ID: 1000044751

View in Genome Browser
Species Human (GRCh38)
Location 5:157512958-157512980
Sequence CCTTAAAGGATTCTTAAACT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 282
Summary {0: 1, 1: 0, 2: 2, 3: 21, 4: 258}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000044744_1000044751 12 Left 1000044744 5:157512923-157512945 CCCTGGGCTTTGTATCTGGAAGG 0: 1
1: 0
2: 0
3: 13
4: 137
Right 1000044751 5:157512958-157512980 CCTTAAAGGATTCTTAAACTGGG 0: 1
1: 0
2: 2
3: 21
4: 258
1000044739_1000044751 30 Left 1000044739 5:157512905-157512927 CCTCCTAAGTCAGAGAATCCCTG 0: 1
1: 0
2: 0
3: 11
4: 171
Right 1000044751 5:157512958-157512980 CCTTAAAGGATTCTTAAACTGGG 0: 1
1: 0
2: 2
3: 21
4: 258
1000044742_1000044751 27 Left 1000044742 5:157512908-157512930 CCTAAGTCAGAGAATCCCTGGGC 0: 1
1: 0
2: 2
3: 18
4: 148
Right 1000044751 5:157512958-157512980 CCTTAAAGGATTCTTAAACTGGG 0: 1
1: 0
2: 2
3: 21
4: 258
1000044746_1000044751 11 Left 1000044746 5:157512924-157512946 CCTGGGCTTTGTATCTGGAAGGA 0: 1
1: 0
2: 0
3: 12
4: 190
Right 1000044751 5:157512958-157512980 CCTTAAAGGATTCTTAAACTGGG 0: 1
1: 0
2: 2
3: 21
4: 258

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000044751 Original CRISPR CCTTAAAGGATTCTTAAACT GGG Intronic
901417026 1:9124201-9124223 CCTAAAAGGAGTCTTGGACTGGG + Intronic
904014436 1:27409119-27409141 AAGTAAAGGATTCTTAAGCTGGG - Intronic
904409000 1:30313585-30313607 CCTCAAGGGATTCTTAGATTAGG + Intergenic
905721750 1:40209434-40209456 GCTTAAAGAATTCTTATACTAGG - Intronic
909042935 1:70675643-70675665 CCTTCCAGGATTTTTAAAATTGG + Intergenic
909371921 1:74893590-74893612 CCTTAAAGGATTGCTAAACATGG + Intergenic
910153897 1:84191170-84191192 CCTTAAGGGAGTCCTAAACATGG - Intronic
910826774 1:91417436-91417458 CCTAGAAGGAATCTTACACTTGG - Intergenic
911073913 1:93854724-93854746 CATTAAAGATTTCTCAAACTTGG + Intergenic
911375026 1:97042117-97042139 CCTTAAAGGAGTGCTAAACTTGG - Intergenic
911495985 1:98632018-98632040 TCTTGAGGGATTCTTAATCTGGG - Intergenic
913064185 1:115234731-115234753 CTTTAAAGAATTCTTAACCTAGG - Intergenic
913832904 1:123278518-123278540 CTGTAAAGGATCCTTCAACTCGG - Intergenic
913849174 1:123570462-123570484 CTGTAAAGGATCCTTCAACTCGG - Intergenic
913887252 1:124252848-124252870 CTGTAAAGGATCCTTCAACTCGG - Intergenic
915772753 1:158445954-158445976 CCTTATAGGCTTCTCAAACCTGG - Intergenic
917665986 1:177226328-177226350 CCTTAAGGGGTCCATAAACTAGG + Intronic
920157450 1:203966429-203966451 GGTTAAAGGATTTTTAAATTAGG - Intergenic
920973228 1:210760531-210760553 GCTTAAAGGAGTCCTAAACATGG + Intronic
921464292 1:215467520-215467542 CCTTAAATGGGTCTTATACTGGG - Intergenic
921543257 1:216444994-216445016 ACTTAAATGATTCTTTGACTGGG + Intergenic
921917832 1:220632693-220632715 TCTTAAAGGATTTTTAAAAGAGG + Intronic
923765950 1:236892568-236892590 TCTGAAGGGATTCTTAAATTTGG + Intronic
1063024858 10:2167959-2167981 CATTAAAGGATACTTAGATTTGG - Intergenic
1065254165 10:23848499-23848521 CTTTAAAGGAATCTCAAAATTGG + Intronic
1068269463 10:54701297-54701319 CCTTAAAGGAGTGTTAAATATGG + Intronic
1068303031 10:55170446-55170468 CCTTAAAGGTGTCTTAAAGCTGG + Intronic
1068559321 10:58495655-58495677 CAATAAAGGATTTTTTAACTAGG + Intergenic
1068588419 10:58827177-58827199 CCTTAAAGGATTGTTACACATGG + Intronic
1069346730 10:67478621-67478643 CCTTAAGGGAGTCTTAAACATGG + Intronic
1073816372 10:107212449-107212471 CCTTAAAGGAGTGCTAAACATGG - Intergenic
1075164450 10:120054489-120054511 CATTAAAGGATTCATGAACTGGG - Intergenic
1078573129 11:12476324-12476346 CCTAAGAAGACTCTTAAACTAGG - Intronic
1079583547 11:22096434-22096456 CCTTAAAGGATTCTAAACTATGG + Intergenic
1079679261 11:23273439-23273461 ACTTAAATGATTCTAAAACACGG - Intergenic
1080259069 11:30325691-30325713 CGTTAAAAGATTATTAAAATAGG + Intronic
1080296308 11:30732792-30732814 ACTTAAATGATAATTAAACTGGG - Intergenic
1081791166 11:45786987-45787009 CCTTAAAAGATCATCAAACTTGG - Intergenic
1081883434 11:46473955-46473977 CCTTTAAGGATTCTTAAAGAAGG + Intronic
1083242734 11:61401440-61401462 CCCTAAATGCTTCCTAAACTGGG - Intergenic
1083986205 11:66217257-66217279 CCTTAACGGATCCATAACCTTGG + Intronic
1085903836 11:80736035-80736057 CCTCAAAGGATGCTAAATCTAGG + Intergenic
1086443538 11:86851263-86851285 CCTCAAAGGAGTCATAAATTTGG - Intronic
1093655545 12:21689759-21689781 CCTTAAAGGAATGCTAAACATGG + Intronic
1093721812 12:22452146-22452168 CAAAAAAGGATTCTTAAAGTAGG + Intronic
1093767763 12:22984351-22984373 CCTTCAGGGATACTCAAACTAGG - Intergenic
1094313331 12:29111083-29111105 GCTTAAAGGAGTCCTAAACATGG - Intergenic
1095043014 12:37464946-37464968 CCTGACAGGAATTTTAAACTGGG + Intergenic
1095815589 12:46418579-46418601 CCTTAAAGGAATTCTAAACAAGG + Intergenic
1095889743 12:47224405-47224427 GCTTTAAGAATTTTTAAACTTGG + Intronic
1096332715 12:50728393-50728415 CCTTAATGGAGTCTTAGATTAGG + Intronic
1096507657 12:52105345-52105367 CCTCAAAGGAGTCATAAATTCGG + Intergenic
1098818306 12:75196394-75196416 CCAGAAAGGCTTCTTAAAGTAGG + Intronic
1099264023 12:80421097-80421119 CCTTAAAAGATTCTTGAAAATGG - Intronic
1099611742 12:84881186-84881208 CCTTAATAGATTCTGTAACTAGG + Intronic
1099714053 12:86267341-86267363 ACTCAAAGGTATCTTAAACTTGG + Intronic
1099966548 12:89452493-89452515 GCATAAAGTATTCTTTAACTAGG + Intronic
1103183890 12:118939113-118939135 CTTTAAATGGTTTTTAAACTTGG + Intergenic
1105387122 13:19941394-19941416 CATTAAAGGATTCATTAATTGGG + Intergenic
1107335953 13:39355232-39355254 CCTTTAAGGATACTGAAAATAGG - Intronic
1107687103 13:42913251-42913273 CATTAAGAGATTCTGAAACTAGG + Intronic
1108319895 13:49279369-49279391 CTTTAAAGGATTCCTAGACTGGG + Intronic
1109840123 13:67909004-67909026 CCTCAAAGGAGTCATAAATTCGG + Intergenic
1109922840 13:69091851-69091873 ACTTTGAGGATTCTTAAAATGGG + Intergenic
1109941111 13:69366933-69366955 CCTTAAGGGAATTCTAAACTTGG + Intergenic
1110280340 13:73685776-73685798 ACTTAAAGGATACGTAAAGTGGG + Intergenic
1110494333 13:76148853-76148875 CCATAAAGGATTTTTGAGCTTGG + Intergenic
1111050334 13:82875056-82875078 CCTTAAAGGAATGTTAAACATGG - Intergenic
1113385546 13:109844586-109844608 CCTTAAAGAAATCTTAAACACGG + Intergenic
1114938503 14:27574940-27574962 CCTTAAGGGAGTTTTAAACATGG + Intergenic
1116058322 14:39891437-39891459 CCCTAAAGTATTCAGAAACTGGG + Intergenic
1116078059 14:40137732-40137754 CCTTAAAGGAGTCATAAACATGG - Intergenic
1116280323 14:42898728-42898750 CCTTAAAGGAATACTAAACAGGG - Intergenic
1116724575 14:48546137-48546159 GCTTAAGGGAGTCTTAAACATGG + Intergenic
1116781161 14:49239251-49239273 CCTTAAAGGAGTTCTAAACATGG - Intergenic
1117009259 14:51453498-51453520 CCTTAAAGTACTCTGAATCTTGG - Intergenic
1117387400 14:55229588-55229610 CCTTAGAGTATTCTTCAGCTAGG - Intergenic
1117454429 14:55883524-55883546 CCCTAAATGATTCTGAAGCTGGG + Intergenic
1121593655 14:95140782-95140804 GTTTACAGGAATCTTAAACTTGG - Intronic
1122593223 14:102870578-102870600 CCCTAAAGGATTCACAAGCTGGG - Intronic
1202842293 14_GL000009v2_random:133044-133066 CCATATAGGCTTCTTAAAATTGG + Intergenic
1202911680 14_GL000194v1_random:123279-123301 CCATATAGGCTTCTTAAAATTGG + Intergenic
1202941555 14_KI270725v1_random:152548-152570 CCTGACAGGAATTTTAAACTGGG + Intergenic
1125367167 15:38930592-38930614 CCTTAAAGGAGTGCTAAACATGG - Intergenic
1126206592 15:46052876-46052898 CCTTAAGGGAGTGTTAAACATGG - Intergenic
1130213452 15:81946993-81947015 CCTGAAAAGATTCTGTAACTGGG + Intergenic
1130289448 15:82584371-82584393 CATTATGGGATTCTTAACCTGGG - Intronic
1131032085 15:89194960-89194982 CTCTAAAGGGTTCTCAAACTCGG - Intronic
1131435760 15:92420243-92420265 CCAGAAAGGATTCATAAACAGGG - Intronic
1132979845 16:2732011-2732033 CCTTAAAGGATTGTATAAATTGG - Intergenic
1135007242 16:18836746-18836768 CCTTCAAGGAACCTAAAACTTGG - Intronic
1135744363 16:25003512-25003534 CCTTAAAGCTTTTTAAAACTTGG + Intronic
1140563074 16:76007080-76007102 CCTTAAAGGATTATTTCACTGGG - Intergenic
1144137580 17:12313116-12313138 CCTTAAGGGAATGTTAAACAGGG - Intergenic
1144680924 17:17193817-17193839 CCCTGAAGGCTTCTTTAACTGGG - Intronic
1145275329 17:21425748-21425770 CCTTAAATTTTTCTTAAAGTGGG + Intergenic
1149290568 17:55214329-55214351 CTTTACAGGTTTCTTAAACAGGG - Intergenic
1150494751 17:65598604-65598626 TCTTACAGGATTGTTAAAATCGG + Intronic
1155551119 18:26966468-26966490 CCTTAAATGATTTTGAAACAAGG + Intronic
1162290318 19:9774868-9774890 CCTTAGAGTATTCTTCAGCTAGG - Intronic
1166903461 19:46085773-46085795 CCTTAAGGGAGTGTTAAACATGG - Intergenic
925784914 2:7422640-7422662 CCTTGAAGGCTTTTTAAACACGG + Intergenic
925969721 2:9097857-9097879 CTTTAAAGGATTCTAACCCTTGG + Intergenic
930333227 2:50013381-50013403 CCTAAAGAGATTCTTTAACTTGG - Intronic
930555645 2:52892827-52892849 GCTCAAGGGAGTCTTAAACTTGG - Intergenic
930627806 2:53718507-53718529 CCTTAAGGGACTTTTAAACATGG + Intronic
930732262 2:54739488-54739510 CCTTAAGGGTTTCTTAACCTGGG - Intronic
931813926 2:65881420-65881442 TCATAAAGGATTCTTGATCTCGG - Intergenic
933115640 2:78467133-78467155 AGTTAAAGGATTCATACACTTGG - Intergenic
933233917 2:79843242-79843264 CCTGAAAGGATTCTTTAACTTGG + Intronic
933234651 2:79851566-79851588 TCTTAAAGGATTCTGAAAAACGG - Intronic
933812999 2:86044686-86044708 CTGTCAAGGATTCTCAAACTTGG + Intronic
935500133 2:103829385-103829407 CCTTATGGGAGTGTTAAACTTGG - Intergenic
935786059 2:106549955-106549977 TCTTACAGGGTTCTTAAACGAGG - Intergenic
935828479 2:106974709-106974731 CACTAAAAGATTTTTAAACTGGG + Intergenic
940157327 2:150671725-150671747 GCTCAGAGGAATCTTAAACTTGG - Intergenic
942615120 2:177783799-177783821 CCTATAAGCATTGTTAAACTGGG + Intronic
942708279 2:178801817-178801839 CCTTAAAGGACTTATAAACAAGG + Intronic
944074012 2:195706484-195706506 CCTTAAAGCTTTCATAATCTGGG + Intronic
944272609 2:197800447-197800469 CTTTAAAGATTTATTAAACTGGG + Intergenic
944573476 2:201068642-201068664 CCATGAAGAATTCTTAAATTAGG + Intronic
945206274 2:207335488-207335510 CCTTAAAGGATTGTTCAAAGCGG + Intergenic
945256845 2:207810322-207810344 CCATAAGAGATTCTTAACCTGGG + Intergenic
946266248 2:218544494-218544516 CTTTAAAGAATCTTTAAACTTGG + Intronic
947491216 2:230595966-230595988 CCTTAAGGGAGTTTTAAACACGG + Intergenic
948441079 2:237989770-237989792 CCTCAAAGTTTTCTTCAACTCGG + Intronic
1168989333 20:2080752-2080774 ACATAATGGATTCTTAATCTTGG - Intergenic
1169864250 20:10183266-10183288 GCTAAAATGGTTCTTAAACTTGG - Intergenic
1171537437 20:25907700-25907722 CCTGACAGGAATTTTAAACTGGG + Intergenic
1171803672 20:29653586-29653608 CCTGACAGGAATTTTAAACTGGG - Intergenic
1171840387 20:30203039-30203061 CCTGACAGGAATTTTAAACTGGG + Intergenic
1171966416 20:31534176-31534198 CCTTAAAGACTTCATAAAGTGGG - Intronic
1173220163 20:41125860-41125882 CCTTGAAGGATGCTTAACCCAGG + Intergenic
1175438382 20:58972128-58972150 CCTTAAAGTATTGTATAACTTGG + Intergenic
1176631041 21:9137946-9137968 CCATATAGGCTTCTTAAAATTGG + Intergenic
1176642255 21:9316872-9316894 CCATATAGGCTTCTTAAAATTGG - Intergenic
1176938411 21:14894284-14894306 CCTTAAATGATTCTTAAACATGG + Intergenic
1177902732 21:26936156-26936178 ACTTAAAGGATCCTTACACATGG - Intronic
1178779091 21:35582596-35582618 CCTTAAATCATTCTTATAATTGG + Intronic
1180264444 22:10511458-10511480 CCTGACAGGAATTTTAAACTGGG - Intergenic
1180351265 22:11806224-11806246 CCATATAGGCTTCTTAAAATTGG - Intergenic
1180375553 22:12089657-12089679 CCATACAGGCTTCTTAAAATTGG - Intergenic
1180386936 22:12185851-12185873 CCATATAGGCTTCTTAAAATTGG + Intergenic
1181264308 22:21621576-21621598 CCTTAGAGTATTCTTCAGCTAGG - Exonic
1184043268 22:41957074-41957096 CCTTTAAGGAGTCTTAGGCTGGG - Intergenic
949649626 3:6141326-6141348 CCCTAAATGTTACTTAAACTGGG - Intergenic
949728008 3:7073013-7073035 CCTTAAAGGTTACTTAATATAGG - Intronic
950292801 3:11800080-11800102 GCTCAAAGGAGTCTTAAACATGG + Intronic
950381408 3:12618729-12618751 GCTTAAACAATTCTTAAACCTGG + Exonic
950769349 3:15298936-15298958 CCTTAAAGAATGGTTAAAATGGG + Intronic
955668777 3:61379791-61379813 CGTTAGCGAATTCTTAAACTGGG - Intergenic
956889759 3:73600947-73600969 GTTTGAAGGGTTCTTAAACTTGG - Intronic
957097861 3:75793775-75793797 CCATATAGGCTTCTTAAAATTGG + Intergenic
958193050 3:90207874-90207896 GCTTAAAGGATTCTTAATAAGGG + Intergenic
958256160 3:91327375-91327397 CTTAAAAGGATTCTTTAACCTGG - Intergenic
959544762 3:107581386-107581408 TCTTTTATGATTCTTAAACTTGG + Intronic
959560148 3:107770151-107770173 CCTGAAAGGATTCTACAGCTAGG - Intronic
960060863 3:113318917-113318939 CCTTAAGGGAGTGTTAAACATGG + Intronic
960426617 3:117515637-117515659 CCTCAAATGATTCTTATGCTTGG - Intergenic
962237061 3:133715679-133715701 CCTGAACAGATTCTTAAACTGGG - Intergenic
962519610 3:136186052-136186074 CCCTGAAGAATTCTTTAACTAGG + Intronic
964250846 3:154714975-154714997 CCTTCAATGACTCTTAGACTGGG - Intergenic
1202744634 3_GL000221v1_random:88146-88168 CCATATAGGCTTCTTAAAATTGG + Intergenic
969075769 4:4576496-4576518 CATTAAAGTATTCTTTATCTTGG + Intergenic
971028867 4:22615356-22615378 CCTTAAATGATTTTGAAACAAGG + Intergenic
971836133 4:31765443-31765465 CCTTAAACTAATTTTAAACTGGG + Intergenic
973729117 4:53806085-53806107 CCTAGAAGGATTGTTAAACATGG - Intronic
974501580 4:62711812-62711834 CCCTAAAGGATTCTTAGTCAGGG - Intergenic
975753706 4:77551271-77551293 CCTCAAAGGAATTTTAAACATGG - Intronic
977332714 4:95657849-95657871 CCTTAAGGGAATTTTAAACATGG - Intergenic
980841868 4:138272266-138272288 TCTAAAAGCATTCTTACACTTGG + Intergenic
980863240 4:138523613-138523635 CCTTTAAGGATGCTGAAAATAGG - Intergenic
980873789 4:138640269-138640291 CCTAAAAAGATTCTCAAGCTAGG + Intergenic
982596331 4:157389410-157389432 CCTTAAAAGATTAGAAAACTAGG - Intergenic
983474603 4:168198181-168198203 CCTTAAAGGAGTTCTAAACATGG + Intergenic
983730663 4:170990009-170990031 CCTTAAGGGAGTGCTAAACTTGG - Intergenic
984043855 4:174772724-174772746 CCATAACAGATTCTTAACCTTGG + Intronic
1202757152 4_GL000008v2_random:75099-75121 CCATACAGGCTTCTTAAAATTGG - Intergenic
987921653 5:24290740-24290762 CTCTAAAGGATTCTTCAACATGG - Intergenic
988034317 5:25806365-25806387 TCTTAAAGGAGTGTTAAACATGG - Intergenic
988586145 5:32509211-32509233 CCTCAAAGACTTCTGAAACTCGG + Intergenic
988654486 5:33193314-33193336 CCTTAAAGAATCTTTAAACATGG + Intergenic
989312206 5:40032807-40032829 CCTTGAAGGATTTTTCAGCTAGG + Intergenic
989774191 5:45183092-45183114 CCTGATAGGATTTCTAAACTTGG - Intergenic
990169238 5:53029301-53029323 CCTTTAAGGAATTTTAATCTAGG - Intronic
990502554 5:56410809-56410831 ACTTCAAGGATCCTGAAACTTGG + Intergenic
990667336 5:58088068-58088090 CCTTAAAGCCATCTTAGACTGGG + Intergenic
992307718 5:75460612-75460634 CCTAAAAAGATTCTTAACCTTGG + Intronic
993838092 5:92839649-92839671 CATTTAAGGATTCTTACAATGGG - Intergenic
993941588 5:94064831-94064853 GCTTAAGGGAATCTTAAACCTGG + Intronic
997479350 5:134172219-134172241 CCTTGAAGAATTTATAAACTAGG - Intronic
1000044751 5:157512958-157512980 CCTTAAAGGATTCTTAAACTGGG + Intronic
1002034109 5:176452806-176452828 CATCAAAGGATTTTTCAACTAGG + Intronic
1004140892 6:13015875-13015897 CCTCAAAGGATTCTTAAATAGGG + Intronic
1006309485 6:33247931-33247953 CCTGAATTGTTTCTTAAACTGGG - Intergenic
1007349799 6:41261934-41261956 ACTCAAAGGAGTCCTAAACTTGG + Intergenic
1007949790 6:45860964-45860986 CTTTAAAGGATTCAGTAACTGGG - Intergenic
1008999178 6:57693803-57693825 CTTAAAAGGATTCTTCAACCTGG + Intergenic
1010711968 6:79185402-79185424 CCATAAAGTATTTTTAAAATTGG - Intergenic
1010898988 6:81402402-81402424 CCTTAAGGCATTTTTAAATTAGG + Intergenic
1012322426 6:97867020-97867042 CCTTAATAGATTTTTAAAATAGG - Intergenic
1012924179 6:105251008-105251030 CCTTACAGGAATCTGGAACTTGG - Intergenic
1015003452 6:128248732-128248754 CTATAAAGCATTCTTAACCTTGG - Intronic
1015911868 6:138176756-138176778 GCTCAAAGGAGTCTTAAACATGG - Intronic
1016467306 6:144338584-144338606 CCTTTAAGGATTTTGAAGCTGGG + Intronic
1016496986 6:144674857-144674879 CCTTAAAGAAATTTTAAACATGG - Intronic
1017554569 6:155549082-155549104 CCTTAAAGAATTCAGAAACCAGG - Intergenic
1019782125 7:2947376-2947398 ACTCAAAGGATCCATAAACTGGG - Intronic
1021803425 7:24331015-24331037 CCTTGAAGCACTCATAAACTTGG - Intergenic
1021931675 7:25587042-25587064 CCTTAAAGAATTCATAATTTAGG - Intergenic
1022032796 7:26507484-26507506 CCTAAAAGGGATCTTAGACTTGG + Intergenic
1022896551 7:34755725-34755747 CCTTTAAGGGCTTTTAAACTAGG + Intronic
1024116881 7:46202751-46202773 GCCTAAAGGATTCTTAATATGGG + Intergenic
1024190229 7:46999192-46999214 CCATAAGTGATTCTAAAACTTGG - Intergenic
1024758055 7:52559979-52560001 CCTTAGATGATACCTAAACTTGG - Intergenic
1025288915 7:57694529-57694551 CCTGACAGGAATTTTAAACTGGG + Intergenic
1026389910 7:69890087-69890109 CCCTGAAGGATTCCTAAAATTGG - Intronic
1028437793 7:90824659-90824681 CCTTAAAATATCCTTAAACAGGG + Intronic
1028605547 7:92651501-92651523 CCTTAAAGGCTTCTGGAAATGGG - Intronic
1030482122 7:110117935-110117957 CCGTAAACAATTCTTCAACTAGG - Intergenic
1030661424 7:112223373-112223395 CCTAAAAGGATCCTTTAACTTGG - Intronic
1030846355 7:114417851-114417873 TCTTATAGCATTCTTACACTTGG + Intronic
1031181679 7:118426485-118426507 ACATCAAGGATTCTTCAACTAGG - Intergenic
1031287842 7:119894553-119894575 TGTTAGAAGATTCTTAAACTAGG + Intergenic
1031305509 7:120121036-120121058 CAATAAAGGATTCTTGAATTGGG - Intergenic
1033837016 7:145327152-145327174 CCATAAAGGAAACTTGAACTGGG + Intergenic
1037160946 8:15771397-15771419 GCTTGAAGGACTCTTCAACTTGG - Intergenic
1038235753 8:25752601-25752623 CCAGAAAAGATTCTTAAAGTAGG + Intergenic
1039146548 8:34453360-34453382 CATTGAAGGATTTTTAAATTTGG - Intergenic
1040791615 8:51237114-51237136 ATGTTAAGGATTCTTAAACTAGG - Intergenic
1040843342 8:51807964-51807986 ACTGAAAGGATTCTTGAACTTGG - Intronic
1043967597 8:86496143-86496165 CCTTAAAGGAGTGCTAAACATGG + Intronic
1046449825 8:114373807-114373829 CCTTAAAGTATTCAGTAACTTGG + Intergenic
1047261936 8:123270945-123270967 TCTTAAAAGATACTTAATCTTGG - Intronic
1047566009 8:126045082-126045104 CCTTAAGGGAGTTTTAAACATGG - Intergenic
1049926735 9:416305-416327 CCATCAAGGATTCTCAAAATGGG - Intronic
1051500154 9:17768069-17768091 GCTTAAAAGATTCTTAATCAGGG + Intronic
1051539161 9:18194979-18195001 CTTTCATGCATTCTTAAACTGGG - Intergenic
1051874652 9:21778455-21778477 CCTCAAATGTTTCTTAATCTAGG - Intergenic
1052792390 9:32887776-32887798 TCTTAAATTATTCTTAAATTGGG + Intergenic
1053573855 9:39337681-39337703 CCTTAAAGGATTCTTTCTCAGGG + Intergenic
1053625034 9:39860758-39860780 CCTTAAAGGATTCTTTCTCAAGG + Intergenic
1053838477 9:42166238-42166260 CCTTAAAGGATTCTTTCTCAGGG + Intergenic
1053879836 9:42582470-42582492 CCTTAAAGGATTCTTTCTCAAGG - Intergenic
1053892831 9:42711850-42711872 CCTTAAAGGATTCTTTCTCAAGG + Intergenic
1054095421 9:60896369-60896391 CCTTAAAGGATTCTTTCTCAGGG + Intergenic
1054116883 9:61172289-61172311 CCTTAAAGGATTCTTTCTCAGGG + Intergenic
1054218862 9:62389940-62389962 CCTTAAAGGATTCTTTCTCAAGG - Intergenic
1054231855 9:62519229-62519251 CCTTAAAGGATTCTTTCTCAAGG + Intergenic
1054590869 9:67010274-67010296 CCTTAAAGGATTCTTTCTCAGGG - Intergenic
1056619911 9:88203663-88203685 AAGTAAAGGATTTTTAAACTAGG + Intergenic
1056864082 9:90214017-90214039 CCTCAAAGGAGTCATAAATTCGG + Intergenic
1056915813 9:90745403-90745425 CCTCAAAGGAGTCATAAATTCGG - Intergenic
1056931943 9:90886027-90886049 ACTCAAAGGAATCTTAAACGTGG + Intronic
1059080795 9:111247257-111247279 CCTCAAAATATTTTTAAACTAGG - Intergenic
1059644404 9:116250350-116250372 CTTCATAGGATTCTGAAACTGGG - Intronic
1203688751 Un_GL000214v1:22161-22183 CCATATAGGCTTCTTAAAATTGG - Intergenic
1203753865 Un_GL000218v1:105562-105584 CCATATAGGCTTCTTAAAATTGG + Intergenic
1203713262 Un_KI270742v1:118096-118118 CCATATAGGCTTCTTAAAATTGG + Intergenic
1203537942 Un_KI270743v1:59959-59981 CCATACAGGCTTCTTAAAATTGG - Intergenic
1203647524 Un_KI270751v1:81892-81914 CCATATAGGCTTCTTAAAATTGG + Intergenic
1188149666 X:26656223-26656245 CCTTAAAGGATTACTAAACATGG - Intergenic
1188749771 X:33890474-33890496 CCTTAAGGAAATCATAAACTGGG - Intergenic
1191025800 X:55911885-55911907 CCTAAAACAATTCTTAACCTTGG + Intergenic
1191178010 X:57527341-57527363 GCTTAAAGGATTTCTAAACATGG - Intergenic
1192194760 X:69020892-69020914 CCTTAAAGGGTTCTTGAGCAGGG + Intergenic
1192866120 X:75133823-75133845 CCTTAAAGGAGTGCTAAACACGG + Intronic
1193671126 X:84388102-84388124 CCTTTAAGGATGCTAAAAATAGG + Intronic
1194037707 X:88898584-88898606 TCTCAAAGGAGTCTTAAACATGG + Intergenic
1194206123 X:91014025-91014047 GCTTAAAGGAGTTTTAAACATGG - Intergenic
1194216597 X:91136727-91136749 CCTTAAAGGAGTCTAAGAGTTGG + Intergenic
1194795357 X:98205034-98205056 CCTTAATGTATTTTTAAAGTTGG - Intergenic
1194803346 X:98298155-98298177 CCTTAAAGTCTGTTTAAACTGGG - Intergenic
1195415437 X:104615133-104615155 CCTTAAGGGATTTCTAAACATGG - Intronic
1195494714 X:105517333-105517355 CCTTACTGGATGTTTAAACTTGG + Intronic
1196484081 X:116183806-116183828 GCTCAAAGGAGTCTTAAACTTGG + Intergenic
1196496653 X:116331279-116331301 CCTTAAAGGAGTGCTAAACATGG + Intergenic
1197305066 X:124831601-124831623 ACTTCAAGGATTCTAAACCTTGG + Intronic
1197600818 X:128526476-128526498 TCTTAAAGGAGTTCTAAACTTGG + Intergenic
1197888244 X:131240154-131240176 CCCTATAGGATTCCTAATCTAGG + Intergenic
1198676971 X:139141423-139141445 CATTAAAGGATTTTAAACCTAGG - Intronic
1200551880 Y:4588841-4588863 GCTTAAAGGAGTTTTAAACATGG - Intergenic