ID: 1000044745

View in Genome Browser
Species Human (GRCh38)
Location 5:157512923-157512945
Sequence CCCTGGGCTTTGTATCTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 231
Summary {0: 1, 1: 0, 2: 2, 3: 15, 4: 213}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000044734_1000044745 14 Left 1000044734 5:157512886-157512908 CCCTGACCTACCTCAATTCCCTC 0: 1
1: 0
2: 0
3: 18
4: 276
Right 1000044745 5:157512923-157512945 CCCTGGGCTTTGTATCTGGAAGG 0: 1
1: 0
2: 2
3: 15
4: 213
1000044732_1000044745 18 Left 1000044732 5:157512882-157512904 CCCACCCTGACCTACCTCAATTC 0: 1
1: 0
2: 2
3: 16
4: 230
Right 1000044745 5:157512923-157512945 CCCTGGGCTTTGTATCTGGAAGG 0: 1
1: 0
2: 2
3: 15
4: 213
1000044737_1000044745 4 Left 1000044737 5:157512896-157512918 CCTCAATTCCCTCCTAAGTCAGA 0: 1
1: 2
2: 2
3: 26
4: 199
Right 1000044745 5:157512923-157512945 CCCTGGGCTTTGTATCTGGAAGG 0: 1
1: 0
2: 2
3: 15
4: 213
1000044735_1000044745 13 Left 1000044735 5:157512887-157512909 CCTGACCTACCTCAATTCCCTCC 0: 1
1: 0
2: 2
3: 15
4: 239
Right 1000044745 5:157512923-157512945 CCCTGGGCTTTGTATCTGGAAGG 0: 1
1: 0
2: 2
3: 15
4: 213
1000044742_1000044745 -8 Left 1000044742 5:157512908-157512930 CCTAAGTCAGAGAATCCCTGGGC 0: 1
1: 0
2: 2
3: 18
4: 148
Right 1000044745 5:157512923-157512945 CCCTGGGCTTTGTATCTGGAAGG 0: 1
1: 0
2: 2
3: 15
4: 213
1000044739_1000044745 -5 Left 1000044739 5:157512905-157512927 CCTCCTAAGTCAGAGAATCCCTG 0: 1
1: 0
2: 0
3: 11
4: 171
Right 1000044745 5:157512923-157512945 CCCTGGGCTTTGTATCTGGAAGG 0: 1
1: 0
2: 2
3: 15
4: 213
1000044738_1000044745 -4 Left 1000044738 5:157512904-157512926 CCCTCCTAAGTCAGAGAATCCCT 0: 1
1: 0
2: 3
3: 13
4: 204
Right 1000044745 5:157512923-157512945 CCCTGGGCTTTGTATCTGGAAGG 0: 1
1: 0
2: 2
3: 15
4: 213
1000044733_1000044745 17 Left 1000044733 5:157512883-157512905 CCACCCTGACCTACCTCAATTCC 0: 1
1: 0
2: 2
3: 26
4: 281
Right 1000044745 5:157512923-157512945 CCCTGGGCTTTGTATCTGGAAGG 0: 1
1: 0
2: 2
3: 15
4: 213
1000044736_1000044745 8 Left 1000044736 5:157512892-157512914 CCTACCTCAATTCCCTCCTAAGT 0: 1
1: 0
2: 0
3: 18
4: 252
Right 1000044745 5:157512923-157512945 CCCTGGGCTTTGTATCTGGAAGG 0: 1
1: 0
2: 2
3: 15
4: 213

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000044745 Original CRISPR CCCTGGGCTTTGTATCTGGA AGG Intronic
902237782 1:15068677-15068699 GCCTGAGTTTTGTATCTGGGGGG - Intronic
902933986 1:19751139-19751161 CCCTGGGCTTGGAAACTGGAGGG + Intronic
903609644 1:24601034-24601056 CCCTGGGCTTTGGAACTGCCTGG + Intronic
903676353 1:25067067-25067089 CCCTGGGCTTCCTATCTCTAAGG - Intergenic
904920749 1:34006172-34006194 ACCTTGGCTTTGTATTTGGCTGG - Intronic
905768921 1:40624978-40625000 CCCTTGGGTTTGTATCTGGTAGG - Exonic
906116379 1:43359737-43359759 GCCTGGGCTTTGAACCTGAACGG + Exonic
908492845 1:64663753-64663775 CCATGCGCTTTGTCTCTGGCTGG - Exonic
908985762 1:70018751-70018773 CTCTTTGCTTTGTTTCTGGATGG - Exonic
910276717 1:85457255-85457277 TCCTGTTCTCTGTATCTGGAAGG + Intronic
919015769 1:192033091-192033113 CTCTGGGCTTTTTATTTGCATGG + Intergenic
920305225 1:205014301-205014323 CCCTCTGCTTTGGCTCTGGAAGG + Intronic
921293165 1:213677626-213677648 CACTGGGCATTGTATGTGGGGGG + Intergenic
922018777 1:221682373-221682395 CAGTAAGCTTTGTATCTGGAGGG - Intergenic
1063979973 10:11444963-11444985 CCCACGGCTGTGCATCTGGAAGG + Intergenic
1067451113 10:46382651-46382673 TCCTTGGCTTCGTATCTGTATGG - Exonic
1067586129 10:47477100-47477122 TCCTTGGCTTCGTATCTGTATGG + Exonic
1068223942 10:54082102-54082124 CTATGGTCTTTGTTTCTGGAGGG + Intronic
1070813333 10:79309276-79309298 CCCTCAGCTTCGTATCTGGCTGG - Intronic
1071039566 10:81290196-81290218 TCCTGGGCTTTTTTTCTGGTTGG - Intergenic
1072832554 10:98674420-98674442 CTCAGTGCTTTTTATCTGGAAGG - Intronic
1073154056 10:101332622-101332644 CCCTGGCCTTTGGCCCTGGAGGG - Intergenic
1075547621 10:123367131-123367153 CACTGGGCTTTGTATCTTCATGG - Intergenic
1075618794 10:123910560-123910582 GCCTGGGGCTTGTATCTGGGAGG - Intronic
1076356542 10:129857682-129857704 CCCGGGGCCTGGTATCTGGATGG - Intronic
1076734106 10:132451119-132451141 CCCTGGGCTTTGGAACATGAGGG - Intergenic
1078056213 11:8010989-8011011 CCCTGTGCTGAGTCTCTGGAAGG - Intergenic
1078062977 11:8060277-8060299 GCCTGGACCTTGTTTCTGGAAGG + Intronic
1078335044 11:10456483-10456505 CACTGGGCTTCCTTTCTGGAGGG + Intronic
1078935581 11:15946697-15946719 CCCTCAGCTTTGTCCCTGGATGG + Intergenic
1079953705 11:26836375-26836397 ATCTGGGCTTTGTTTCTGGATGG + Intergenic
1080430725 11:32196534-32196556 CCCTGATCTTTGATTCTGGATGG - Intergenic
1081461121 11:43273884-43273906 CCCTGGGCCTGGCATCAGGAGGG + Intergenic
1081622598 11:44627848-44627870 CCCTGGGCTCTGTGTCTGGCAGG + Intergenic
1084168205 11:67387005-67387027 CCCTGGGCTGTGGGGCTGGAAGG - Intronic
1084316305 11:68347785-68347807 CCCAGGGCTGTGTATCTTGCTGG + Intronic
1085513891 11:77101406-77101428 CCTTTTGCTTTGTAGCTGGAGGG - Intronic
1086945285 11:92838683-92838705 CCCAGGGCTTTGTGGGTGGAAGG + Intronic
1088281747 11:108141861-108141883 CCCTGGGATTTATATATTGAAGG - Intronic
1088988657 11:114931201-114931223 CCCTGGGGTATCTACCTGGAAGG + Intergenic
1089692067 11:120193160-120193182 TCCTGAACTTTGTCTCTGGAGGG - Intergenic
1091319709 11:134640837-134640859 CCCTGGGGTCTCTGTCTGGAAGG + Intergenic
1091646503 12:2275951-2275973 CCTTGGGTTTTGTATCTGAGAGG - Intronic
1091871056 12:3891628-3891650 GCCTGGGATTTGTAACTGGACGG - Intergenic
1092940905 12:13406053-13406075 CTCTCTGCTTTGTATCTGGACGG + Intergenic
1095973876 12:47925959-47925981 ACCAGGGCATTGTATCTGGCTGG + Intronic
1096403966 12:51329379-51329401 CCCTGGGCTTTGACTTAGGAAGG + Intronic
1096677681 12:53234334-53234356 CCCGGGTCTTTGTCTCTGGTGGG + Intergenic
1097422029 12:59391739-59391761 CCCTGGCCTTTCTCTCTGGCTGG - Intergenic
1099860170 12:88216643-88216665 CCCTGGGCTTTTTTTTTGGTGGG - Intergenic
1100856612 12:98762844-98762866 CACTGGGCTTTGCATCTCTAGGG + Intronic
1101721256 12:107352568-107352590 CCCATGGCTTGGTATGTGGAAGG - Intronic
1102454398 12:113062899-113062921 CTCTGGGCTCTGGACCTGGAGGG - Intronic
1102627383 12:114246014-114246036 CCCTAAGCTGTGTATCTGAATGG + Intergenic
1102841314 12:116126873-116126895 TCCTGGGTTTTGTAACTAGAAGG - Intronic
1102961696 12:117097511-117097533 CCCACTGCTTTGAATCTGGATGG - Intronic
1105427569 13:20307447-20307469 GCCTTGGCTTTCTATGTGGAGGG + Intergenic
1106129432 13:26927228-26927250 CTCTAGGCTTTGCATCTGGCGGG - Intergenic
1106209999 13:27633254-27633276 GGCAGGGCTTTGTATCTGCAAGG + Intronic
1106500386 13:30322695-30322717 CCCTGGTCATCGTCTCTGGATGG + Intergenic
1106910902 13:34462824-34462846 ACCTGGGCTCTGTACCTGGCAGG + Intergenic
1108127753 13:47263059-47263081 CCCTGGCATTTGTACCTGGTTGG + Intergenic
1112321862 13:98415162-98415184 CACTGGGCTTGGGAACTGGAGGG + Intronic
1112877581 13:104063759-104063781 ACCTGGTCTTTATTTCTGGAGGG - Intergenic
1113756531 13:112815497-112815519 GCCTGGGCTGTGTGTCTGAAGGG - Intronic
1113769672 13:112899950-112899972 CCCTTGGGTTGGTTTCTGGATGG + Intronic
1116090255 14:40295700-40295722 CAATTGGCTTTGTTTCTGGATGG + Intergenic
1118391848 14:65302524-65302546 CCCAGGGCCTTCTATCTGGTAGG - Intergenic
1118868165 14:69719355-69719377 CCCTGGGCCTTGCTTCTGAAAGG + Intergenic
1119758934 14:77138109-77138131 CCCTGGCCTTTGACTCTGAATGG - Intronic
1119778280 14:77261448-77261470 CACTGGGCTCTGTGTTTGGAGGG - Intergenic
1119854851 14:77891789-77891811 CACTGGGCTTCGTCTCTGGTGGG + Intronic
1120828407 14:88975800-88975822 CACTGTGCTTTATACCTGGAAGG + Intergenic
1121003496 14:90470315-90470337 TCCTGGGCTTTGTTTTTGGTTGG + Intergenic
1124402535 15:29362070-29362092 CCCTGGGATGTGCCTCTGGATGG - Intronic
1126654690 15:50964675-50964697 GCTTGGGCTTTGATTCTGGATGG + Intronic
1126813101 15:52428536-52428558 CCTTGGTCTTTGGATCTAGATGG + Exonic
1130161642 15:81407564-81407586 CCCTGGGCTCTGATTCTGAAGGG - Intergenic
1131070228 15:89461359-89461381 GCCTGGGCGTTGTATCTGTGTGG - Intergenic
1131181886 15:90245914-90245936 CCCTGGGCTTTGAGTATGGTAGG + Intergenic
1132316114 15:100891696-100891718 CCCTGGGCTATGTGTCAGGGCGG + Intronic
1132520028 16:382585-382607 CCCGGCGCTTTGCACCTGGATGG + Intronic
1132803487 16:1765338-1765360 CCCTGGGCCCTGTTTCTGGGAGG + Intronic
1135960077 16:26987913-26987935 CTCTGGACTTTGAATCTAGAGGG - Intergenic
1137568654 16:49550537-49550559 GCCTGGGCTTTGGTTCTGGCTGG - Intronic
1143811242 17:9473436-9473458 CCATGGATTTTGTATATGGAAGG - Intronic
1144943887 17:18960031-18960053 CCCTGGGCTGCGTACCTGAATGG + Intronic
1145740625 17:27271307-27271329 CCCTAGGCATAGTAACTGGAGGG + Intergenic
1149439842 17:56664892-56664914 CCCCGGGCTTTGTCTCTGATTGG - Intergenic
1150824271 17:68460874-68460896 CCCTTGGCTTTTTATATGAATGG - Intergenic
1152419206 17:80182983-80183005 CCCTGGGCCTTGACTCTGAAGGG + Intronic
1152993725 18:386568-386590 GCCTTGGGTTTGTATCTGAAGGG - Intronic
1153066359 18:1050106-1050128 CCCTGGTCTCTTTATCTTGAGGG - Intergenic
1153675994 18:7456067-7456089 CCCTGGACGGTGTTTCTGGAGGG - Intergenic
1155344153 18:24842120-24842142 CTTTGAGCTTTGTATCTGCAAGG - Intergenic
1155381095 18:25223470-25223492 CCCTGGGGTTTTCATTTGGATGG + Intronic
1161398812 19:4058766-4058788 CCCTGGGCTTTGGGTCCGGCTGG - Intronic
1163604502 19:18266593-18266615 CCCTGGGTTTGGGCTCTGGATGG + Exonic
1164390317 19:27814074-27814096 CCCTGTCCTCTGCATCTGGAAGG + Intergenic
1164906959 19:31975534-31975556 CACTGGAATTTGTATCTGCATGG + Intergenic
1165372819 19:35420517-35420539 ACCTGGGCTTGGTAACTGGCTGG - Intergenic
1166538522 19:43591209-43591231 CAGTGGGCTTTGAATCTTGATGG - Exonic
1166563628 19:43749775-43749797 CCCTGGGCTGGGAATCAGGAGGG - Intronic
1167266919 19:48487771-48487793 CCCTGTACTTTGTACCTGGGAGG + Intronic
1168041272 19:53760911-53760933 TCCTGAGTTTTGTCTCTGGAAGG - Intergenic
925259733 2:2519180-2519202 CTCTGGGCATTGAAACTGGAGGG - Intergenic
927201967 2:20583558-20583580 CTCTGGACTTTGAAGCTGGAAGG - Intronic
928562034 2:32499293-32499315 CCCTTAGTTTTGTATTTGGAAGG + Intronic
932048227 2:68371682-68371704 CCATGGGCTCTGGAGCTGGATGG - Intronic
933260425 2:80125867-80125889 CCCTGGGCTTTCTATCATGTGGG - Intronic
936562735 2:113555895-113555917 CCCTGGGATCTGTATCTGTGTGG + Intergenic
937402596 2:121597881-121597903 GCCTGGGCTATGCAACTGGAGGG - Intronic
937428857 2:121821597-121821619 CACTGGGCTTAGTGTCAGGAGGG + Intergenic
937854861 2:126664842-126664864 CCCTGGGCTGGGCATCTGCAGGG + Intronic
938192884 2:129299582-129299604 GCCTGGGCTCTGGAGCTGGAAGG - Intergenic
939991399 2:148879260-148879282 CCCAGGGCTTTGTCTGTAGAAGG + Intronic
941618865 2:167754787-167754809 CCTTGGTCTTTGTAACTGCAGGG - Intergenic
942088757 2:172467526-172467548 CCCTGGACCTTGGCTCTGGACGG - Exonic
942441898 2:176045437-176045459 CCCTGTGCTTGGTATATGAAGGG + Intergenic
943113636 2:183639046-183639068 CCTTGGGATTTTTCTCTGGAAGG - Intergenic
943353719 2:186824571-186824593 ACTTGGGCTTGGTTTCTGGATGG + Intergenic
943702938 2:191005983-191006005 CCCCTGGCTTTGGATCTTGAAGG - Intronic
945765639 2:213973498-213973520 CCCTGGCCTCTGGTTCTGGAAGG - Intronic
946675856 2:222158567-222158589 GCCTGTGCTTTGGATTTGGAGGG - Intergenic
946688080 2:222291334-222291356 TCCTGGGCTATGGAGCTGGAGGG + Intronic
947091983 2:226522037-226522059 CCTTGGGCTTTGCAACTGAATGG + Intergenic
948109152 2:235440512-235440534 CCCTGGGCTTGGTAGCTGTGTGG - Intergenic
948590912 2:239049733-239049755 CCCAGGGCTCTGGTTCTGGAGGG - Exonic
1169812268 20:9620276-9620298 CACTGGGCTTGGTATTTGGCTGG + Intronic
1171424274 20:25039861-25039883 AGCTGGGCTTTGTGTCTGGAAGG - Intronic
1172933378 20:38601533-38601555 CCCAGGGGTTTTTATCTGGCTGG - Intergenic
1173318607 20:41967696-41967718 TCCTGGGCTTTGTTTTTGGTTGG + Intergenic
1173754818 20:45506563-45506585 CCCTGGACTTTGGATCTGGAGGG - Intergenic
1173756877 20:45524624-45524646 ACCTGGGTTTTGTGTTTGGAGGG - Intergenic
1174076393 20:47940424-47940446 CCATGGCTTTTGTATATGGAGGG + Intergenic
1175113064 20:56662630-56662652 TCCTCGGCTGTGTGTCTGGAGGG + Intergenic
1176516381 21:7787085-7787107 CCCCGAGCTTTGTTTATGGAGGG - Intergenic
1178650409 21:34417097-34417119 CCCCGAGCTTTGTTTATGGAGGG - Intergenic
1181666004 22:24397811-24397833 CTCTGGACTTTGTTTCTGGATGG + Intronic
1184743777 22:46444274-46444296 GACAGCGCTTTGTATCTGGAAGG + Intronic
1185078035 22:48693768-48693790 CCCTGGGCTTTGCATCTTCCAGG + Intronic
950565840 3:13769026-13769048 CCTTGGACTCTGTCTCTGGAGGG + Intergenic
950726855 3:14922342-14922364 CACTGGGCTCTGCATCTGGCTGG + Intronic
951266858 3:20577743-20577765 ACCTGGAACTTGTATCTGGAGGG - Intergenic
951308742 3:21098526-21098548 CCCTGAGCTCTGGATCTTGAGGG + Intergenic
953574186 3:44099710-44099732 GCCTCGGGTTTGTATCAGGATGG - Intergenic
955611698 3:60764348-60764370 CTTTGGGCTTTGTTTCTGAAAGG - Intronic
969197443 4:5574221-5574243 CTCAGGGCTCTGTATCAGGAAGG + Intronic
969328534 4:6458784-6458806 CCCTGGGCTATGTTTCAGAAAGG + Intronic
969448896 4:7261797-7261819 CCCTGGGCTTTGCCTGGGGAAGG + Intronic
969525127 4:7700403-7700425 CCCTAGGCTATGAATCTGTAGGG + Intronic
972657829 4:41082646-41082668 CCCTGGGATTTGAAGCTGCAGGG - Intronic
974116086 4:57580679-57580701 CCCTGGGATTTGTATATGGATGG + Intergenic
977398004 4:96495061-96495083 CCCTCAGCTTTGATTCTGGATGG - Intergenic
977697102 4:99977878-99977900 TACTAGGCTTTGTACCTGGATGG + Intergenic
981588409 4:146328756-146328778 GCCTTGGCTTTGATTCTGGATGG - Intronic
985765450 5:1777098-1777120 CCCAGGTCTTTGCCTCTGGAGGG + Intergenic
986338391 5:6770987-6771009 GCTTGGCCTTTGCATCTGGATGG + Intergenic
986790185 5:11152004-11152026 CCTTGAGCTTTGTATCTGTTAGG - Intronic
987837116 5:23175956-23175978 CCCTGGGCTTTTTTTTTGGTTGG + Intergenic
989085137 5:37668117-37668139 TCTTGGGCTTTCTCTCTGGAAGG + Intronic
996988868 5:129603847-129603869 ACATGGGCTTTGGATTTGGATGG - Intronic
999284686 5:150387372-150387394 TCCTGGGCCATGTATCAGGAGGG + Intronic
1000044745 5:157512923-157512945 CCCTGGGCTTTGTATCTGGAAGG + Intronic
1000379982 5:160620453-160620475 CCCTGGGCTTTGACTCTGTCAGG - Exonic
1001121561 5:168985146-168985168 CCCTGGGCTTTGCACCTTGCAGG + Intronic
1001249408 5:170135132-170135154 CCTTGGGCTTTGAGTCTTGAGGG - Intergenic
1001445274 5:171777908-171777930 CCCAGAGCTTTGAATCTGCAGGG + Intergenic
1002399071 5:178981173-178981195 CCTGGGGCTGTGCATCTGGATGG - Exonic
1002450486 5:179315675-179315697 GGCTGTGCTTTGTCTCTGGAAGG - Intronic
1002887946 6:1312514-1312536 CGCTGGGCTTTTTCTCTGGAGGG - Exonic
1003351017 6:5317893-5317915 CCCTGTGCTCTTTCTCTGGAGGG + Intronic
1003936644 6:10981658-10981680 TCCTGGGCTTCATATCTGTATGG - Exonic
1004894434 6:20133598-20133620 CACTGGGCTTTGTATAAGGAAGG - Intronic
1008541802 6:52552213-52552235 CCCTGGGCTTTGCATGGGGGAGG - Intronic
1008630601 6:53359776-53359798 CTCTGGGCTCTGGATCTGAAGGG - Intergenic
1010497264 6:76550023-76550045 TACTAGGCTTAGTATCTGGATGG - Intergenic
1011448384 6:87467428-87467450 CCCTGGCATTTGTATCTTGTTGG + Intronic
1011786997 6:90857997-90858019 CCCTGAACTTTGCATGTGGAGGG - Intergenic
1012687127 6:102266097-102266119 CCCTGGGCTTTTTTTTTGGTTGG - Intergenic
1012792594 6:103716242-103716264 GTCTGGGGTTTCTATCTGGAAGG + Intergenic
1012874164 6:104706294-104706316 CCCAGGATTTTGTTTCTGGAAGG - Intergenic
1017729824 6:157305521-157305543 GCTGGGGCTATGTATCTGGACGG + Intronic
1018145048 6:160877860-160877882 CAGTTGGCTTTGTTTCTGGAAGG - Intergenic
1018199651 6:161383406-161383428 CTCTCTGCTTTGCATCTGGAAGG + Intronic
1019302301 7:311974-311996 GGCTGGGCTTTGTTTCTGGCTGG + Intergenic
1019538747 7:1541976-1541998 GCCTGGGCTCTGTAGCTGGTGGG - Exonic
1020977630 7:15026548-15026570 CCCTGGATTTTGTATCTGACGGG + Intergenic
1024973440 7:55091551-55091573 CCCTGGCCTTACTCTCTGGAAGG - Intronic
1027222601 7:76223677-76223699 CACTGGGCTTTTTCTCTGGAAGG + Intronic
1027865284 7:83638746-83638768 CACTGGGCTGTGTGTGTGGAAGG - Intronic
1029687991 7:102162183-102162205 CCCTGGCCTTTCTTTCTGGTCGG - Intronic
1030176674 7:106661098-106661120 CCCTGGGCTTTGTCATTGGACGG + Intergenic
1030333282 7:108295921-108295943 CCCTCTGCTTTGTATATGGGGGG + Intronic
1031988364 7:128178608-128178630 CCCTGCCCTTTGTCTCAGGAAGG + Intergenic
1033974030 7:147077618-147077640 CACTGGGCTGTGTAGCTAGATGG - Intronic
1034989921 7:155541929-155541951 CCCAGGGCTGTTTACCTGGAAGG + Intergenic
1036379135 8:8225777-8225799 CTCTTGGATTTGAATCTGGAAGG - Intergenic
1036926391 8:12909842-12909864 CCCTGTGCTTTGAATTTTGAGGG + Intergenic
1036926473 8:12911172-12911194 CTCTGGGCTTTGAATTTCGAGGG + Intergenic
1038323218 8:26548391-26548413 CCCTGGGCTCAGTATATAGACGG - Intronic
1039584062 8:38690887-38690909 GCCTGGGCTTTGGAAATGGAAGG + Intergenic
1040392560 8:46962161-46962183 CCCAGGGCTTTGCTGCTGGAGGG + Intergenic
1042383787 8:68150241-68150263 CCCTGGGCCTCCTTTCTGGATGG + Intronic
1042786408 8:72551502-72551524 CCCTGGGCTTTCTTGCTAGAAGG + Intronic
1043235965 8:77867377-77867399 TCCTGGGCTTTGTTTTTGGTTGG - Intergenic
1044171066 8:89052377-89052399 TACTGGGCTCTGTGTCTGGAAGG + Intergenic
1044988710 8:97776480-97776502 CCGTGGGCTTTGTGTTTCGACGG + Intronic
1045727754 8:105195613-105195635 CCCCAGGCTTTGTATGTGCAGGG + Intronic
1049242174 8:141543634-141543656 TCCTGAGCTTTGTGTCTGCAGGG - Intergenic
1049415431 8:142492799-142492821 CCCTGGGCTTTGCATTTTCAGGG + Intronic
1049889997 9:59804-59826 CCCTGGGATCTGTATCTGTGTGG - Intergenic
1052578802 9:30326807-30326829 CCATAGGCTTTGTATATGGCAGG + Intergenic
1053062614 9:35043848-35043870 CACTGGGGCTTATATCTGGATGG - Exonic
1053436953 9:38082091-38082113 ACCTGGGCTTTGTATACTGACGG + Intergenic
1053466061 9:38309524-38309546 CGCTGGGCTTTCCATCTGGCTGG + Intergenic
1053731476 9:41061079-41061101 CCCTGGGATCTGTATCTGTGTGG - Intergenic
1054697035 9:68371016-68371038 CCCTGGGATCTGTATCTGTGTGG + Intronic
1055830619 9:80374202-80374224 CCCTGACCTTGGTATGTGGAGGG + Intergenic
1056304217 9:85273339-85273361 CTCTTGGCTTTGTATGGGGAGGG - Intergenic
1057382975 9:94585365-94585387 CCCTGGGGTTTGTTTCCGGGGGG + Intronic
1057843987 9:98507819-98507841 CCCTGTGCTAGGCATCTGGAGGG - Intronic
1060767595 9:126306728-126306750 CCCTGGGCTTCATGTCTGCAGGG + Intergenic
1187298206 X:18023157-18023179 CCATCAGCTTTGTGTCTGGATGG - Intergenic
1187548008 X:20271253-20271275 CTTTGAACTTTGTATCTGGAAGG - Intergenic
1189115569 X:38338922-38338944 CCTGGGGCTTTGGATCTTGAAGG - Intronic
1192883265 X:75310467-75310489 TCCTGGGCTTTGTTTTTGGTTGG + Intergenic
1193318366 X:80091806-80091828 TCCAGGGCTTCGTATGTGGAAGG + Intergenic
1194590874 X:95798191-95798213 CCCTGGGTTTTGGATTTGCATGG + Intergenic
1195144945 X:102003931-102003953 TCCTGGGCTTTTTATCTGGTTGG - Intergenic
1200232228 X:154449776-154449798 CCCTGGGCTTTGGCTCAGGCTGG + Intronic