ID: 1000044747

View in Genome Browser
Species Human (GRCh38)
Location 5:157512944-157512966
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000044736_1000044747 29 Left 1000044736 5:157512892-157512914 CCTACCTCAATTCCCTCCTAAGT 0: 1
1: 0
2: 0
3: 18
4: 252
Right 1000044747 5:157512944-157512966 GGAACCTTAAAGAACCTTAAAGG No data
1000044737_1000044747 25 Left 1000044737 5:157512896-157512918 CCTCAATTCCCTCCTAAGTCAGA No data
Right 1000044747 5:157512944-157512966 GGAACCTTAAAGAACCTTAAAGG No data
1000044742_1000044747 13 Left 1000044742 5:157512908-157512930 CCTAAGTCAGAGAATCCCTGGGC 0: 1
1: 0
2: 2
3: 18
4: 148
Right 1000044747 5:157512944-157512966 GGAACCTTAAAGAACCTTAAAGG No data
1000044738_1000044747 17 Left 1000044738 5:157512904-157512926 CCCTCCTAAGTCAGAGAATCCCT No data
Right 1000044747 5:157512944-157512966 GGAACCTTAAAGAACCTTAAAGG No data
1000044744_1000044747 -2 Left 1000044744 5:157512923-157512945 CCCTGGGCTTTGTATCTGGAAGG No data
Right 1000044747 5:157512944-157512966 GGAACCTTAAAGAACCTTAAAGG No data
1000044746_1000044747 -3 Left 1000044746 5:157512924-157512946 CCTGGGCTTTGTATCTGGAAGGA 0: 1
1: 0
2: 0
3: 12
4: 190
Right 1000044747 5:157512944-157512966 GGAACCTTAAAGAACCTTAAAGG No data
1000044739_1000044747 16 Left 1000044739 5:157512905-157512927 CCTCCTAAGTCAGAGAATCCCTG 0: 1
1: 0
2: 0
3: 11
4: 171
Right 1000044747 5:157512944-157512966 GGAACCTTAAAGAACCTTAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type