Intergenic
1178305403 21:31486699-31486721 CCTTCCTGATGGGAAGCCCAAGG + Intronic
1178595246 21:33947620-33947642 CTTCCAAGATACATAGCCCAGGG + Intergenic
1179634171 21:42696753-42696775 CCTTACAGACCCAGAGCCCAAGG - Intronic
1180087690 21:45515418-45515440 TCTTCCAGCAACAAAGCCCGCGG + Exonic
1183331855 22:37226467-37226489 TCTTCCAGAGGCAAGGCCCAAGG - Intronic
1185078034 22:48693768-48693790 CCTGGAAGATGCAAAGCCCAGGG - Intronic
1185427407 22:50780637-50780659 TGTCCCAGATACAAAGACCATGG - Intronic
950447534 3:13046998-13047020 ACATCAAGATACAAAGCACACGG + Intronic
950453005 3:13076002-13076024 CCTCCCAGATGCAAAGCCTGTGG + Intergenic
950565839 3:13769026-13769048 CCCTCCAGAGACAGAGTCCAAGG - Intergenic
951091396 3:18577598-18577620 CCTTCCAGAGAAAAAGCCTCTGG - Intergenic
951764785 3:26185516-26185538 CCTGCCACATACATATCCCATGG - Intergenic
953658468 3:44872648-44872670 TCTTCCAGACCAAAAGCCCAGGG - Intronic
953842608 3:46401355-46401377 CTTTCAAGATACAGAACCCAAGG + Intergenic
954959044 3:54548623-54548645 TCTTCCAGTTACAAAAACCAAGG + Intronic
956856819 3:73283168-73283190 CATGGCAGATACCAAGCCCAGGG - Intergenic
961722398 3:128905717-128905739 TCTTCCAGATGCTAAGCCTAGGG + Intronic
962266799 3:133949572-133949594 CCTTTCAGATGCAAGGCCCCTGG + Intronic
969319205 4:6401507-6401529 CCTTCCAGAGACCAAGGGCAAGG + Intronic
969328533 4:6458784-6458806 CCTTTCTGAAACATAGCCCAGGG - Intronic
969448895 4:7261797-7261819 CCTTCCCCAGGCAAAGCCCAGGG - Intronic
974116085 4:57580679-57580701 CCATCCATATACAAATCCCAGGG - Intergenic
976378952 4:84377781-84377803 TCTTCCAATTACATAGCCCATGG - Intergenic
976827692 4:89278983-89279005 GCCTCCAGATACAAAGTCCTGGG + Intronic
981066131 4:140488313-140488335 CCTACCACATACATAGCACATGG - Intronic
983057104 4:163111152-163111174 ACTTCTAGATACAAAGCTGAAGG + Intronic
983696303 4:170536386-170536408 ACTTCCAGATAGAAAGCTCCTGG + Intergenic
986032078 5:3904468-3904490 CCTCCCAGAGACCAGGCCCAAGG + Intergenic
986790186 5:11152004-11152026 CCTAACAGATACAAAGCTCAAGG + Intronic
989134776 5:38143019-38143041 GCTTACAGATACCAAGGCCAAGG + Intergenic
995378186 5:111502074-111502096 TTCTCCAGCTACAAAGCCCAAGG - Exonic
999972707 5:156880859-156880881 GCTTCAGGAAACAAAGCCCAAGG + Intergenic
1000044744 5:157512923-157512945 CCTTCCAGATACAAAGCCCAGGG - Intronic
1000379983 5:160620453-160620475 CCTGACAGAGTCAAAGCCCAGGG + Exonic
1001121560 5:168985146-168985168 CCTGCAAGGTGCAAAGCCCAGGG - Intronic
1001249409 5:170135132-170135154 CCCTCAAGACTCAAAGCCCAAGG + Intergenic
1001539645 5:172528427-172528449 CCTTCCAGGTCCATGGCCCAAGG + Intergenic
1002399072 5:178981173-178981195 CCATCCAGATGCACAGCCCCAGG + Exonic
1004326612 6:14680131-14680153 CCTTCGACCTACAAAGCCAAAGG - Intergenic
1008261931 6:49377291-49377313 GCTTCTATATACAAAACCCAAGG - Intergenic
1008541803 6:52552213-52552235 CCTCCCCCATGCAAAGCCCAGGG + Intronic
1012874165 6:104706294-104706316 CCTTCCAGAAACAAAATCCTGGG + Intergenic
1016902772 6:149118404-149118426 CCTTCCAGAGACAGAACACAAGG - Intergenic
1022888070 7:34667175-34667197 CCTGCCAGGTCCAGAGCCCATGG - Intronic
1024567781 7:50696803-50696825 ACTTCTAGATACATACCCCAAGG + Intronic
1024973441 7:55091551-55091573 CCTTCCAGAGAGTAAGGCCAGGG + Intronic
1028762060 7:94508380-94508402 CTTTCAAGATATAAAGTCCATGG + Intergenic
1030176673 7:106661098-106661120 CCGTCCAATGACAAAGCCCAGGG - Intergenic
1031988363 7:128178608-128178630 CCTTCCTGAGACAAAGGGCAGGG - Intergenic
1034989920 7:155541929-155541951 CCTTCCAGGTAAACAGCCCTGGG - Intergenic
1042786407 8:72551502-72551524 CCTTCTAGCAAGAAAGCCCAGGG - Intronic
1044988709 8:97776480-97776502 CCGTCGAAACACAAAGCCCACGG - Intronic
1046509547 8:115184437-115184459 TCTTCAAGATACCAAGCCCTAGG - Intergenic
1046873617 8:119229785-119229807 TCTTCCAAAAACAAAGCTCAGGG + Intronic
1052578801 9:30326807-30326829 CCTGCCATATACAAAGCCTATGG - Intergenic
1057410028 9:94809916-94809938 CCTTCCAGATACCAAGACTGCGG - Intronic
1057471891 9:95365111-95365133 CCTGCCCAATACAAAGCCCTCGG - Intergenic
1059299110 9:113298481-113298503 GCGTCCAGCTCCAAAGCCCAGGG - Exonic
1059459277 9:114419683-114419705 CATTCCAGACAGAAAGCACATGG + Intronic
1061192575 9:129090256-129090278 CATTCCAGATGCCAAGACCAGGG + Exonic
1062108910 9:134771372-134771394 CCTTCCGGAAACAAGGCTCATGG - Intronic
1187294788 X:17988308-17988330 CCTGCCATTTAAAAAGCCCACGG - Intergenic
1187298207 X:18023157-18023179 CCATCCAGACACAAAGCTGATGG + Intergenic
1189115570 X:38338922-38338944 CCTTCAAGATCCAAAGCCCCAGG + Intronic
1197979398 X:132199593-132199615 ACTTCAAGCTACTAAGCCCAGGG + Intergenic