ID: 1000044749

View in Genome Browser
Species Human (GRCh38)
Location 5:157512957-157512979
Sequence ACCTTAAAGGATTCTTAAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 154
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 142}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000044742_1000044749 26 Left 1000044742 5:157512908-157512930 CCTAAGTCAGAGAATCCCTGGGC 0: 1
1: 0
2: 2
3: 18
4: 148
Right 1000044749 5:157512957-157512979 ACCTTAAAGGATTCTTAAACTGG 0: 1
1: 0
2: 1
3: 10
4: 142
1000044746_1000044749 10 Left 1000044746 5:157512924-157512946 CCTGGGCTTTGTATCTGGAAGGA 0: 1
1: 0
2: 0
3: 12
4: 190
Right 1000044749 5:157512957-157512979 ACCTTAAAGGATTCTTAAACTGG 0: 1
1: 0
2: 1
3: 10
4: 142
1000044739_1000044749 29 Left 1000044739 5:157512905-157512927 CCTCCTAAGTCAGAGAATCCCTG 0: 1
1: 0
2: 0
3: 11
4: 171
Right 1000044749 5:157512957-157512979 ACCTTAAAGGATTCTTAAACTGG 0: 1
1: 0
2: 1
3: 10
4: 142
1000044744_1000044749 11 Left 1000044744 5:157512923-157512945 CCCTGGGCTTTGTATCTGGAAGG 0: 1
1: 0
2: 0
3: 13
4: 137
Right 1000044749 5:157512957-157512979 ACCTTAAAGGATTCTTAAACTGG 0: 1
1: 0
2: 1
3: 10
4: 142
1000044738_1000044749 30 Left 1000044738 5:157512904-157512926 CCCTCCTAAGTCAGAGAATCCCT 0: 1
1: 0
2: 3
3: 13
4: 204
Right 1000044749 5:157512957-157512979 ACCTTAAAGGATTCTTAAACTGG 0: 1
1: 0
2: 1
3: 10
4: 142

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000044749 Original CRISPR ACCTTAAAGGATTCTTAAAC TGG Intronic
900079409 1:844353-844375 ATCTAAAATGATACTTAAACTGG + Intergenic
900979252 1:6036976-6036998 GCCTGAGAGGATTCGTAAACAGG + Intronic
901614546 1:10527979-10528001 ACCTTCAAGGAGTCTTTAAAAGG - Intronic
904014437 1:27409120-27409142 AAAGTAAAGGATTCTTAAGCTGG - Intronic
908562004 1:65315683-65315705 ACCTTATAGGATTCTTATGAGGG - Intronic
912533956 1:110349680-110349702 AAGTTAAAGGATCTTTAAACAGG - Intergenic
912710596 1:111946991-111947013 ACCTTAAAGGATACTCAGACTGG - Intronic
915605945 1:156950821-156950843 CCCTTAAAGGTGACTTAAACAGG - Intronic
917405526 1:174702540-174702562 ACCTTAAAGGCATTTTATACTGG - Intronic
918869735 1:189953952-189953974 ACCTTATTGGATTCTGAACCAGG - Intergenic
919654516 1:200184467-200184489 CCCTTAAAGAAGTCTTAAAGTGG + Intergenic
922883113 1:228997614-228997636 CCATTGAAGGATTTTTAAACAGG - Intergenic
923407338 1:233675504-233675526 AAATTAAAGGATTCATGAACTGG + Intergenic
1064556514 10:16551890-16551912 AGCTAAAAGCATTCTTAAAGTGG - Intergenic
1065465522 10:26016668-26016690 ACATTAAAGGATCCTAAATCAGG - Intronic
1067971639 10:50977828-50977850 ACCTTAAAGAAATGTGAAACAGG + Intergenic
1069254967 10:66321496-66321518 AACTTGAATGATTCTAAAACAGG - Intronic
1069431410 10:68338481-68338503 ACCTTAAAACATTTTTAAATAGG + Exonic
1069592183 10:69648953-69648975 ACCCCAAATGATTCTTAAATGGG - Intergenic
1073006078 10:100325853-100325875 ACCTGAGAAGATTCTTAAGCAGG - Intronic
1073548179 10:104371242-104371264 ACCTTAAACAATTCTTCCACAGG + Intronic
1073828240 10:107351474-107351496 ACCTGAAAGAATTCATGAACAGG + Intergenic
1074351890 10:112745942-112745964 AATTTAAAAGATTCTTAAATTGG - Intronic
1075164451 10:120054490-120054512 GCATTAAAGGATTCATGAACTGG - Intergenic
1078583209 11:12556504-12556526 TCCTTAAAGGAATTTTACACAGG + Intergenic
1080972292 11:37292747-37292769 TGCTTGAAGGAATCTTAAACTGG - Intergenic
1088549064 11:110991974-110991996 GCCTTAAAGGATTTTGAAAAGGG - Intergenic
1089211342 11:116805283-116805305 ACCTTTAAGTATTCTTAGCCAGG - Intergenic
1089269914 11:117295005-117295027 AGTTTAAAGGATTATTTAACAGG - Intronic
1093800555 12:23366980-23367002 CCCTTACAGGATTCATACACAGG + Intergenic
1094522136 12:31203084-31203106 ACCATTAAGGATTTTTAAAGAGG - Intergenic
1095142865 12:38687973-38687995 ACCTTAAAGGAATGTTAAATAGG - Intronic
1095675559 12:44913732-44913754 TCCTTAAAGAATTTTTAAAATGG + Intronic
1101319019 12:103656619-103656641 ACCTGAAAGCATTCTAAAAAGGG - Intronic
1108105911 13:47008966-47008988 AACTTAAAGTATTCATAGACAGG + Intergenic
1108319894 13:49279368-49279390 GCTTTAAAGGATTCCTAGACTGG + Intronic
1110931818 13:81228467-81228489 TCCTTTAAGGATTTTTAAATTGG - Intergenic
1114371936 14:22099296-22099318 ACCTAACAGGATGCATAAACAGG + Intergenic
1116280325 14:42898729-42898751 TCCTTAAAGGAATACTAAACAGG - Intergenic
1120784617 14:88521353-88521375 ATCCTAAAGGATTCCTAATCTGG - Intronic
1122492265 14:102126428-102126450 ATCTTAGGGGATTCTTAAAGCGG + Intronic
1122726322 14:103756388-103756410 ATCTTAAAATATTCTGAAACTGG - Intronic
1125960468 15:43825723-43825745 TCCTTAAAGAGTTCTTAAATAGG - Intergenic
1130003992 15:80076873-80076895 CCCTTAAAGCATTTTTAGACAGG - Intronic
1130213450 15:81946992-81947014 ACCTGAAAAGATTCTGTAACTGG + Intergenic
1131435762 15:92420244-92420266 ACCAGAAAGGATTCATAAACAGG - Intronic
1132427121 15:101727133-101727155 ACCTAACAAGATTCTGAAACAGG + Intergenic
1138787446 16:59864224-59864246 ATCTCCAAGGATCCTTAAACAGG - Intergenic
1140403378 16:74690396-74690418 ATCCTGAAGGATTCTTATACAGG + Intronic
1140563076 16:76007081-76007103 ACCTTAAAGGATTATTTCACTGG - Intergenic
1140652734 16:77106407-77106429 TCATTAAAGGATTTTTAAATAGG + Intergenic
1144137582 17:12313117-12313139 TCCTTAAGGGAATGTTAAACAGG - Intergenic
1145275327 17:21425747-21425769 ACCTTAAATTTTTCTTAAAGTGG + Intergenic
1149290569 17:55214330-55214352 CCTTTACAGGTTTCTTAAACAGG - Intergenic
1152893731 17:82897734-82897756 ACCTGCACGGATTCTAAAACGGG - Intronic
1153270931 18:3320345-3320367 AACTTAAAGGATGCTGAAATTGG - Intergenic
1157776432 18:50400221-50400243 ACCTTAAAGCATGATTAAACAGG - Intergenic
1160124717 18:76160965-76160987 ACCTTATATGATTCTTAAGAGGG - Intergenic
1166665166 19:44675385-44675407 GACTTGGAGGATTCTTAAACTGG - Intronic
927622366 2:24675491-24675513 GCCTTATGGGATTCTTAATCAGG - Intronic
929303473 2:40332700-40332722 ACTTCACAGGATTTTTAAACAGG - Intronic
930160039 2:48145637-48145659 AGCGTAAAGGACTCTAAAACTGG + Intergenic
930732264 2:54739489-54739511 TCCTTAAGGGTTTCTTAACCTGG - Intronic
930892739 2:56409851-56409873 ATCTTAACTGATTCTTAAATTGG + Intergenic
933371778 2:81423860-81423882 ACCTTAATGGATTGATTAACAGG + Intergenic
937136278 2:119556419-119556441 CCTTTAAAAGATTCTTGAACTGG - Intronic
938255509 2:129857254-129857276 ATGTTACAGGATTCTTAAAAAGG + Intergenic
938742139 2:134242953-134242975 TCCTTAAAGGAATCACAAACTGG - Intronic
939976987 2:148729411-148729433 ACATTAAAGGAAACTAAAACTGG - Intronic
942701449 2:178715724-178715746 ACCTTCAAGAATTGTGAAACAGG - Exonic
944200011 2:197096737-197096759 TCCTTATAGGATTATTAAAGAGG - Intronic
944272608 2:197800446-197800468 ACTTTAAAGATTTATTAAACTGG + Intergenic
948142940 2:235687510-235687532 ACCTAAAATGAATTTTAAACTGG - Intronic
1170130426 20:13013186-13013208 AGCTTAAATGGTTCTAAAACTGG - Intronic
1171028478 20:21654226-21654248 AGCTTAAAGGATTCTTAAAATGG - Intergenic
1172645724 20:36468105-36468127 ACCTTTAAGGAATTCTAAACTGG - Intronic
1176049658 20:63111223-63111245 ACCTCAAAGGATACTCAAAAGGG - Intergenic
1182511565 22:30823762-30823784 TCCTTAAAGGACTCTTAAGATGG - Intronic
949374259 3:3369539-3369561 ATTTTAAATTATTCTTAAACTGG + Intergenic
951968126 3:28412089-28412111 AAATTAAAGGATTCTTTAAATGG + Intronic
956714496 3:72066605-72066627 CCCTTCAAGGATTTTTAAACAGG + Intergenic
956764058 3:72469141-72469163 TCCTTAAAGGATTATTATAGTGG + Intergenic
958051306 3:88350308-88350330 ACCTTAATTGTTTCCTAAACTGG + Intergenic
958144376 3:89604854-89604876 ACCTTAAAGTATTCTAGAAAAGG + Intergenic
958193049 3:90207873-90207895 TGCTTAAAGGATTCTTAATAAGG + Intergenic
958726723 3:97914653-97914675 ACCTCAAAGGTTTCTTACAAGGG + Intronic
960724176 3:120653643-120653665 ACATTAAAAGATACTTAAAAAGG + Intronic
961285131 3:125795866-125795888 ACTTTAAACGATTCTTGAACTGG - Intergenic
962237063 3:133715680-133715702 GCCTGAACAGATTCTTAAACTGG - Intergenic
964911567 3:161788953-161788975 ACCTTACAAGATTCTTAATTGGG + Intergenic
966303612 3:178506539-178506561 ACCTGAAAGGAGTCTTAACAAGG + Intronic
974433657 4:61830643-61830665 AGTTTAATTGATTCTTAAACAGG - Intronic
974501582 4:62711813-62711835 GCCCTAAAGGATTCTTAGTCAGG - Intergenic
975979622 4:80142717-80142739 ACCTAAAAGCAGTTTTAAACAGG - Intergenic
976227076 4:82803223-82803245 ACCTAAAAAGATCCTAAAACTGG - Intergenic
977138105 4:93331796-93331818 ACTTTACAGGGTTCTTAAAAGGG + Intronic
978055912 4:104266083-104266105 ACATTAAAGAATGTTTAAACTGG - Intergenic
979150559 4:117309186-117309208 TTCTTAAAGGATTTCTAAACAGG - Intergenic
980500442 4:133645400-133645422 TCCTTAAAGTGTTCTTAAATAGG + Intergenic
981663547 4:147195577-147195599 ACATCAAAGGATTCTTTAAGGGG - Intergenic
983895498 4:173076926-173076948 ACCTTCAAGGAATATTAATCAGG + Intergenic
984006509 4:174316659-174316681 ACCTTAAAGGTCTCTCAATCAGG + Intronic
986933115 5:12852149-12852171 GCCCTAAAGGAGTCTTAGACTGG + Intergenic
990240286 5:53810235-53810257 AATTTAAATGATACTTAAACTGG + Intergenic
992421411 5:76609293-76609315 ACCCTATAGGATTTATAAACTGG - Intronic
993838093 5:92839650-92839672 ACATTTAAGGATTCTTACAATGG - Intergenic
993858596 5:93105666-93105688 CCCTTAAAGGACTCTTTAAGTGG - Intergenic
996927082 5:128840473-128840495 ACCTTCAAGGAGTTTTAACCTGG + Intronic
1000044749 5:157512957-157512979 ACCTTAAAGGATTCTTAAACTGG + Intronic
1003072172 6:2953483-2953505 AACTTAAAGGATTATCAAAAAGG + Intronic
1003745337 6:8994890-8994912 ACCTTTAAGGATTGTTTAATAGG - Intergenic
1004140890 6:13015874-13015896 CCCTCAAAGGATTCTTAAATAGG + Intronic
1005307598 6:24529007-24529029 ACCTCAAAGGATTCTTTCATTGG + Intronic
1009034537 6:58100151-58100173 TCCTTAAAGGAGTGCTAAACAGG + Intergenic
1009210019 6:60850649-60850671 TCCTTAAAGGAGTGCTAAACAGG + Intergenic
1012371896 6:98517372-98517394 ACTTTAAAGGAGTCTTTAAGGGG + Intergenic
1016467304 6:144338583-144338605 ACCTTTAAGGATTTTGAAGCTGG + Intronic
1017258546 6:152362014-152362036 TCTCTAAAGGCTTCTTAAACTGG - Intronic
1017405632 6:154115660-154115682 TCCTTAAAGGAGTCTAAATCAGG + Intronic
1019782126 7:2947377-2947399 AACTCAAAGGATCCATAAACTGG - Intronic
1020669772 7:11092295-11092317 ACCTGAAAGGCTTGTTAAAAGGG + Intronic
1022634333 7:32117960-32117982 ACCCTAAAGGAAGCTTTAACAGG + Intronic
1024165555 7:46725621-46725643 ACCATCAAGGGTTCTTAACCAGG + Intronic
1027149808 7:75724946-75724968 ACCTCAAAGGATGCATCAACAGG + Intronic
1027903218 7:84145569-84145591 ACCTTAAATTATTTATAAACTGG + Intronic
1028437791 7:90824658-90824680 TCCTTAAAATATCCTTAAACAGG + Intronic
1028605549 7:92651502-92651524 ACCTTAAAGGCTTCTGGAAATGG - Intronic
1028969650 7:96843708-96843730 ACATTGATTGATTCTTAAACCGG - Intergenic
1029239400 7:99148546-99148568 CCCTTACAGGATTCATAAATTGG - Intergenic
1033454792 7:141492936-141492958 ATCTTAGAGGATTATTAAAGGGG + Intergenic
1037148444 8:15603911-15603933 CTCTAAAAGGGTTCTTAAACTGG - Intronic
1039115664 8:34088909-34088931 ACCTTAAAGGATAGGTAAAATGG - Intergenic
1047989287 8:130268790-130268812 ACTGCAAATGATTCTTAAACTGG - Intronic
1048766246 8:137847552-137847574 ATCTTGAAGGATTTTTAAGCAGG - Intergenic
1051500153 9:17768068-17768090 TGCTTAAAAGATTCTTAATCAGG + Intronic
1052792389 9:32887775-32887797 ATCTTAAATTATTCTTAAATTGG + Intergenic
1053573853 9:39337680-39337702 GCCTTAAAGGATTCTTTCTCAGG + Intergenic
1053838475 9:42166237-42166259 GCCTTAAAGGATTCTTTCTCAGG + Intergenic
1054095419 9:60896368-60896390 GCCTTAAAGGATTCTTTCTCAGG + Intergenic
1054116881 9:61172288-61172310 GCCTTAAAGGATTCTTTCTCAGG + Intergenic
1054590871 9:67010275-67010297 GCCTTAAAGGATTCTTTCTCAGG - Intergenic
1058564510 9:106267700-106267722 ATCTTAAATGATTCTTGAAAGGG + Intergenic
1059644405 9:116250351-116250373 ACTTCATAGGATTCTGAAACTGG - Intronic
1185951245 X:4436689-4436711 ACCTGAAAGGATTCTCAAATAGG - Intergenic
1188365222 X:29306924-29306946 TCATTGAAGGATTTTTAAACAGG - Intronic
1189814349 X:44809951-44809973 ACCTAAAAGAATTATTAAAGGGG - Intergenic
1192194758 X:69020891-69020913 CCCTTAAAGGGTTCTTGAGCAGG + Intergenic
1193357576 X:80539335-80539357 AACTTAAAAGATTTTTAAAAAGG + Intergenic
1193849804 X:86523072-86523094 TCCTTAAAAGGTTCTTAAGCTGG + Intronic
1195628929 X:107033673-107033695 ACCTTAAATGACTGTAAAACAGG + Intergenic
1197358642 X:125469469-125469491 AACTTAAAAGATTCTCAAAGAGG - Intergenic
1199661839 X:150058585-150058607 ACTTTACATGATACTTAAACTGG - Intergenic
1200370241 X:155717394-155717416 AACTTAAAGTATTTTTAAAAAGG - Intergenic
1201737805 Y:17288419-17288441 ACCTGAAAGGATTCTCAAATAGG - Intergenic