ID: 1000044749

View in Genome Browser
Species Human (GRCh38)
Location 5:157512957-157512979
Sequence ACCTTAAAGGATTCTTAAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 154
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 142}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000044739_1000044749 29 Left 1000044739 5:157512905-157512927 CCTCCTAAGTCAGAGAATCCCTG 0: 1
1: 0
2: 0
3: 11
4: 171
Right 1000044749 5:157512957-157512979 ACCTTAAAGGATTCTTAAACTGG 0: 1
1: 0
2: 1
3: 10
4: 142
1000044746_1000044749 10 Left 1000044746 5:157512924-157512946 CCTGGGCTTTGTATCTGGAAGGA 0: 1
1: 0
2: 0
3: 12
4: 190
Right 1000044749 5:157512957-157512979 ACCTTAAAGGATTCTTAAACTGG 0: 1
1: 0
2: 1
3: 10
4: 142
1000044738_1000044749 30 Left 1000044738 5:157512904-157512926 CCCTCCTAAGTCAGAGAATCCCT No data
Right 1000044749 5:157512957-157512979 ACCTTAAAGGATTCTTAAACTGG 0: 1
1: 0
2: 1
3: 10
4: 142
1000044742_1000044749 26 Left 1000044742 5:157512908-157512930 CCTAAGTCAGAGAATCCCTGGGC 0: 1
1: 0
2: 2
3: 18
4: 148
Right 1000044749 5:157512957-157512979 ACCTTAAAGGATTCTTAAACTGG 0: 1
1: 0
2: 1
3: 10
4: 142
1000044744_1000044749 11 Left 1000044744 5:157512923-157512945 CCCTGGGCTTTGTATCTGGAAGG No data
Right 1000044749 5:157512957-157512979 ACCTTAAAGGATTCTTAAACTGG 0: 1
1: 0
2: 1
3: 10
4: 142

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000044749 Original CRISPR ACCTTAAAGGATTCTTAAAC TGG Intronic