ID: 1000044745

View in Genome Browser
Species Human (GRCh38)
Location 5:157512923-157512945
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 231
Summary {0: 1, 1: 0, 2: 2, 3: 15, 4: 213}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000044736_1000044745 8 Left 1000044736 5:157512892-157512914 CCTACCTCAATTCCCTCCTAAGT 0: 1
1: 0
2: 0
3: 18
4: 252
Right 1000044745 5:157512923-157512945 CCCTGGGCTTTGTATCTGGAAGG 0: 1
1: 0
2: 2
3: 15
4: 213
1000044732_1000044745 18 Left 1000044732 5:157512882-157512904 CCCACCCTGACCTACCTCAATTC 0: 1
1: 0
2: 2
3: 16
4: 230
Right 1000044745 5:157512923-157512945 CCCTGGGCTTTGTATCTGGAAGG 0: 1
1: 0
2: 2
3: 15
4: 213
1000044733_1000044745 17 Left 1000044733 5:157512883-157512905 CCACCCTGACCTACCTCAATTCC 0: 1
1: 0
2: 2
3: 26
4: 281
Right 1000044745 5:157512923-157512945 CCCTGGGCTTTGTATCTGGAAGG 0: 1
1: 0
2: 2
3: 15
4: 213
1000044735_1000044745 13 Left 1000044735 5:157512887-157512909 CCTGACCTACCTCAATTCCCTCC 0: 1
1: 0
2: 2
3: 15
4: 239
Right 1000044745 5:157512923-157512945 CCCTGGGCTTTGTATCTGGAAGG 0: 1
1: 0
2: 2
3: 15
4: 213
1000044737_1000044745 4 Left 1000044737 5:157512896-157512918 CCTCAATTCCCTCCTAAGTCAGA No data
Right 1000044745 5:157512923-157512945 CCCTGGGCTTTGTATCTGGAAGG 0: 1
1: 0
2: 2
3: 15
4: 213
1000044742_1000044745 -8 Left 1000044742 5:157512908-157512930 CCTAAGTCAGAGAATCCCTGGGC 0: 1
1: 0
2: 2
3: 18
4: 148
Right 1000044745 5:157512923-157512945 CCCTGGGCTTTGTATCTGGAAGG 0: 1
1: 0
2: 2
3: 15
4: 213
1000044738_1000044745 -4 Left 1000044738 5:157512904-157512926 CCCTCCTAAGTCAGAGAATCCCT No data
Right 1000044745 5:157512923-157512945 CCCTGGGCTTTGTATCTGGAAGG 0: 1
1: 0
2: 2
3: 15
4: 213
1000044734_1000044745 14 Left 1000044734 5:157512886-157512908 CCCTGACCTACCTCAATTCCCTC 0: 1
1: 0
2: 0
3: 18
4: 276
Right 1000044745 5:157512923-157512945 CCCTGGGCTTTGTATCTGGAAGG 0: 1
1: 0
2: 2
3: 15
4: 213
1000044739_1000044745 -5 Left 1000044739 5:157512905-157512927 CCTCCTAAGTCAGAGAATCCCTG 0: 1
1: 0
2: 0
3: 11
4: 171
Right 1000044745 5:157512923-157512945 CCCTGGGCTTTGTATCTGGAAGG 0: 1
1: 0
2: 2
3: 15
4: 213

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type