ID: 1000044746

View in Genome Browser
Species Human (GRCh38)
Location 5:157512924-157512946
Sequence TCCTTCCAGATACAAAGCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 203
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 190}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000044746_1000044749 10 Left 1000044746 5:157512924-157512946 CCTGGGCTTTGTATCTGGAAGGA 0: 1
1: 0
2: 0
3: 12
4: 190
Right 1000044749 5:157512957-157512979 ACCTTAAAGGATTCTTAAACTGG 0: 1
1: 0
2: 1
3: 10
4: 142
1000044746_1000044751 11 Left 1000044746 5:157512924-157512946 CCTGGGCTTTGTATCTGGAAGGA 0: 1
1: 0
2: 0
3: 12
4: 190
Right 1000044751 5:157512958-157512980 CCTTAAAGGATTCTTAAACTGGG 0: 1
1: 0
2: 2
3: 21
4: 258
1000044746_1000044747 -3 Left 1000044746 5:157512924-157512946 CCTGGGCTTTGTATCTGGAAGGA 0: 1
1: 0
2: 0
3: 12
4: 190
Right 1000044747 5:157512944-157512966 GGAACCTTAAAGAACCTTAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000044746 Original CRISPR TCCTTCCAGATACAAAGCCC AGG (reversed) Intronic
900320722 1:2082236-2082258 TCTTGCCAAATACACAGCCCTGG - Intronic
903679364 1:25087061-25087083 TCCTTCCAGCTTCACAGCCTGGG + Intergenic
903682451 1:25106326-25106348 ACTTTCCAGATATAAAGTCCTGG + Intergenic
905768920 1:40624977-40624999 CCCTACCAGATACAAACCCAAGG + Exonic
906106760 1:43299416-43299438 TCATTCCAGATTCAAAGGTCTGG + Intergenic
907916317 1:58873156-58873178 TTCTTCCAGTTACTTAGCCCTGG + Intergenic
910276718 1:85457256-85457278 ACCTTCCAGATACAGAGAACAGG - Intronic
915615242 1:157032783-157032805 TCCTCCCAGTTACTAAGTCCAGG + Intronic
916162245 1:161929355-161929377 TACTTCCAGAACCAAAGCCATGG + Intronic
917748135 1:178030391-178030413 TCCTTCCAGCTACTAGACCCTGG - Intergenic
920847641 1:209607203-209607225 TCCCACCAGGTACAAAGCTCTGG + Intronic
923539217 1:234876156-234876178 TCCTTCCAGAGACAGTGCCAGGG - Intergenic
924011590 1:239671275-239671297 TTCTTCAAAATAAAAAGCCCAGG + Intronic
1063914053 10:10863170-10863192 TCCTCCCAGCTACACTGCCCAGG + Intergenic
1063979974 10:11444964-11444986 ACCTTCCAGATGCACAGCCGTGG - Intergenic
1064749994 10:18518795-18518817 TCTTTCCAGATGCAAAGCTCAGG + Intronic
1065165357 10:22971049-22971071 TCCTTCCTCATACAAACTCCTGG + Intronic
1066140141 10:32496872-32496894 ACCTTCCTGATACCAAGACCTGG - Intronic
1068005625 10:51390209-51390231 TCATTTCAGATATAAAGCCATGG - Intronic
1069913587 10:71773899-71773921 GCCTACCACATACCAAGCCCTGG - Intronic
1070590687 10:77798634-77798656 GCCTCCCAGAAACACAGCCCCGG - Intronic
1074402578 10:113154001-113154023 TCCTTCCTGATTCAACTCCCAGG - Intronic
1075528663 10:123208443-123208465 TTGTTCCAGATTCAAAGTCCTGG + Intergenic
1075618793 10:123910559-123910581 CCCTCCCAGATACAAGCCCCAGG + Intronic
1076089574 10:127670580-127670602 TCCTTCCATATTCCATGCCCTGG - Intergenic
1076356541 10:129857681-129857703 GCCATCCAGATACCAGGCCCCGG + Intronic
1076472421 10:130728260-130728282 TCCTGCCTGATTAAAAGCCCTGG - Intergenic
1078062978 11:8060278-8060300 CCCTTCCAGAAACAAGGTCCAGG - Intronic
1078394887 11:10972242-10972264 TCCTACATGTTACAAAGCCCAGG - Intergenic
1078508880 11:11970749-11970771 CCCTTCCATCTACAAAGCCAGGG - Intronic
1078537965 11:12190271-12190293 TTCTTCAAGAGACAAATCCCAGG - Intronic
1078637302 11:13064121-13064143 TCCTTGCAGAAATAAAGCACGGG - Intergenic
1080288013 11:30639212-30639234 TCCTTCCAGAGACAAAAACTGGG + Intergenic
1081622599 11:44627849-44627871 ACCTGCCAGACACAGAGCCCAGG - Intergenic
1082706585 11:56500018-56500040 TCCTTCCAAAAAGAAAACCCAGG + Intergenic
1083748388 11:64747345-64747367 TCCTGGCAGGTACAATGCCCAGG - Exonic
1083752320 11:64767426-64767448 TCCTTCCAGAGCCACAACCCTGG + Intronic
1085184405 11:74563226-74563248 TCCTTCCAAGTACAGAGCCCTGG - Intronic
1085475984 11:76789142-76789164 GCCTTCCAGCTCCCAAGCCCTGG + Intronic
1086945286 11:92838684-92838706 ACCTTCCACCCACAAAGCCCTGG - Intronic
1087121179 11:94575996-94576018 TCCTACCAGATATATACCCCAGG + Intronic
1088031107 11:105251947-105251969 TCCTTCCAAAAACATAGCCTTGG + Intergenic
1089044584 11:115489248-115489270 TCCTTCAAGATACAAAAGTCAGG + Intronic
1090430367 11:126641130-126641152 TCCTTCCAGTTACTCAGACCAGG + Intronic
1090751526 11:129750400-129750422 TGCTTCCAGAGTCATAGCCCCGG - Intergenic
1091588032 12:1827208-1827230 TCCTTCCAGATGGGAGGCCCAGG - Intronic
1091605993 12:1952030-1952052 TCCTTCCAGGTAGAAAGTTCAGG + Intronic
1091622334 12:2098781-2098803 TCATTCCAGAGATAAAGCCTCGG - Intronic
1091871055 12:3891627-3891649 TCCGTCCAGTTACAAATCCCAGG + Intergenic
1095973877 12:47925960-47925982 ACCAGCCAGATACAATGCCCTGG - Intronic
1096228613 12:49885007-49885029 GCTTTCCACATCCAAAGCCCTGG - Intronic
1098558473 12:71845988-71846010 TCCTTCCTGACACAAAGAGCTGG - Intronic
1101721255 12:107352567-107352589 CCCTTCCACATACCAAGCCATGG + Intronic
1101914825 12:108887898-108887920 TCCTTCTTGATAAAAAGCCTTGG - Intronic
1102841313 12:116126872-116126894 CCCTTCTAGTTACAAAACCCAGG + Intronic
1104364197 12:128162151-128162173 ACCTTCCAGATACAGATCCTGGG + Intergenic
1105427570 13:20307448-20307470 TCCCTCCACATAGAAAGCCAAGG - Intergenic
1106506953 13:30378825-30378847 TCCTTCTAGCTACAAAACCATGG + Intergenic
1106910903 13:34462825-34462847 CCCTGCCAGGTACAGAGCCCAGG - Intergenic
1108723905 13:53160364-53160386 TCCTCACAGATAAAAATCCCAGG - Intergenic
1109529313 13:63620418-63620440 TCGTTCCACATTCAAAGCCTAGG + Intergenic
1112877580 13:104063758-104063780 TCCCTCCAGAAATAAAGACCAGG + Intergenic
1113578578 13:111412050-111412072 TCTTCCCAGATCCACAGCCCTGG + Intergenic
1114943126 14:27641491-27641513 TCCTTTCAAAAACAAAGACCAGG + Intergenic
1118391847 14:65302523-65302545 ACCTACCAGATAGAAGGCCCTGG + Intergenic
1119304300 14:73595040-73595062 TTCTTCCAGGTAAAAGGCCCAGG + Exonic
1119748727 14:77062839-77062861 TCATTCTTGATACAAAGCACTGG - Intergenic
1122323499 14:100869067-100869089 GCCTACCATGTACAAAGCCCTGG - Intergenic
1123982116 15:25613690-25613712 TCCTTTCAGAGACAAAGATCCGG + Intergenic
1124465054 15:29930529-29930551 TCATTCCTGATACAAACACCTGG + Intronic
1125415697 15:39450156-39450178 TCCTTCCTCATACATAGACCTGG - Intergenic
1125576626 15:40760130-40760152 TGCTTACAGAAACAAAGGCCAGG + Intergenic
1125708288 15:41762334-41762356 TCTTTCCAGAAAAAAAGACCAGG + Exonic
1128893820 15:71354844-71354866 ACCTTCCATATACAAAACTCTGG + Intronic
1129513078 15:76139189-76139211 TCCTTCCAGAAACAAGCCCAGGG - Intronic
1129763677 15:78147694-78147716 TCCTTCCAGCCCCAAAGACCTGG - Intronic
1130672373 15:85923818-85923840 TTCCCCCAGGTACAAAGCCCAGG - Intergenic
1131181887 15:90245915-90245937 TCCTACCATACTCAAAGCCCAGG - Intergenic
1131440690 15:92457311-92457333 TCTTTCCACATACCCAGCCCAGG + Intronic
1132520029 16:382586-382608 TCCATCCAGGTGCAAAGCGCCGG - Intronic
1132803488 16:1765339-1765361 TCCTCCCAGAAACAGGGCCCAGG - Intronic
1137580813 16:49632462-49632484 CCATTGCAGAAACAAAGCCCAGG - Intronic
1138272557 16:55706180-55706202 TGCTACCAGATACACAGCCCAGG - Exonic
1141484557 16:84330172-84330194 TCCTTCTGGATGCACAGCCCTGG - Intergenic
1142136511 16:88454125-88454147 CGCTTCTAGATACAAAGCCTGGG - Intronic
1143298057 17:5885988-5886010 TTGTTCTAGTTACAAAGCCCAGG + Intronic
1143596393 17:7916562-7916584 TTCTACCATGTACAAAGCCCCGG + Intergenic
1143788111 17:9271941-9271963 TCCTTCCAGCTAGGGAGCCCTGG - Intronic
1147718074 17:42521446-42521468 TCCTTCCATCTACAATGCACGGG - Exonic
1149439841 17:56664891-56664913 TCCAATCAGAGACAAAGCCCGGG + Intergenic
1149564367 17:57630693-57630715 TGTTTCCAGACACAAAGCCTAGG + Intronic
1151958346 17:77391976-77391998 TCCTTCCAGAAACGGAGCACTGG - Intronic
1157486631 18:48092138-48092160 CACTTCCAGACACAGAGCCCTGG + Intronic
1157565458 18:48676314-48676336 TACGTCCTGATAGAAAGCCCTGG - Intronic
1158955595 18:62535046-62535068 TCCTTCCAGCTTCTGAGCCCAGG + Intronic
1160747550 19:719155-719177 TCCTTCCAGAACCCACGCCCGGG - Intronic
1164742125 19:30583577-30583599 TCCTTCCAGAATCAAGGCTCCGG + Intronic
1165372818 19:35420516-35420538 TCCAGCCAGTTACCAAGCCCAGG + Intergenic
1168037877 19:53734656-53734678 TCTTTCCAGAGACAAAACTCAGG + Intergenic
1168039520 19:53746897-53746919 TCTTTCCAGAGACAAAACTCAGG + Intergenic
1168040730 19:53756523-53756545 TCTTTCCAGAGACAAAACTCAGG + Intergenic
1168041271 19:53760910-53760932 TCCTTCCAGAGACAAAACTCAGG + Intergenic
926792788 2:16592169-16592191 ACCTTCCAGATACAAAAATCTGG - Intronic
929823193 2:45289799-45289821 TCCTTCCAGCCAAAGAGCCCTGG - Intergenic
930568621 2:53055797-53055819 TCCTTCCCAAGACAAAGCCATGG + Intergenic
931006146 2:57851488-57851510 TCCTTCCTCAAAAAAAGCCCAGG + Intergenic
931460524 2:62446711-62446733 TACTTGCAGACACTAAGCCCTGG - Intergenic
931817840 2:65922019-65922041 TCCATCCAGCTACATATCCCTGG - Intergenic
937402595 2:121597880-121597902 TCCCTCCAGTTGCATAGCCCAGG + Intronic
938192883 2:129299581-129299603 CCCTTCCAGCTCCAGAGCCCAGG + Intergenic
938262023 2:129903212-129903234 CCTTTCCAGAGACAAGGCCCTGG - Intergenic
939991400 2:148879261-148879283 GCCTTCTACAGACAAAGCCCTGG - Intronic
941792056 2:169563162-169563184 TGCATCCACATCCAAAGCCCAGG + Intronic
943702937 2:191005982-191006004 ACCTTCAAGATCCAAAGCCAGGG + Intronic
945765638 2:213973497-213973519 TCCTTCCAGAACCAGAGGCCAGG + Intronic
946688081 2:222291335-222291357 TCCCTCCAGCTCCATAGCCCAGG - Intronic
1171202871 20:23255966-23255988 GCCTTGCAGATGCAGAGCCCTGG - Intergenic
1172001806 20:31784187-31784209 TTCTTCCAGATAGAAAGTTCAGG + Intronic
1172330856 20:34075175-34075197 CCATTCCAGAGACAAAGGCCAGG - Intronic
1173672261 20:44807000-44807022 TCCTTACAGATACGAAACCGAGG + Intronic
1173754817 20:45506562-45506584 TCCCTCCAGATCCAAAGTCCAGG + Intergenic
1173756876 20:45524623-45524645 TCCCTCCAAACACAAAACCCAGG + Intergenic
1173982880 20:47238628-47238650 GCCTTCAAGATACAATGGCCCGG + Intronic
1176188602 20:63795620-63795642 TGCTTCTAGGTCCAAAGCCCGGG + Intronic
1177320041 21:19509151-19509173 TCCTTCCAGGCACTAAGCCTAGG - Intergenic
1178595245 21:33947619-33947641 TCTTCCAAGATACATAGCCCAGG + Intergenic
1180133892 21:45847956-45847978 AGCTGCCAGATACAGAGCCCAGG - Intronic
1182251457 22:29004305-29004327 TCCTTGCTGAAAAAAAGCCCAGG + Intronic
1183565707 22:38613519-38613541 TCTTCCCAGAGACAAAGCTCAGG + Intronic
1184973819 22:48046858-48046880 TCCTTCCTGACAGGAAGCCCGGG + Intergenic
953574185 3:44099709-44099731 TCCATCCTGATACAAACCCGAGG + Intergenic
953625212 3:44565391-44565413 TCCCTCCAGAAAGAAAGCCAGGG - Intronic
956856820 3:73283169-73283191 TCATGGCAGATACCAAGCCCAGG - Intergenic
962036647 3:131658835-131658857 GCTTTCCAGAAAAAAAGCCCAGG + Intronic
965384059 3:168024732-168024754 TCATTCCCAATACAAAGCCCAGG + Intronic
966302227 3:178492621-178492643 TGCTCTCAGTTACAAAGCCCAGG + Intronic
969101735 4:4774686-4774708 TCATCCCTGATACAAAACCCTGG + Intergenic
969229091 4:5817199-5817221 TCCTTCCAAATACAGTGGCCTGG + Intronic
970157022 4:13151826-13151848 TCATTCCAGATCCCAAACCCTGG - Intergenic
971978550 4:33723098-33723120 TACTTCCACATTCAAAGCGCAGG - Intergenic
972983457 4:44734089-44734111 TTCTAACAGATAAAAAGCCCTGG - Intergenic
973893871 4:55393676-55393698 TCCTTCCTGTGAGAAAGCCCTGG + Intergenic
974116087 4:57580680-57580702 ACCATCCATATACAAATCCCAGG - Intergenic
974204789 4:58687383-58687405 TCCTTCCAGATATCAAGGCAGGG - Intergenic
976827691 4:89278982-89279004 AGCCTCCAGATACAAAGTCCTGG + Intronic
984533067 4:180941561-180941583 TCCTTCCACACAGAAAGCCAAGG - Intergenic
984872976 4:184343724-184343746 TGCTGCCAGATCCAGAGCCCAGG + Intergenic
988504302 5:31808497-31808519 ACCTTCCAGAAACCAAGTCCTGG - Intronic
991411072 5:66346378-66346400 TCCTTCCAGGTGCTAAGCACTGG + Intergenic
994310866 5:98268570-98268592 TCCTTCCAGTAGCAAAGGCCTGG - Intergenic
995582356 5:113615378-113615400 TCCTTTCAGGCACAAAGCCTTGG - Intergenic
997284798 5:132670258-132670280 TCCTACCAGCTACAAACCCTTGG + Intergenic
998112694 5:139514378-139514400 TCCTTCCAGCCAAAAAGCCGAGG + Intergenic
1000044746 5:157512924-157512946 TCCTTCCAGATACAAAGCCCAGG - Intronic
1000379981 5:160620452-160620474 TCCTGACAGAGTCAAAGCCCAGG + Exonic
1001023150 5:168200710-168200732 TCCTTCAAAAGGCAAAGCCCTGG - Intronic
1001121562 5:168985147-168985169 TCCTGCAAGGTGCAAAGCCCAGG - Intronic
1001263774 5:170256970-170256992 TCCTTGCAGACCCTAAGCCCTGG - Intronic
1001445275 5:171777909-171777931 TCCCTGCAGATTCAAAGCTCTGG - Intergenic
1001559332 5:172659054-172659076 TCCTTCCTGAGACCAAGCCAGGG + Intronic
1003109654 6:3242900-3242922 TCATCCCAGAGTCAAAGCCCCGG - Intronic
1003240791 6:4344094-4344116 TCCTTCCAGATGCAGACCCAGGG + Intergenic
1006575513 6:35042478-35042500 TCCTACCAGGTACTAAGCACTGG - Intronic
1007636471 6:43302646-43302668 TCCCTCCAGATATGAAGTCCTGG + Exonic
1008541801 6:52552212-52552234 TCCTCCCCCATGCAAAGCCCAGG + Intronic
1010787790 6:80024956-80024978 TCCTTGAAGATACAAGGCTCTGG + Intronic
1012874163 6:104706293-104706315 TCCTTCCAGAAACAAAATCCTGG + Intergenic
1013693094 6:112668173-112668195 TCCTTGCAGAGAAAAGGCCCTGG - Intergenic
1013753421 6:113433717-113433739 TCCTTGCAGATTCAGAGCCAGGG - Intergenic
1019334175 7:475190-475212 TCCCTCAAGATTCAAATCCCTGG - Intergenic
1022724618 7:32969705-32969727 TCCTTCAAGATTCCAAGGCCAGG + Intronic
1023521010 7:41049997-41050019 TCCTCCCAGACACAATGCACAGG - Intergenic
1023876337 7:44288249-44288271 TGCTTCCAGATAAGAAGACCGGG - Intronic
1023877188 7:44293210-44293232 TCCTCCCAGATACTGAGCGCCGG + Intronic
1025048981 7:55718127-55718149 TCCTTCAAGATTCCAAGGCCAGG - Intergenic
1027198685 7:76048532-76048554 TACTTTCAGATGCAGAGCCCTGG - Intronic
1028524903 7:91773340-91773362 TCATTCCAAATAGAAAACCCTGG + Intronic
1030203487 7:106929318-106929340 TCCTTCCTGATAAAAACCCTGGG - Intergenic
1034228503 7:149500917-149500939 TCCTGACAGATACAAAGGCATGG + Intergenic
1034758276 7:153644340-153644362 TAATTCCAGATACAAAGGCAGGG + Intergenic
1034989922 7:155541930-155541952 ACCTTCCAGGTAAACAGCCCTGG - Intergenic
1038306301 8:26406333-26406355 TCCTTCCAGAGAGTAAACCCTGG + Intronic
1038412550 8:27369321-27369343 TCTTTGCAGATAGAAACCCCTGG - Intronic
1039584063 8:38690888-38690910 GCCTTCCATTTCCAAAGCCCAGG - Intergenic
1040826580 8:51627800-51627822 TCCTTCCAGAACCAGGGCCCAGG - Intronic
1045494002 8:102692916-102692938 TCCGTGCAGCTCCAAAGCCCCGG - Intergenic
1047357079 8:124132551-124132573 TCTTTCCAGAAACAAACTCCTGG - Intergenic
1049102699 8:140590647-140590669 TCCTTCCTGATGCAGAGCTCTGG - Intronic
1049242173 8:141543633-141543655 TCCCTGCAGACACAAAGCTCAGG + Intergenic
1050269841 9:3931233-3931255 TCCTTCCATATACACACCCTCGG + Intronic
1052345869 9:27408811-27408833 TCCTTCCTGCTACAAAGCTCTGG + Intronic
1053370854 9:37560471-37560493 TCATTCTAGATACAGAGCCCTGG - Intronic
1053397841 9:37790614-37790636 TCCTTCTATATACAAGGTCCAGG + Intronic
1056431295 9:86530681-86530703 GGCTTCCAGATACAAGGCTCTGG + Intergenic
1056506900 9:87266054-87266076 TCCTTCAAGATTCAAAGTGCTGG - Intergenic
1059299111 9:113298482-113298504 TGCGTCCAGCTCCAAAGCCCAGG - Exonic
1062424484 9:136499702-136499724 TCCTGCCAGATGCCAAGACCCGG - Intronic
1187130265 X:16495676-16495698 TCCTTCAAGATCCAAAGACCTGG - Intergenic
1188403386 X:29775873-29775895 TCCTCCTAGTTACAAAGCCAAGG + Intronic
1192599972 X:72451873-72451895 TACTTCCAGGTAGAAAGCCTGGG - Intronic
1193318367 X:80091807-80091829 ACCTTCCACATACGAAGCCCTGG - Intergenic
1193824369 X:86205217-86205239 TCTTTCCAGTTATATAGCCCTGG - Intronic
1195144944 X:102003930-102003952 ACCAACCAGATAAAAAGCCCAGG + Intergenic