ID: 1000046744

View in Genome Browser
Species Human (GRCh38)
Location 5:157528140-157528162
Sequence TTCCATTTGAACCCTGGAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 521
Summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 496}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000046744_1000046749 27 Left 1000046744 5:157528140-157528162 CCTTCTCCAGGGTTCAAATGGAA 0: 1
1: 0
2: 1
3: 23
4: 496
Right 1000046749 5:157528190-157528212 AATCAGTCCACCCACAGCCTTGG 0: 1
1: 0
2: 1
3: 8
4: 205

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000046744 Original CRISPR TTCCATTTGAACCCTGGAGA AGG (reversed) Intronic
901369128 1:8781267-8781289 AATCACTTGAACCCTGGAGATGG + Intronic
901442183 1:9285002-9285024 AATCACTTGAACCCTGGAGACGG - Intergenic
902421982 1:16288057-16288079 AACCACTTGAACCCAGGAGATGG + Intronic
902778299 1:18688825-18688847 AACCATTTGAACCCGGGAGATGG + Intronic
902882813 1:19384010-19384032 TTCCATTTAAAGCCAGGAAAGGG + Intronic
904223079 1:28989703-28989725 TTCGATTTGAACCCTCTAGTCGG - Intronic
905657754 1:39696279-39696301 ATCCACTTGAACCCGGGAGCTGG + Intronic
906474131 1:46156370-46156392 AATCGTTTGAACCCTGGAGACGG + Intronic
907054329 1:51350999-51351021 AATCACTTGAACCCTGGAGATGG - Intergenic
907359989 1:53906563-53906585 TTCCTTTTGAACCCAGATGATGG + Intronic
907422740 1:54358113-54358135 TTCCATTTTAACCCACCAGATGG + Intronic
907468609 1:54656421-54656443 AATCACTTGAACCCTGGAGATGG + Intronic
908434729 1:64093820-64093842 TCACCTTTGAACCCTGGAAAAGG + Intronic
908825695 1:68130976-68130998 ATCTCTTTGAACCCTGGAGGCGG - Intronic
909019798 1:70418334-70418356 AACCATTTGAACCCAGGAGGCGG - Intronic
910643473 1:89489285-89489307 TTCCATCTGAAGACAGGAGAGGG + Intergenic
910931907 1:92451441-92451463 TATCATTTGAACCCAGGAGGCGG - Intergenic
912602398 1:110949933-110949955 GACCATTTGACCTCTGGAGAAGG - Exonic
913349880 1:117845603-117845625 AATCACTTGAACCCTGGAGATGG + Intergenic
914713359 1:150234970-150234992 CTGAATTTGATCCCTGGAGACGG - Intronic
915451703 1:156009858-156009880 AATCATTTGAACCCTGGAGGCGG - Intronic
916670557 1:167014935-167014957 TATCATTTGAACCCTGGAGGTGG + Intronic
917957804 1:180118029-180118051 TTCCCTCTGAAGTCTGGAGATGG - Intergenic
918780744 1:188697098-188697120 AACAATTTGAACCCAGGAGACGG + Intergenic
919534016 1:198763761-198763783 TTCCATTTTTACTCTGGAAAGGG - Intergenic
919658500 1:200220651-200220673 AATCATTTGAACCCTGGAGGCGG - Intergenic
920802528 1:209202710-209202732 AATCACTTGAACCCTGGAGATGG + Intergenic
921573922 1:216811823-216811845 TTCCATTTTAAGCCTAGTGATGG + Intronic
922480120 1:225934619-225934641 AATCACTTGAACCCTGGAGACGG - Intergenic
923510098 1:234643455-234643477 TGCCATGAGAACCATGGAGAGGG - Intergenic
923700344 1:236294228-236294250 AATCATTTGAACCCAGGAGATGG - Intergenic
923706600 1:236349255-236349277 ATCGCTTTGAACCCGGGAGATGG - Intronic
924493326 1:244561572-244561594 TTCCCTCTGAAACCTGTAGAGGG + Intronic
924551427 1:245081553-245081575 AACCACTTGAACCCGGGAGATGG - Intronic
1063145541 10:3291791-3291813 AATCACTTGAACCCTGGAGATGG + Intergenic
1064309932 10:14202992-14203014 GACCATTTGAACCCAGGAGTTGG - Intronic
1064540384 10:16398970-16398992 AACCACTTGAACCCAGGAGATGG + Intergenic
1064918388 10:20487598-20487620 AATCATTTGAACCCAGGAGATGG - Intergenic
1065017553 10:21475914-21475936 AATCATTTGAACCCTGGAGGCGG - Intergenic
1065153643 10:22847800-22847822 AACCACTTGAACCCGGGAGATGG + Intergenic
1065855260 10:29824967-29824989 AACCATTTGAACCCGGGAGGTGG + Intergenic
1066378070 10:34876580-34876602 AATCATTTGAACCCAGGAGATGG + Intergenic
1069420642 10:68243445-68243467 ATCCACTTGAACCCAGGAGATGG + Intergenic
1070400119 10:76045983-76046005 GTCCACTTGAACCTAGGAGAAGG - Intronic
1071675289 10:87650108-87650130 AATCACTTGAACCCTGGAGACGG - Intergenic
1072062075 10:91822964-91822986 AATCGTTTGAACCCTGGAGATGG + Intronic
1072640867 10:97210092-97210114 AATCATTTGAACCCAGGAGACGG + Intronic
1072643521 10:97233060-97233082 AATCACTTGAACCCTGGAGATGG + Intronic
1073866357 10:107808949-107808971 TTCCACATCATCCCTGGAGAAGG - Intergenic
1075063592 10:119273858-119273880 AATCATTTGAACCCAGGAGATGG - Intronic
1075810106 10:125218952-125218974 TTCCTTTTCTACCCTGGAGCTGG + Intergenic
1076602613 10:131668572-131668594 AATCATTTGAACCCTGGAGGCGG + Intergenic
1077624047 11:3754337-3754359 TATCACTTGAACCCGGGAGACGG + Intronic
1079444002 11:20543226-20543248 ATTCACTTGAACCCAGGAGATGG + Intergenic
1079709288 11:23661535-23661557 AATCACTTGAACCCTGGAGATGG - Intergenic
1080175581 11:29358915-29358937 CTACATTTGAACACTGGAAATGG + Intergenic
1081239253 11:40682682-40682704 AATCACTTGAACCCTGGAGATGG + Intronic
1081537573 11:44006590-44006612 AATCATTTGAACCCAGGAGATGG - Intergenic
1082096134 11:48131162-48131184 CTTCACTTGAACCCAGGAGATGG - Intronic
1083233724 11:61339056-61339078 TTCCCTATGAAACCTGGAGGTGG - Exonic
1083458504 11:62795387-62795409 AACCACTTGAACCCAGGAGACGG + Intronic
1083562473 11:63684036-63684058 AATCATTTGAACCCCGGAGATGG - Intronic
1086207268 11:84274554-84274576 CTCCATTTGTACCCTGATGATGG + Intronic
1086482449 11:87257015-87257037 TTCCATATAAACCCTAGAAATGG + Intronic
1087035797 11:93755270-93755292 GCCCATGTGAACCCTGCAGATGG + Exonic
1087972206 11:104498181-104498203 AATCATTTGAACCCAGGAGACGG + Intergenic
1088225920 11:107620072-107620094 TTTCATTTGAACCAAAGAGAAGG + Intronic
1088325564 11:108597282-108597304 AATCATTTGAACCCTGGAGGCGG - Intergenic
1088768756 11:113012103-113012125 AGCCACTTGAACCCAGGAGATGG - Intronic
1089090591 11:115871475-115871497 TTCCACTTGCATCCTGGAGTTGG - Intergenic
1089117088 11:116104085-116104107 AATCACTTGAACCCTGGAGATGG + Intergenic
1089311779 11:117562816-117562838 AACCACTTGAACCCGGGAGATGG - Intronic
1089758845 11:120708126-120708148 CTCCATATGAGCCATGGAGAAGG + Intronic
1090163079 11:124516432-124516454 TTCCATTTTACCCCTGGACCAGG - Intergenic
1091502529 12:1032957-1032979 AGTCACTTGAACCCTGGAGATGG - Intronic
1092306796 12:7309868-7309890 AATCACTTGAACCCTGGAGATGG - Intronic
1092372405 12:7928017-7928039 AATCATTTGAACCCAGGAGATGG + Intronic
1093858775 12:24137543-24137565 AAACACTTGAACCCTGGAGATGG + Intergenic
1094060093 12:26304496-26304518 TTGCATTTAAAGCCTTGAGAAGG - Intergenic
1094815757 12:34181935-34181957 AATCACTTGAACCCTGGAGATGG - Intergenic
1095285360 12:40404259-40404281 AATCATTTGAACCCAGGAGACGG - Intronic
1095616822 12:44200030-44200052 ATCGGCTTGAACCCTGGAGATGG + Intronic
1095877901 12:47101857-47101879 TGTCATTTGAACCCAGGAGGCGG + Intronic
1097277721 12:57824501-57824523 ATCCATTGGAAGCCTGGTGAGGG - Intronic
1098574039 12:72020573-72020595 AATCATTTGAACCCAGGAGACGG - Intronic
1098824839 12:75282986-75283008 TTTCATATGAATCCTAGAGATGG - Intronic
1098860748 12:75707436-75707458 AATCATTTGAACCCAGGAGACGG - Intergenic
1098888087 12:75980833-75980855 AACCACTTGAACCCAGGAGATGG - Intergenic
1098914697 12:76245072-76245094 AACCATTTGAACCCGGGAGGCGG + Intergenic
1099767428 12:87005919-87005941 AATCATTTGAACCCAGGAGATGG + Intergenic
1100515406 12:95322743-95322765 AATCATTTGAACCCAGGAGACGG + Intergenic
1101293758 12:103399453-103399475 TTCTATTTGAACCCGGGAGGTGG - Intronic
1101382479 12:104226111-104226133 AATCATTTGAACCCTGGAGGTGG + Intronic
1101895036 12:108749918-108749940 AATCATTTGAACCCAGGAGATGG + Intergenic
1102149794 12:110680841-110680863 AACCATTTGAACCCAGGAGACGG + Intronic
1102338007 12:112098842-112098864 TCCCAGTTGAACCTTGGAGGCGG - Intronic
1102365352 12:112329452-112329474 AATCATTTGAACCCAGGAGACGG - Intronic
1102867577 12:116386349-116386371 AATCATTTGAACCCTGGAGGCGG - Intergenic
1102914709 12:116744137-116744159 AACCACTTGAACCCTGGAGGTGG + Intronic
1103988611 12:124783691-124783713 TCCCACTTGAACCCGGGAGGTGG + Intronic
1104004823 12:124884534-124884556 ATCCATTAGAACCCGGGAGGCGG + Intergenic
1105389871 13:19965858-19965880 TTCAAGTTGAACCCAGGAGGCGG - Intronic
1105973551 13:25453211-25453233 TATCATTTGAACCCAGGAGGTGG - Intronic
1107017930 13:35722705-35722727 TACCATTTGAAGCCTTTAGAAGG - Intergenic
1108781651 13:53843629-53843651 AATCATTTGAACCCGGGAGACGG + Intergenic
1109481906 13:62965854-62965876 TACCACTTGAGCCCTGGAGGTGG + Intergenic
1109890340 13:68603390-68603412 GTCAATTTGAACACTGTAGATGG + Intergenic
1111256732 13:85679378-85679400 CTCCACTTGAACCCGGGAGGCGG - Intergenic
1111807139 13:93051686-93051708 AATCATTTGAACCCAGGAGATGG + Intergenic
1113280825 13:108785649-108785671 TTCCATTCACATCCTGGAGAAGG - Exonic
1114903515 14:27097426-27097448 TATCATTTGAACACTGGAGGCGG - Intergenic
1116007766 14:39314298-39314320 AATCATTTGAACCCTGGAGGTGG + Intronic
1116059608 14:39905462-39905484 TTCCCTTTGAACACTGAAGCTGG - Intergenic
1116585885 14:46703488-46703510 TTCCTTTTGAACTCTGAACATGG - Intergenic
1116722192 14:48511775-48511797 TTCCATTGTAACAGTGGAGAAGG - Intergenic
1116791826 14:49347740-49347762 TTTGGCTTGAACCCTGGAGATGG - Intergenic
1117273308 14:54166967-54166989 TTCCACTTCAGCTCTGGAGAGGG + Intergenic
1117353028 14:54899949-54899971 AATCATTTGAACCCTGGAGGCGG - Intronic
1118286716 14:64481017-64481039 AATCATTTGAACCCGGGAGATGG - Exonic
1118404094 14:65406620-65406642 AATCATTTGAACCCAGGAGAAGG - Intergenic
1118733819 14:68688181-68688203 AATCACTTGAACCCTGGAGACGG + Intronic
1118864720 14:69693901-69693923 TACAAATTGTACCCTGGAGAGGG + Intronic
1119352225 14:73975489-73975511 AATCATTTGAACCCTGGAGGCGG - Intronic
1119840148 14:77786332-77786354 TTCCAATCCAACCCTGGAGGCGG - Intergenic
1123541187 15:21293438-21293460 TTCCTTTTGGACCCTAAAGAAGG + Intergenic
1124015318 15:25869031-25869053 TTCCAGTAGATCCCTTGAGAAGG + Intergenic
1124032944 15:26027874-26027896 AATCACTTGAACCCTGGAGACGG - Intergenic
1125134005 15:36319914-36319936 AATCACTTGAACCCTGGAGAAGG + Intergenic
1126584747 15:50272854-50272876 TATCACTTGAACCCAGGAGACGG - Intergenic
1126594898 15:50375477-50375499 TTTCACTTGAACCCGGGAGGCGG - Intergenic
1126957264 15:53947457-53947479 TTCAAATTGTACCTTGGAGATGG - Intergenic
1127038007 15:54941147-54941169 TTCCAGGTGAACCATGCAGAGGG - Intergenic
1127890544 15:63246746-63246768 TACCATTCGACCTCTGGAGAAGG - Intronic
1128072508 15:64806624-64806646 ATCTTTTTGAACCCTGGAGAGGG + Intergenic
1129804461 15:78443731-78443753 AATCGTTTGAACCCTGGAGATGG - Intronic
1132339532 15:101069210-101069232 TTCCATCTGAGACCTGGGGATGG - Exonic
1202949500 15_KI270727v1_random:20579-20601 TTCCTTTTGGACCCTAAAGAAGG + Intergenic
1133247486 16:4458917-4458939 ATCCGCTTGAACCCTGGAGGTGG + Intergenic
1133520093 16:6548986-6549008 ATTCACTTGAACCCTGGAGGTGG + Intronic
1134031299 16:10994615-10994637 TATCACTTGAACCCAGGAGACGG + Intronic
1135017709 16:18937983-18938005 TTTCGTTTGAACCCAGGAGGTGG - Intergenic
1135109033 16:19676163-19676185 AATCATTTGAACCCAGGAGATGG + Intronic
1135286660 16:21199238-21199260 TTTCCCTTGAACCCTGGAGGTGG + Intronic
1135535000 16:23287089-23287111 AACCACTTGAACCCTGGAGGCGG - Intronic
1135876984 16:26211382-26211404 TTCCATTTGAAATCTGGGGCAGG - Intergenic
1136057638 16:27702218-27702240 TTCTACTGGAAACCTGGAGAAGG - Intronic
1136162557 16:28430017-28430039 AACCATTTGAACCTGGGAGACGG + Intergenic
1136200409 16:28684972-28684994 AACCATTTGAACCTGGGAGACGG - Intergenic
1136216756 16:28799165-28799187 AACCATTTGAACCTGGGAGACGG - Intergenic
1136532928 16:30882045-30882067 ATTCACTTGAACCCTGGAGGCGG - Intronic
1136570922 16:31096157-31096179 AACCACTTGAACCCTGGAGGCGG - Intergenic
1138406743 16:56801497-56801519 AATCACTTGAACCCTGGAGATGG - Intronic
1138947109 16:61864682-61864704 TTCTTTTTTAACCCTGGATATGG + Intronic
1138991042 16:62391859-62391881 AATCACTTGAACCCTGGAGATGG - Intergenic
1139454484 16:67062253-67062275 AATCATTTGAACCCGGGAGATGG - Intronic
1139629882 16:68223806-68223828 AACCACTTGAACCCGGGAGACGG + Intronic
1140164280 16:72533392-72533414 AATCATTTGAACCCGGGAGACGG - Intergenic
1140278170 16:73529601-73529623 TCCCATTTGTCCCCTGGACAAGG - Intergenic
1140471815 16:75219476-75219498 GATCATTTGAACCCAGGAGATGG - Intronic
1140507766 16:75484755-75484777 AATCATTTGAACCCGGGAGATGG + Intronic
1140521834 16:75588493-75588515 AACCATTTGAACCCAGGAGAAGG - Intergenic
1140702342 16:77592660-77592682 TTTCACTTGAACCCAGGAGACGG - Intergenic
1141588054 16:85048210-85048232 TTCCATGTGCACCTTGCAGAGGG + Intronic
1141681646 16:85547790-85547812 ATTCACTTGAACCCTGGAGGCGG + Intergenic
1142013736 16:87732180-87732202 ATTCACTTGAACCCTGGAGGCGG - Intronic
1143507427 17:7375520-7375542 AATCATTTGAACCCAGGAGATGG + Intergenic
1143560463 17:7691120-7691142 AATCATTTGAACCCAGGAGATGG + Intronic
1143697954 17:8634125-8634147 AATCATTTGAACCCAGGAGATGG + Intergenic
1144010387 17:11142822-11142844 TTCCATTTGCACCCTGCTTAAGG - Intergenic
1144544945 17:16185594-16185616 AATCACTTGAACCCTGGAGACGG + Intronic
1144558029 17:16298938-16298960 AACCATTCGAACCCAGGAGATGG + Intronic
1144564760 17:16351017-16351039 AATCATTTGAACCCTGGAGGTGG - Intronic
1145832007 17:27924034-27924056 AATCACTTGAACCCTGGAGATGG - Intergenic
1146025585 17:29317699-29317721 AATCACTTGAACCCTGGAGACGG + Intergenic
1146292972 17:31624824-31624846 AATCATTTGAACCCCGGAGATGG + Intergenic
1146392574 17:32436745-32436767 TACCATTCGAGCTCTGGAGAGGG - Intergenic
1146585002 17:34074870-34074892 AATCACTTGAACCCTGGAGATGG - Intronic
1147222594 17:38947211-38947233 AATCACTTGAACCCTGGAGATGG + Intronic
1147455521 17:40535853-40535875 AACCATTTGAACCCGGGAGGTGG - Intergenic
1147699008 17:42380119-42380141 TTGCTTTTGAACCCAGGAGGTGG - Intronic
1148023882 17:44572059-44572081 TATCACTTGAACCCAGGAGATGG - Intergenic
1148637738 17:49161768-49161790 TATCATTTGAACCCTGAAGGCGG + Intronic
1148934863 17:51156914-51156936 TTGCTTTTGAACCCAGGAGGCGG + Intronic
1149567422 17:57649990-57650012 TTTCATCTCCACCCTGGAGAGGG - Intronic
1149587689 17:57803820-57803842 AATCATTTGAACCCGGGAGAGGG - Intergenic
1150332360 17:64304470-64304492 AACCATTTGAACCCAGGAGGCGG + Intergenic
1150339565 17:64355679-64355701 CTCCACTTGAGCCCTGGAGTTGG - Intronic
1150368749 17:64616566-64616588 ATCCACTTGAACCCAGGAGGCGG + Intronic
1150439415 17:65179249-65179271 TTGCTTTTGCTCCCTGGAGAGGG + Intronic
1150495685 17:65606293-65606315 AATCATTTGAACCCTGGAGGTGG + Intronic
1150873571 17:68943649-68943671 GTCCCTTTTATCCCTGGAGAAGG - Intronic
1151755670 17:76074227-76074249 AACCGTTTGAACCCGGGAGACGG + Intronic
1153344477 18:4011087-4011109 AACCACTTGAACCCAGGAGATGG + Intronic
1154108365 18:11544982-11545004 TTCCAGTTCAAACCTGGAAAGGG - Intergenic
1154207161 18:12347038-12347060 GTTTATTTGAACCCTGGAGGTGG + Intronic
1155203198 18:23535378-23535400 TTCCATGTAAACCCTAAAGATGG - Intronic
1156049364 18:32913451-32913473 CTCCACTTGAACCCAGGAGGTGG + Intergenic
1156163017 18:34383072-34383094 TTTCATTGGAACCCAGGAAACGG - Intergenic
1156631370 18:38973391-38973413 TTCCCTTTGACCACTGTAGAAGG - Intergenic
1156728456 18:40159608-40159630 TTACATTTGCATCCTGTAGAGGG - Intergenic
1157260192 18:46170590-46170612 AATCACTTGAACCCTGGAGATGG - Intergenic
1157822980 18:50787491-50787513 ATCCACTTGAACCCAGGAGGCGG + Intergenic
1158275535 18:55763079-55763101 TTCCACTTGAACTCTTAAGATGG - Intergenic
1158318344 18:56236935-56236957 AATCATTTGAACCCGGGAGATGG - Intergenic
1158438294 18:57450258-57450280 AATCAATTGAACCCTGGAGACGG - Intronic
1159817623 18:73095634-73095656 AACCACTTGAACCCTGGAGGTGG - Intergenic
1160495684 18:79373574-79373596 AATCATTTGAACCCAGGAGACGG - Intronic
1161617274 19:5278561-5278583 GTCCACTTGAACCCAGGAGGCGG - Intronic
1162394620 19:10409694-10409716 AATCATTTGAACCCTGGAGGCGG + Intronic
1162545942 19:11329766-11329788 AACCATTTGAACCCGGGAGGCGG - Intronic
1162712381 19:12605064-12605086 AATCATTTGAACCCTGGAGATGG + Intronic
1163100555 19:15093506-15093528 AACCATTTGAACCCAGGAGGTGG - Intergenic
1163176500 19:15567526-15567548 GATCATTTGAACCCAGGAGATGG - Intergenic
1163384085 19:16988521-16988543 AATCACTTGAACCCTGGAGACGG + Intronic
1163578779 19:18125652-18125674 AATCATTTGAACCCTGGAGGCGG + Intronic
1163596815 19:18225410-18225432 TTCCATTTCAACCAGGGAGTGGG - Intronic
1163700518 19:18784499-18784521 TGCCATTTGGCCCCTGAAGAAGG - Intronic
1163841386 19:19612903-19612925 AACCGATTGAACCCTGGAGACGG - Intronic
1164013551 19:21231567-21231589 AATCATTTGAACCCTGGAGGTGG - Intronic
1164061742 19:21681293-21681315 AATCATTTGAACCCTAGAGACGG + Intergenic
1164165095 19:22666275-22666297 AATCACTTGAACCCTGGAGACGG - Exonic
1165087099 19:33358042-33358064 AACCATTTGAACCCAGGAGGCGG - Intergenic
1165416300 19:35695822-35695844 CATCATTTGAACCCAGGAGATGG + Intergenic
1166724705 19:45019762-45019784 AATCACTTGAACCCTGGAGATGG - Intronic
1166780067 19:45337392-45337414 AATCATTTGAACCCGGGAGATGG + Intronic
1166907646 19:46124274-46124296 TTCCTTTTGAACACTGGAGGAGG + Exonic
1167017834 19:46852756-46852778 AAGCACTTGAACCCTGGAGATGG + Intergenic
1167082384 19:47285777-47285799 AATCATTTGAACCCAGGAGACGG - Intergenic
1167104007 19:47419880-47419902 TCCCACGTGACCCCTGGAGATGG - Intergenic
1167167257 19:47806989-47807011 TATCACTTGAACCCGGGAGATGG - Intronic
1167323734 19:48811842-48811864 AATCATTTGAACCCTGGAGGCGG + Intergenic
1167436135 19:49479889-49479911 ATTCGCTTGAACCCTGGAGATGG - Intronic
1167652040 19:50737052-50737074 CTCAATTTGAACCCAGGAGTTGG - Intergenic
1168068215 19:53932165-53932187 ATCGCTTTGAACCCAGGAGATGG + Intronic
1168083050 19:54024391-54024413 TCCCGCTTGAACCCGGGAGATGG - Intergenic
1168214358 19:54914423-54914445 AATCATTTGAACCCTGGAGGTGG - Intronic
1168608058 19:57775687-57775709 AATCATTTGAACCCAGGAGATGG - Intronic
925416484 2:3673352-3673374 TGCCATTTGAACCCTGGAACAGG + Intronic
925750778 2:7089364-7089386 GTCAATTTCATCCCTGGAGAGGG - Intergenic
925955508 2:8960124-8960146 TGCCATTAGAACCCTTTAGAAGG - Intronic
927245339 2:20952952-20952974 TTCCATTTGAACACTGCAAGTGG + Intergenic
928100036 2:28431597-28431619 TGCCATTGGCACCCTGCAGATGG + Intergenic
928312492 2:30222462-30222484 TTCCACTTCCACCCTAGAGAGGG - Intergenic
929409064 2:41676444-41676466 AATCATTTGAACCCAGGAGATGG + Intergenic
929448520 2:42020076-42020098 TTCTATTTGAAACCTCGAGGAGG + Intergenic
930292203 2:49509293-49509315 AATCATTTGAACCCGGGAGATGG - Intergenic
930545456 2:52761778-52761800 AGTCATTTGAACCCTGGAGGGGG + Intergenic
930635803 2:53804358-53804380 AACCACTTGAACCCAGGAGATGG - Intronic
931090501 2:58880782-58880804 AATCATTTGAACCCTGGAGGTGG + Intergenic
931878453 2:66540393-66540415 ATCCACTTGAACCCAGGAGGTGG - Intronic
932360393 2:71100633-71100655 TTCCATGTGTACCCGGCAGAGGG + Intergenic
932490032 2:72114562-72114584 TCCCATTTGAAACCAGGAGCTGG + Intergenic
933017818 2:77152212-77152234 TGCCATTTGACCCCAAGAGAGGG + Intronic
934091167 2:88551904-88551926 AACCACTTGAACCCTGGAGGTGG - Intergenic
935204265 2:100883931-100883953 TTCTGTTTCACCCCTGGAGAGGG + Intronic
935733464 2:106085806-106085828 TTCCATTTTAACCCTGAGGGAGG - Intergenic
935872250 2:107463633-107463655 AATCATTTGAACCCGGGAGACGG + Intergenic
936082706 2:109445782-109445804 TTCCATTTCATCCCTGAAGTGGG + Intronic
936408022 2:112225728-112225750 TATCACTTGAACCCAGGAGACGG + Intronic
936521480 2:113214583-113214605 AATCACTTGAACCCTGGAGACGG - Intergenic
937108518 2:119342523-119342545 TATCACTTGAACCCAGGAGACGG + Intronic
937129031 2:119493383-119493405 GTCCATTTGAACCCTGGCAGTGG + Intronic
937619287 2:123967214-123967236 AATCATTTGAACCCTGGAGGTGG - Intergenic
938301448 2:130216939-130216961 AATCATTTGAACCCAGGAGACGG + Intergenic
938899920 2:135791219-135791241 GTCCATTGGAAGCCTGGAGCTGG - Intronic
939104023 2:137928297-137928319 AACCACTTGAACCCTGGAGGTGG + Intergenic
939561394 2:143736307-143736329 ATTCATTTGAACCCAGGAGGTGG + Intronic
940755410 2:157676308-157676330 AATCATTTGAACCCGGGAGATGG + Intergenic
941519389 2:166520545-166520567 AATCATTTGAACCCAGGAGACGG + Intergenic
942658592 2:178240479-178240501 GACCACTTGAACCCAGGAGATGG + Intronic
942730722 2:179058045-179058067 TTCCATCTGAGCCCTGGGGAAGG + Intergenic
942844421 2:180405381-180405403 TTCCACTTCAACTCTGGAAAAGG - Intergenic
943684333 2:190801843-190801865 TTCCATAGAAATCCTGGAGATGG - Intergenic
944091480 2:195916769-195916791 AGTCATTTGAAGCCTGGAGACGG + Intronic
944242805 2:197501674-197501696 AATCATTTGAACCCTGGAGGCGG + Intronic
945228966 2:207563855-207563877 AATCACTTGAACCCTGGAGACGG + Intronic
945249345 2:207750947-207750969 TTCCATTTCATTCCTGGAGGAGG - Exonic
945755800 2:213845282-213845304 AATCATTTGAACCCAGGAGATGG - Intronic
947196514 2:227573520-227573542 TTCCACTTGAACCCTGCGGAGGG + Intergenic
947604500 2:231475909-231475931 ATTCACTTGAACCCGGGAGACGG + Intronic
948074204 2:235153117-235153139 AACCACTTGAACCCAGGAGACGG - Intergenic
948433051 2:237932569-237932591 TATCACTTGAACCCTGGAGGTGG + Intergenic
1168961651 20:1874305-1874327 TTCCATTTCAGCTCTGGAGTTGG - Intergenic
1169873184 20:10269313-10269335 TTGCACTTGAACCCGGGAGGTGG + Intronic
1171501175 20:25594462-25594484 AACCACTTGAACCCTGGAGGTGG - Intergenic
1172239951 20:33406403-33406425 AATCATTTGAACCCTGGAGGTGG - Intergenic
1172514597 20:35524102-35524124 AACCATTTGAACCCAGGAGGCGG - Intronic
1172726692 20:37049114-37049136 AATCATTTGAACCCGGGAGATGG + Intronic
1173612596 20:44381365-44381387 AATCATTTGAACCCTGGAGTTGG - Intronic
1173762548 20:45576484-45576506 AATCATTTGAACCCAGGAGAGGG - Intronic
1174067955 20:47879194-47879216 AATCATTTGAACCCTGGAGGTGG - Intergenic
1174475334 20:50792171-50792193 AATCACTTGAACCCTGGAGAAGG + Intergenic
1174661170 20:52214709-52214731 AATCATTTGAACCCTGGAGGTGG - Intergenic
1176199068 20:63851975-63851997 AATCATTTGAACCCTGGAGGTGG + Intergenic
1176964815 21:15200375-15200397 TAACACTTGAATCCTGGAGAAGG + Intergenic
1177018678 21:15824701-15824723 AATCATTTGAACCCAGGAGATGG - Intronic
1177413612 21:20765827-20765849 TTTCAGTTGAAGACTGGAGAAGG + Intergenic
1177519563 21:22201049-22201071 TTCCAGTTTCTCCCTGGAGAGGG - Intergenic
1178181740 21:30169511-30169533 AATCATTTGAACCCTGGAGGTGG - Intergenic
1178880052 21:36442238-36442260 AATCATTTGAACCCGGGAGACGG - Intergenic
1178912888 21:36690374-36690396 AACCACTTGAACCCAGGAGATGG + Intergenic
1178952946 21:36999974-36999996 AATCATTTGAACCCGGGAGACGG - Intergenic
1179060032 21:37971377-37971399 TTCCATTTCATCCCTTGAGAAGG + Intronic
1179673641 21:42967030-42967052 AATCATTTGAACCCGGGAGACGG - Intergenic
1180630577 22:17226738-17226760 AATCATTTGAACCCGGGAGATGG + Intergenic
1180635778 22:17261911-17261933 AATCATTTGAACCCAGGAGACGG + Intergenic
1180660359 22:17461877-17461899 AATCACTTGAACCCTGGAGACGG - Intronic
1181557579 22:23680527-23680549 TTCCCTTGGAAACCTGGAAAAGG - Intergenic
1181873773 22:25923905-25923927 ATGCATTTTAACCCTGCAGAGGG - Intronic
1182543419 22:31058236-31058258 TCCCATCTGAACCATGGGGAAGG + Intergenic
1182581245 22:31313132-31313154 AACCACTTGAACCCTGGAGGTGG - Intergenic
1182658699 22:31909810-31909832 AACCATTTGAACCCGGGAGATGG + Intergenic
1183385356 22:37510993-37511015 AATCATTTGAACCCAGGAGATGG + Intronic
1184360616 22:44015730-44015752 AATCATTTGAACCCAGGAGACGG + Intronic
1185252520 22:49812188-49812210 TCCCACTTGAACCCAGGAGGTGG - Intronic
1185263511 22:49884857-49884879 TCTCACTTGAACCCTGGAGATGG + Exonic
950025155 3:9815152-9815174 ATCAACTTGAACCCAGGAGACGG + Intronic
950141537 3:10619374-10619396 TTCGGTTTGAAGCCTTGAGAAGG - Intronic
951367722 3:21804988-21805010 TTCCTATTGAACCCTGGAGGTGG + Intronic
951733232 3:25834131-25834153 AATCATTTGAACCCAGGAGACGG - Intergenic
952463266 3:33552203-33552225 AGCCGTTTGAACCCAGGAGACGG - Intronic
953604143 3:44398341-44398363 AATCATTTGAACCCGGGAGACGG + Intronic
953926578 3:46985692-46985714 TTACCTATGGACCCTGGAGAGGG + Intronic
954103257 3:48394159-48394181 GATCATTTGAACCCAGGAGATGG + Intronic
954329605 3:49882639-49882661 TTCCATAGGAACCCTGAAGGAGG - Intergenic
955170578 3:56560631-56560653 AATCACTTGAACCCTGGAGATGG + Intronic
955204456 3:56883104-56883126 TTACATTAGGACCCTGGATAAGG - Intronic
955675008 3:61438975-61438997 TTCCTTTTGAACTCTGCAGGAGG - Intergenic
955987703 3:64591728-64591750 CTCCATTTTGACCTTGGAGAAGG + Intronic
956144014 3:66173964-66173986 AATCATTTGAACCCAGGAGATGG + Intronic
956493172 3:69796066-69796088 AATCATTTGAACCCAGGAGACGG - Intronic
957777502 3:84772722-84772744 ATCAATTTGAACCCAGGGGATGG - Intergenic
958716721 3:97792394-97792416 AATCATTTGAACCCAGGAGATGG + Intronic
958973724 3:100641689-100641711 TGCCATATGGACCCTGGAGCAGG + Intronic
959695990 3:109248996-109249018 AATCATTTGAACCCTGGAGGTGG + Intergenic
959824526 3:110777825-110777847 AACCATTTGAACCCAGGAGGTGG + Intergenic
960026398 3:113015747-113015769 TTCCATGTGATCCCTGAAGTAGG - Intronic
960650985 3:119949712-119949734 TATCATTTGAACCCAGGAGGTGG + Intronic
961101068 3:124199470-124199492 TTCCTTTTATACTCTGGAGAGGG + Intronic
962079150 3:132118565-132118587 GATCACTTGAACCCTGGAGATGG - Intronic
962308238 3:134307608-134307630 GTCCATTTGAAGCCAGGACAAGG - Intergenic
962800710 3:138888237-138888259 AATCATTTGAACCCAGGAGACGG - Intergenic
963396546 3:144741745-144741767 ATTCATTTGAACCCGGGAGGCGG + Intergenic
964254675 3:154762458-154762480 AATCATTTGAACCCTGGAGGTGG + Intergenic
965842486 3:172922833-172922855 AATCATTTGAACCCTGGAGGTGG + Intronic
966996853 3:185291056-185291078 TTTCATTTGAACCTTGCAAAGGG + Intronic
967077857 3:186020891-186020913 AATCACTTGAACCCTGGAGACGG - Intergenic
967794312 3:193582233-193582255 AATCATTTGAACCCTGGAGGGGG - Intronic
968241181 3:197087737-197087759 TTCCATAAGAATCCTGGAGATGG + Intronic
968378059 4:61255-61277 AACCATTTGAACCCGGGAGGTGG - Intronic
968619287 4:1596596-1596618 TTCCATCTGGTCCCTGTAGAGGG - Intergenic
968672649 4:1860049-1860071 AATCACTTGAACCCTGGAGATGG + Intergenic
969081195 4:4619706-4619728 AATCACTTGAACCCTGGAGACGG - Intergenic
969208059 4:5663832-5663854 AACCACTTGAACCCAGGAGACGG + Intronic
969504443 4:7575806-7575828 TCCAAGTTGAACCCAGGAGAAGG + Intronic
969853774 4:9982953-9982975 AACCACTTGAACCCAGGAGATGG - Intronic
970101934 4:12533280-12533302 AACCATTTGAACCCGGGAGGTGG + Intergenic
970895254 4:21094961-21094983 TTCTATTTCTACCATGGAGAAGG - Intronic
970930042 4:21499242-21499264 AATCATTTGAACCCAGGAGACGG + Intronic
971366608 4:25982784-25982806 AACCATTTGAACCCAGGAGGTGG - Intergenic
971559430 4:28057379-28057401 AATCATTTGAACCCAGGAGACGG + Intergenic
971792731 4:31189337-31189359 TGACATTTGAACCCAGGTGAAGG - Intergenic
975593767 4:76027164-76027186 AATCACTTGAACCCTGGAGACGG + Intronic
976202793 4:82596581-82596603 ACTCATTTGAACCCTGGAGGTGG - Intergenic
976204368 4:82610470-82610492 AATCACTTGAACCCTGGAGACGG - Intergenic
977246479 4:94637470-94637492 AATCATTTGAACCCTGGAGGTGG + Intronic
977847028 4:101778554-101778576 TCCCATGTGAACCCTAGAGGAGG - Intronic
978834871 4:113136841-113136863 ATCCACTTGAACCCGGGAGGCGG - Intronic
980802906 4:137776008-137776030 TTCCATATGTTCCCTGGAGCAGG + Intergenic
980838605 4:138229139-138229161 TTCCCTGTGATCCCTGGGGAAGG - Intronic
981106594 4:140888667-140888689 TTCCATTTTGCCCCTGCAGATGG + Intronic
981595332 4:146414634-146414656 AACCACTTGAACCCAGGAGACGG + Intronic
981595673 4:146419062-146419084 TTCCCATTGTGCCCTGGAGAGGG - Intronic
981729453 4:147882374-147882396 AACCATTTGAACCCAGGAGGCGG + Intronic
982926062 4:161338390-161338412 AATCATTTGAACCCAGGAGATGG - Intergenic
983243759 4:165263688-165263710 TTCTTCTTGAACCCTGGAGGCGG - Intronic
983587522 4:169371559-169371581 AATCATTTGAACCCTGGAGGTGG + Intergenic
984775701 4:183480134-183480156 AATCATTTGAACCCAGGAGACGG - Intergenic
985208276 4:187564440-187564462 TTCCATTTGAATGCTGAAGGTGG - Intergenic
986711735 5:10492848-10492870 CTCCTTTTGAAGCCTGGAGTGGG - Intergenic
987263822 5:16230368-16230390 TTCCATTTGATGCCTAGAAATGG - Intergenic
988660890 5:33267262-33267284 AATCACTTGAACCCTGGAGACGG - Intergenic
988909691 5:35826788-35826810 TTCCATTTCCACTCTAGAGAGGG + Intergenic
990414912 5:55576945-55576967 TTCCATTAGAAGACTGAAGAGGG + Intergenic
992688866 5:79223844-79223866 AACCATTTGAACCCGGGAGGCGG + Intronic
992728436 5:79633525-79633547 AACCGTTTGAACCCAGGAGACGG - Intronic
993111153 5:83658975-83658997 TTGAATTTGAAACCTGGAGCTGG + Intronic
994101156 5:95894151-95894173 CTCCGCTTGAACCCTGGAGGTGG + Intronic
994746940 5:103690040-103690062 GTTCACTTGAACCCGGGAGATGG - Intergenic
995070462 5:107915171-107915193 TTCCATATGGAATCTGGAGAGGG + Intronic
996731626 5:126722798-126722820 AATCACTTGAACCCTGGAGATGG + Intergenic
998299021 5:141000512-141000534 AATCACTTGAACCCTGGAGAAGG - Intronic
998660380 5:144230053-144230075 AATCATTTGAACCCTGGAGGTGG + Intronic
998684242 5:144505839-144505861 AATCACTTGAACCCTGGAGATGG - Intergenic
999342629 5:150785667-150785689 AATCATTTGAACCCAGGAGATGG - Intronic
1000046744 5:157528140-157528162 TTCCATTTGAACCCTGGAGAAGG - Intronic
1000134990 5:158339270-158339292 AACCACTTGAACCCGGGAGATGG - Intergenic
1000936965 5:167313548-167313570 AACCATTTGAACCAGGGAGATGG + Intronic
1002009987 5:176271271-176271293 AATCATTTGAACCCTGGAGGCGG + Intronic
1002216748 5:177641037-177641059 AATCATTTGAACCCTGGAGGCGG - Intergenic
1002950925 6:1810367-1810389 AATCATTTGAACCCAGGAGATGG - Intronic
1002999999 6:2323086-2323108 AATCACTTGAACCCTGGAGATGG - Intergenic
1003056549 6:2825915-2825937 TTATATTTCAACCTTGGAGAAGG - Intergenic
1005394203 6:25364648-25364670 AATCATTTGAACCCGGGAGACGG - Intronic
1005913162 6:30327964-30327986 TTCCAGTAGGTCCCTGGAGAAGG + Intronic
1005956450 6:30666719-30666741 AATCATTTGAACCCGGGAGACGG + Intronic
1007325462 6:41056070-41056092 TACAATTTGAGGCCTGGAGAAGG + Intronic
1008772482 6:54995511-54995533 AATCATTTGAACCCAGGAGATGG + Intergenic
1009325128 6:62339377-62339399 TTCCAGGCCAACCCTGGAGAGGG - Intergenic
1009660895 6:66609823-66609845 TTCCATATGAACTCTAAAGATGG + Intergenic
1011460080 6:87593781-87593803 AATCACTTGAACCCTGGAGATGG - Intronic
1011729261 6:90244006-90244028 AATCATTTGAACCCAGGAGATGG - Intronic
1012848410 6:104418595-104418617 TTCTATTTTAAGCCTGGAGCAGG + Intergenic
1013029197 6:106314468-106314490 AATCATTTGAACCCAGGAGAGGG + Intronic
1013257472 6:108402375-108402397 AATCATTTGAACCCTGGAGGCGG + Intronic
1014332107 6:120081954-120081976 AATCATTTGAACCCAGGAGATGG - Intergenic
1014683423 6:124464067-124464089 AATCATTTGAACCCGGGAGATGG - Intronic
1015251099 6:131128733-131128755 ACTCATTTGAACCCAGGAGATGG + Intergenic
1015567014 6:134583976-134583998 TTTGATTGGAATCCTGGAGATGG + Intergenic
1016005324 6:139083407-139083429 AACCATTTGAACCCGGGAGGCGG + Intergenic
1016369373 6:143356630-143356652 TTCCCCTTGGTCCCTGGAGAAGG + Intergenic
1016700660 6:147050357-147050379 AATCATTTGAACCCTGGAGGCGG - Intergenic
1016999527 6:149986470-149986492 AATCATTTGAACCCGGGAGACGG + Intergenic
1017202066 6:151765610-151765632 TTCCATGTCGACCCTGTAGATGG + Intronic
1017496059 6:154984579-154984601 ATCCGCTTGAACCCTGGAGGTGG - Intronic
1017928350 6:158930165-158930187 AATCACTTGAACCCTGGAGATGG - Intergenic
1018200718 6:161392295-161392317 AACCGTTTGAACCCTGGAGGCGG + Intronic
1018309203 6:162491181-162491203 ATTCATTTGAACCCAGGAGATGG + Intronic
1018598764 6:165515608-165515630 AATCGTTTGAACCCTGGAGACGG - Intronic
1019554541 7:1622287-1622309 AATCATTTGAACCCAGGAGACGG + Intergenic
1019679132 7:2335107-2335129 AACCATTTGAACCCTGAAGGCGG + Intronic
1020018357 7:4845329-4845351 TACCACTTGAACCCAGGAGATGG + Intronic
1020038222 7:4979074-4979096 AATCACTTGAACCCTGGAGACGG - Intergenic
1020427921 7:8091010-8091032 AATCATTTGAACCCGGGAGATGG - Intronic
1021096123 7:16538251-16538273 TTCCATACCAAACCTGGAGAAGG - Intronic
1021171261 7:17400502-17400524 TTCCATTTGAACCCTGGCATAGG + Intergenic
1021636509 7:22699423-22699445 AACCATTTGAACCCAGGAGGCGG - Intergenic
1023720801 7:43091986-43092008 AATCATTTGAACCCGGGAGACGG - Intergenic
1024970557 7:55065925-55065947 TTCCTTTAGAACCCTGGAGAAGG + Intronic
1027248522 7:76383769-76383791 GATCATTTGAACCCTGGAGTTGG - Intergenic
1027522477 7:79227086-79227108 TTGCATTTGAACCCTGAAATTGG - Intronic
1028762142 7:94509008-94509030 AACCATTTGAACCCAGGAGGGGG + Intergenic
1028926536 7:96362812-96362834 ATTCACTTGAACCCTGGAGGCGG - Intergenic
1029022270 7:97377543-97377565 AATCATTTGAACCCGGGAGATGG - Intergenic
1029717041 7:102334908-102334930 AATCATTTGAACCCTGGAGGCGG - Intergenic
1029838110 7:103334487-103334509 AACCACTTGAACCCTGGAGATGG + Intronic
1030016327 7:105226374-105226396 ATTCACTTGAACCCTGGAGGTGG - Intronic
1030218620 7:107073973-107073995 ATTCACTTGAACCCTGGAGGTGG + Intronic
1031615485 7:123874488-123874510 AATCATTTGAACCCAGGAGACGG - Intronic
1031781491 7:125972935-125972957 TTCTATTTCAACCCTCCAGAGGG + Intergenic
1031946916 7:127852071-127852093 AATCACTTGAACCCTGGAGATGG + Intronic
1032053922 7:128669631-128669653 AACCATTTGAACCCGGGAGGCGG - Intergenic
1033485988 7:141789724-141789746 AACCACTTGAACCCAGGAGATGG - Intergenic
1033596858 7:142865032-142865054 TTCCATAGTAACCCTGGAGCTGG - Intronic
1033762129 7:144447011-144447033 AATCATTTGAACCCAGGAGATGG + Intergenic
1034100973 7:148450160-148450182 TACCACTTGAACCCGAGAGAAGG - Intergenic
1034481953 7:151328680-151328702 TTCCTTTTGAAACCTGATGAAGG - Intergenic
1034542867 7:151770078-151770100 TTCCATTTAACCCTTGGGGAAGG - Intronic
1034913952 7:155021559-155021581 TATCATTTGAACCCAGGAGGCGG + Intergenic
1035171077 7:157017845-157017867 TTCCATTGAAAGGCTGGAGAAGG + Intergenic
1035522749 8:288269-288291 TTCCTCTTGAACCCTAGAGTTGG + Intergenic
1035857706 8:2994057-2994079 ATTCACTTGAACCCTGGAGGCGG + Intronic
1036526858 8:9542950-9542972 AACCATTTGAACCCAGGAGGTGG - Intergenic
1036934259 8:12985945-12985967 ATCCATTTGAACCTGGGAGGCGG - Intronic
1037133743 8:15438179-15438201 ATTCAGTTGAACCCAGGAGACGG - Intronic
1038332966 8:26624054-26624076 TCCCACTTGAACCCTGAATAAGG - Intronic
1038648028 8:29377394-29377416 AATCACTTGAACCCTGGAGATGG + Intergenic
1039775758 8:40734661-40734683 ATTCATTTTAAACCTGGAGATGG - Intronic
1041200205 8:55446426-55446448 AATCACTTGAACCCTGGAGATGG - Intronic
1043857930 8:85283009-85283031 AATCATTTGAACCCGGGAGATGG - Exonic
1044586434 8:93873134-93873156 AACCACTTGAACCCAGGAGACGG + Intronic
1044982082 8:97726989-97727011 AATCATTTGAACCCAGGAGACGG + Exonic
1045275104 8:100697044-100697066 AATCATTTGAACCCAGGAGACGG + Intronic
1045564011 8:103295339-103295361 AACCATTTGAACCCAGGAGGCGG + Intergenic
1046648102 8:116807261-116807283 AATCATTTGAACCCGGGAGACGG + Intronic
1047441572 8:124883547-124883569 ATTCACTTGAACCCAGGAGACGG - Intergenic
1049167946 8:141138470-141138492 AACCACTTGAACCCAGGAGAAGG - Intronic
1049723478 8:144133141-144133163 ATCCACTTGAACCCAGGAGGCGG + Intergenic
1056010853 9:82328520-82328542 AACCATTTGAACCCAGGAGGCGG - Intergenic
1057062496 9:92018107-92018129 AATCACTTGAACCCTGGAGATGG + Intergenic
1057479602 9:95434240-95434262 TGGCATTTAAACGCTGGAGAAGG - Intergenic
1057809617 9:98247640-98247662 AATCATTTGAACCCAGGAGACGG + Intronic
1058196055 9:101977787-101977809 TTTCATTTGAATCCAGTAGATGG + Intergenic
1059101503 9:111476666-111476688 TCCCACTTGAACCCGGGAGGCGG - Intronic
1059116791 9:111607135-111607157 AATCATTTGAACCCAGGAGATGG - Intergenic
1059185837 9:112270029-112270051 AATCATTTGAACCCAGGAGACGG - Intronic
1059261093 9:112977444-112977466 AATCATTTGAACCCAGGAGAGGG + Intergenic
1059333620 9:113553754-113553776 AATCACTTGAACCCTGGAGACGG + Intronic
1060076425 9:120594538-120594560 AATCATTTGAACCCAGGAGATGG - Intergenic
1060145786 9:121251266-121251288 AACCACTTGAACCCGGGAGACGG - Intronic
1061701689 9:132421092-132421114 ATTCACTTGAACCCAGGAGATGG - Intronic
1062719487 9:138029695-138029717 ATCACTTTGAACCCGGGAGATGG - Intronic
1203571180 Un_KI270744v1:132994-133016 AACCATTTGAACCCGGGAGGTGG + Intergenic
1186513644 X:10149785-10149807 AATCACTTGAACCCTGGAGATGG + Intergenic
1186790836 X:12996962-12996984 TTCCATTAGAAGTCTGGAAATGG + Intergenic
1187733927 X:22285007-22285029 TTCCATTTGGAGCCTGGTGAGGG - Intergenic
1189806460 X:44740113-44740135 AATCATTTGAACCCGGGAGACGG + Intergenic
1190178834 X:48174310-48174332 ATTCACTTGAACCCAGGAGATGG - Intergenic
1190757566 X:53413988-53414010 AATCACTTGAACCCTGGAGACGG + Intronic
1190897404 X:54634386-54634408 AATCATTTGAACCCGGGAGATGG - Intergenic
1192343928 X:70285810-70285832 GATCATTTGAACCCTGGAGGTGG - Intergenic
1192550903 X:72052748-72052770 TTTCATTTGCAACCTGGAGGGGG - Intergenic
1193940846 X:87679572-87679594 AATCATTTGAACCCTAGAGATGG - Intergenic
1195716324 X:107821975-107821997 AATCATTTGAACCCGGGAGACGG - Intergenic
1196195225 X:112832401-112832423 TTCCATTTTAGAACTGGAGAGGG + Intronic
1196680766 X:118467217-118467239 AATCATTTGAACCCGGGAGACGG + Intergenic
1196702590 X:118687718-118687740 AATCATTTGAACCCGGGAGATGG - Intergenic
1196704122 X:118701859-118701881 ATTCACTTGAACCCTGGAGGCGG + Intergenic
1196768523 X:119271244-119271266 AATCATTTGAACCCAGGAGATGG + Intergenic
1196818499 X:119684575-119684597 AATCACTTGAACCCTGGAGACGG - Intronic
1197810366 X:130436433-130436455 AATCATTTGAACCCTGGAGGCGG - Intergenic
1198008585 X:132525794-132525816 CTCCTCTTGAATCCTGGAGAAGG - Intergenic
1198190894 X:134304458-134304480 AATCATTTGAACCCAGGAGATGG + Intergenic
1198464785 X:136895197-136895219 AATCATTTGAACCCGGGAGATGG - Intergenic
1199460638 X:148080841-148080863 TGCCCTTTGAACCCTGGGCATGG + Intergenic
1200406230 Y:2814161-2814183 GACCACATGAACCCTGGAGATGG + Intergenic
1200861822 Y:8000556-8000578 TTCCATTTTACTCCTCGAGATGG - Intergenic
1201276741 Y:12305687-12305709 TTACATGTGAACCCAGGAGGTGG + Intergenic
1201414215 Y:13731613-13731635 AACCACTTGAACCCTGGAGGCGG - Intergenic
1201579435 Y:15495340-15495362 TTCCCTTAGAACCCTGAACATGG - Intergenic
1201695760 Y:16823951-16823973 TGGCACTTGAACCCTGGAGGTGG - Intergenic