ID: 1000046772

View in Genome Browser
Species Human (GRCh38)
Location 5:157528320-157528342
Sequence CTCCCTTTCAGCACTGCTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 282
Summary {0: 1, 1: 0, 2: 4, 3: 24, 4: 253}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000046763_1000046772 30 Left 1000046763 5:157528267-157528289 CCAGACGGAAGCATGCAAAACAG 0: 1
1: 0
2: 0
3: 9
4: 92
Right 1000046772 5:157528320-157528342 CTCCCTTTCAGCACTGCTGCTGG 0: 1
1: 0
2: 4
3: 24
4: 253

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000046772 Original CRISPR CTCCCTTTCAGCACTGCTGC TGG Intronic
900110510 1:1003568-1003590 CTCCCTCCCAGCACGGCAGCTGG - Intergenic
900914842 1:5629596-5629618 CTCCCACTCAGTCCTGCTGCAGG + Intergenic
901745879 1:11373177-11373199 CTCCCTGGCAGGGCTGCTGCAGG + Intergenic
902140631 1:14350733-14350755 CGCATTCTCAGCACTGCTGCTGG - Intergenic
902399646 1:16150952-16150974 CTCCCTTTCAGTGGTACTGCTGG - Exonic
902790006 1:18761428-18761450 GTTCATTTCAGCACTGCTGGTGG - Intergenic
902988527 1:20170602-20170624 CTCGCTCTCAGCCCTGCTCCTGG + Intronic
903773456 1:25778391-25778413 CTCCCTTCGCTCACTGCTGCCGG - Intronic
904770558 1:32878860-32878882 CTCCCTTGCAGAGCTGCTGTGGG - Intergenic
904850392 1:33454904-33454926 CTCCCTGGCAGCATGGCTGCAGG + Intergenic
904991615 1:34597949-34597971 AACCCTTTGAGCTCTGCTGCTGG - Intergenic
906143925 1:43549063-43549085 AGCCCTTTCAGCACAGCTCCCGG - Intronic
906158860 1:43632200-43632222 CTCACTTTCAGCAGGGCTGGAGG - Intergenic
907468081 1:54652841-54652863 CTCTCTCTCAAGACTGCTGCTGG + Exonic
909756515 1:79232168-79232190 CTCCCTTCCAGCTAGGCTGCAGG - Intergenic
911064785 1:93778550-93778572 CTCCCTTTCACTGCTGCTGCTGG - Intronic
912487489 1:110040646-110040668 CTTCCTCACAGCACTGCTGCAGG - Exonic
913197795 1:116472376-116472398 CCCACTTGCAGCACTGCTGAAGG + Intergenic
915290881 1:154882437-154882459 CTCCCCCTCAACACTGGTGCTGG + Intergenic
919638315 1:200025383-200025405 CTGCCTTTCAGCTGTGCTGCTGG - Intergenic
922160886 1:223078495-223078517 GTCCCTTGCAGCTCTGCTGAAGG - Intergenic
922608544 1:226907120-226907142 TTCCTGTTCAGCTCTGCTGCTGG + Intronic
922942962 1:229484053-229484075 CTGCCTTTCTGCAATACTGCAGG - Exonic
923137960 1:231134810-231134832 CTCCCTTGCAGCACAGTTGTGGG + Intergenic
923935771 1:238758649-238758671 CTCACTTGCACCACAGCTGCAGG + Intergenic
1062817114 10:508879-508901 CCGCCTTCCAGCACTGCTGTTGG - Intronic
1065867521 10:29926793-29926815 CTGGCTTTCAGCAGTGCGGCAGG - Intergenic
1066052391 10:31647692-31647714 ATCCCTTGCAGCACAGCTGGAGG + Intergenic
1067269055 10:44773832-44773854 CTCCCCTCCTGCCCTGCTGCAGG + Intergenic
1067299244 10:44994068-44994090 CTGCCTTCCAGAGCTGCTGCTGG - Exonic
1069724067 10:70566245-70566267 CTCCCTTTAGGCCCTGCTCCTGG + Intronic
1074931499 10:118131289-118131311 CTCCCTCTCAGAGGTGCTGCAGG + Intergenic
1075861935 10:125684429-125684451 CTCCCTTGCACTGCTGCTGCTGG - Intergenic
1076499589 10:130926919-130926941 CTCACCTCCAGCACTGGTGCAGG - Intergenic
1076981149 11:205522-205544 GTCTCCTTCAGCACTGGTGCGGG - Intronic
1077552513 11:3207265-3207287 CTACCTCTCAGCACAGCAGCTGG + Intergenic
1077554562 11:3219647-3219669 CTGCCTTTCAGCGCAGCTTCCGG - Intergenic
1078779523 11:14423727-14423749 CTCTCTTTCAGCCTTGCTCCCGG - Intergenic
1078984544 11:16580089-16580111 CTGCTTTTCATCAGTGCTGCTGG - Intronic
1080703068 11:34661690-34661712 CTCCCTTTCAACACTGTGGTGGG - Intergenic
1081659256 11:44877889-44877911 CTCCCTCTCCCCACTGCTCCTGG + Intronic
1082242144 11:49885205-49885227 CTCACTTTCACCAATGCTGGAGG + Intergenic
1084473251 11:69375221-69375243 CTCCCTCTCAGCACAGTTGGAGG - Intergenic
1085322122 11:75581715-75581737 CTCGCTTTCCACACTCCTGCTGG + Intergenic
1085665934 11:78416513-78416535 CTCCCTTGATGCACTGCAGCTGG + Intronic
1085755816 11:79200436-79200458 GTCCCTTCCAGCACTGATGAAGG - Intronic
1085860594 11:80229643-80229665 TTCCCTCTCAGCACTGCTTTAGG - Intergenic
1088684772 11:112275372-112275394 CTCCCCTTCAGAACTGCAGTAGG - Intergenic
1088687738 11:112298790-112298812 CTTCCTTCCAGCACTGCTTCTGG + Intergenic
1090499713 11:127249517-127249539 CTGCCTTTCAGCAATGCTGCTGG + Intergenic
1090643399 11:128748047-128748069 CTCCCGTTCAGTGCTGCTCCAGG - Intronic
1092730458 12:11527970-11527992 GTCCCTTTCAGCACTGCTTCCGG + Intergenic
1094284816 12:28781281-28781303 GTGCCTTCAAGCACTGCTGCAGG + Intergenic
1095248720 12:39953871-39953893 CTCTTTTTCATCCCTGCTGCTGG - Intronic
1096694721 12:53341199-53341221 CTGCCTTGCAGCCCTGGTGCTGG - Intronic
1097142190 12:56911299-56911321 CTCCCTTTCCCCATTCCTGCTGG + Intergenic
1099367685 12:81789614-81789636 CTCCTTGTCAGGACTGCTGGGGG + Intergenic
1099830490 12:87836304-87836326 ATCCCATTAAGCAATGCTGCTGG - Intergenic
1100595763 12:96070716-96070738 CCCCCTCCCAGCCCTGCTGCAGG - Intergenic
1101257807 12:102997139-102997161 CTCCCTTTCATCTCTCCTTCTGG + Intergenic
1101807878 12:108080751-108080773 CTCCCTTACAGAATTGCTGTGGG + Intergenic
1102261321 12:111445161-111445183 CTCCCTTTCAGTTCCGCTCCAGG - Intronic
1102385447 12:112505266-112505288 ATCCCTTCCAGCTCTGCTGCTGG + Intronic
1103688224 12:122749888-122749910 CTCCCTTTGAGCAGGGCTTCTGG + Intergenic
1105408305 13:20149883-20149905 CTCCCTCTCAGCATTGTTGAGGG - Intronic
1106268141 13:28128214-28128236 CTCCCTCACAGCACTGTGGCTGG - Intergenic
1107729851 13:43337998-43338020 CAACCCTTCTGCACTGCTGCTGG + Intronic
1108308839 13:49165870-49165892 CTGCCTTTAATCACTGCAGCAGG - Intronic
1109724437 13:66320910-66320932 CTCCCTTTAAGCAAGGCTACTGG + Intronic
1110715652 13:78700949-78700971 TTCCCTTTCTGCCCTGCTTCAGG - Intergenic
1111318535 13:86593194-86593216 CTCTCTTTTAGCATTACTGCTGG + Intergenic
1111921216 13:94413134-94413156 CTCCTTTTCAGCAATTTTGCTGG + Intergenic
1114544937 14:23492727-23492749 CTACCTATCAGCACTGGTGGGGG + Intronic
1115785418 14:36820217-36820239 CTCCCATTCAGCTCTGCTTTTGG + Intronic
1117772902 14:59152359-59152381 CTTCCTCCCAGCATTGCTGCAGG + Intergenic
1117789958 14:59330024-59330046 CTCCCTTCCAGCCCTTCGGCTGG + Intronic
1119330818 14:73792280-73792302 CTCCCTTTCTGGCCTGCTGGGGG + Intergenic
1119779003 14:77265866-77265888 CCCTCATTCAGCACTTCTGCTGG - Exonic
1121953458 14:98193008-98193030 CTTCCTTTCAGAAGTGCAGCAGG - Intergenic
1122367572 14:101203195-101203217 CTCCCCATCAGCACTGCAGTTGG + Intergenic
1122869823 14:104633232-104633254 CACCCGTACAGCACTGCTCCAGG + Intergenic
1123043828 14:105501836-105501858 TTCCCTTTCTGCACTACTTCAGG + Intergenic
1125931023 15:43600255-43600277 GGCTCTTTCAGCACTGCTGCGGG - Exonic
1125944187 15:43700071-43700093 GGCTCTTTCAGCACTGCTGCGGG - Intergenic
1127684347 15:61327369-61327391 CTCCCTGTCAACTCTGCTGCTGG - Intergenic
1129550122 15:76439600-76439622 CTTACTTTCAGCACAGCTGCTGG + Intronic
1131049324 15:89335755-89335777 CTCCCTTTCATCTGTGCAGCTGG - Intergenic
1132399534 15:101496900-101496922 CTGCCTCACAGCACTGCCGCAGG + Intronic
1132538646 16:496706-496728 CGGCCTTTCAGCAATGCTCCCGG - Intronic
1133494739 16:6306329-6306351 TTCCCTTCAAGCCCTGCTGCTGG + Intronic
1134197850 16:12172584-12172606 CTTCCTTTCAGCAATGTTGAAGG + Intronic
1136158155 16:28399495-28399517 CTCCCTTCCAGAATAGCTGCAGG - Intronic
1136204932 16:28715788-28715810 CTCCCTTCCAGAATAGCTGCAGG + Intronic
1136510803 16:30737320-30737342 CTCCCTGGCAGGACTGCAGCGGG - Exonic
1137664939 16:50244687-50244709 TTACCTTTCTTCACTGCTGCCGG + Intergenic
1141959932 16:87398747-87398769 CTTCTTCCCAGCACTGCTGCTGG - Intronic
1142174865 16:88640499-88640521 CTCCCGTTCAGCCCTGGTCCAGG + Intergenic
1143162674 17:4881612-4881634 CTGCCTTTGAGCACAGCTCCTGG + Intronic
1143684946 17:8506286-8506308 CTCCCGTGCAGCGCAGCTGCTGG + Intronic
1143995960 17:11006610-11006632 CCCACTTTCTGCACTGCAGCTGG + Intergenic
1144720422 17:17465512-17465534 CTCTCTATCAGCACTGTTGCTGG - Intergenic
1145795819 17:27654830-27654852 CGGCCTTCCAGCACTACTGCCGG + Intergenic
1145983963 17:29031911-29031933 CTCCCTTCCATCAATGCTCCAGG + Intronic
1146054131 17:29572805-29572827 CTCCGCTTCAGCACAGCTGTGGG - Exonic
1147455047 17:40531910-40531932 CTCCACTTCAGCACCTCTGCAGG - Intergenic
1148856729 17:50583055-50583077 CTCCTTTTCAGTTCTGCTGAAGG + Intronic
1149693843 17:58600741-58600763 CTCTCCTTCAGCAGTGCTGGAGG - Intronic
1151173483 17:72268002-72268024 CTACCCTTCAGCACTTCTGCGGG - Intergenic
1151960596 17:77403453-77403475 CTCCATGTCAGCACGGCTGTGGG - Intronic
1152384770 17:79965805-79965827 CTCCCCTTCACCCCTGCTCCTGG + Intronic
1152661591 17:81544806-81544828 AGCCCTTTCAGCCCTGATGCTGG - Intronic
1152854181 17:82654518-82654540 CTCGAGTTCAGCACTGCGGCAGG + Intergenic
1152984522 18:309654-309676 GTCCTTTGCAGCAATGCTGCTGG + Intergenic
1153003412 18:476586-476608 CTCCCTTTCTGCACTGGGGCGGG - Intronic
1153270898 18:3320142-3320164 CACCCTTTCAGCTGTGCTGAAGG - Intergenic
1155246936 18:23919736-23919758 CTCTCTCTCAGCACTGCCTCTGG - Intronic
1158252796 18:55508073-55508095 CTGCCTTTTTCCACTGCTGCTGG - Intronic
1160379543 18:78441895-78441917 TTCCCTTTCAGTACTGCTTTAGG - Intergenic
1160918154 19:1507394-1507416 TTCCCTTGCAGCACTGATGGGGG - Exonic
1160939723 19:1614604-1614626 CTCTCCTGCAGCACTGTTGCTGG - Intronic
1161055655 19:2189560-2189582 CTCGCTTTCCGCCCTGATGCAGG - Intronic
1161398088 19:4055247-4055269 CTCTCCTTCCCCACTGCTGCAGG - Exonic
1161566613 19:5006140-5006162 CTTCCTTCCATCCCTGCTGCAGG + Intronic
1162605027 19:11700064-11700086 TTCCCTTTCAGCAGTCCAGCTGG + Intergenic
1166209233 19:41295171-41295193 TTACCTTACAGCACTGCTGTTGG - Intronic
1167349931 19:48968254-48968276 CTCCCTTTCACCAAAGCTGAAGG + Exonic
925062541 2:904687-904709 CTCCCTGGCAGCACTGGTGTGGG + Intergenic
925318484 2:2942700-2942722 CTCCCTTTCAGCCCTGAGACTGG - Intergenic
926113702 2:10197866-10197888 CAGACTTTCAGCACTGCTGCTGG + Intronic
926688793 2:15718536-15718558 CTCCCTTTCACCCCACCTGCTGG + Intronic
927686870 2:25177339-25177361 CTCTCATGCAGCACTGCAGCTGG + Intergenic
928947498 2:36784784-36784806 CTACCTGTTAGCACTGATGCTGG + Intronic
930743770 2:54860363-54860385 CTCCTTCTCAGAACTGCTCCAGG - Intronic
931224537 2:60318627-60318649 CTCCCTCCCCGCCCTGCTGCAGG + Intergenic
933662970 2:84942701-84942723 GTGACTCTCAGCACTGCTGCAGG + Intergenic
934912427 2:98271904-98271926 CTCCCTTGCAGCAGTGTTGGAGG + Intronic
935097155 2:99956367-99956389 TTCCATTTCAGCTCTGCTTCAGG - Intronic
935365265 2:102282712-102282734 ATCCCTTTCAACAGTGCTTCAGG + Intergenic
935652384 2:105393243-105393265 CTCCCTATCAACCCTGCTGCAGG + Intronic
935755655 2:106274510-106274532 CTCCCTCCCAGCACTGCTGTGGG + Intergenic
935917038 2:107965835-107965857 GTCCCTTTCACCATTGTTGCGGG - Intergenic
936615917 2:114047650-114047672 CTACCTTTTTGCTCTGCTGCTGG + Intergenic
939469119 2:142597340-142597362 ATTTCTTTCAGCACTGCTTCAGG + Intergenic
941508417 2:166376070-166376092 CTCCCTCTCTCCACTCCTGCGGG + Intergenic
942146028 2:173027457-173027479 CTTCTTTACAGCACTGATGCTGG + Intronic
942746593 2:179241256-179241278 CTCCCTTTCTCCTCTGCTTCTGG - Intronic
944464562 2:199987439-199987461 TTCCCATTCAGCACTGCTCAAGG + Intronic
944831324 2:203535768-203535790 CTCCCTGACAGAACTGCTGGAGG - Intergenic
945856597 2:215076091-215076113 CTACCTGTCAGCAGTGCTGCTGG - Intronic
947489246 2:230579550-230579572 CTCCTCTCCAGCAATGCTGCAGG + Intergenic
947577294 2:231285952-231285974 CTCCCTTTCAGCTAGGGTGCAGG - Intronic
948615638 2:239196973-239196995 CCCTCTGTCTGCACTGCTGCTGG + Intronic
1170757061 20:19213479-19213501 CCCCCTTTCAGAACAGGTGCCGG + Intronic
1170996539 20:21365577-21365599 CTAGGTTTCAGTACTGCTGCTGG - Exonic
1171305777 20:24104625-24104647 CTCCCTTTCATGGCAGCTGCAGG - Intergenic
1171949897 20:31412082-31412104 CTTGCTCTCAGCACTGCAGCAGG + Intronic
1172064466 20:32209162-32209184 CTTCCAGTCTGCACTGCTGCAGG + Intronic
1172896136 20:38301465-38301487 CTCCTTGTCAGCACTGCTGCTGG - Intronic
1173875786 20:46370580-46370602 CTCCCTTCCAGCACTGATGTAGG - Intronic
1175872711 20:62216005-62216027 CTCACTTCCAGCAGTGCTCCAGG + Exonic
1175937978 20:62523716-62523738 CTCCGTGTCAGCCCGGCTGCAGG + Intergenic
1178846396 21:36177434-36177456 CTTCCTTTCAGGTCTGCTGTGGG + Intronic
1179327873 21:40367291-40367313 CTGCCTTCCACCTCTGCTGCTGG + Intronic
1179449671 21:41459979-41460001 CTCCCAATCAGTGCTGCTGCTGG + Intergenic
1179493112 21:41754551-41754573 CTGTCTTTCAGGACAGCTGCAGG - Intronic
1179658844 21:42862102-42862124 CACCCTTTCAGGGCTTCTGCAGG + Intronic
1180284836 22:10735079-10735101 CTCCATGTCAACTCTGCTGCTGG + Intergenic
1180619199 22:17148703-17148725 GTGCCTTTCAGAAGTGCTGCTGG - Intronic
1181788714 22:25246350-25246372 CTCCCTGTCTGCAATCCTGCTGG - Intergenic
1181820399 22:25471051-25471073 CTCCCTGTCTGCAATCCTGCTGG - Intergenic
1184066594 22:42125093-42125115 CTCCCTGTCCCCACAGCTGCAGG + Intergenic
1184069062 22:42137245-42137267 CTCCCTGTCCCCACAGCTGCAGG + Intergenic
1184818902 22:46893781-46893803 CTCCTCGGCAGCACTGCTGCTGG + Intronic
1184926454 22:47643390-47643412 CCCCCTTTCACCTCTCCTGCAGG - Intergenic
950184664 3:10937738-10937760 CTACCTTTGAGCACAGCTGGAGG + Intronic
950381069 3:12615698-12615720 CTCCATTTGAGCACAGCTGGTGG - Intronic
950575360 3:13828982-13829004 CTCCATTTCCTCATTGCTGCTGG + Intronic
950680526 3:14582005-14582027 CTCCCTGGTAGCCCTGCTGCTGG - Intergenic
950718242 3:14864704-14864726 TCCCCTCACAGCACTGCTGCAGG - Intronic
950955257 3:17046192-17046214 CTCCTGTTCAGCTCTCCTGCTGG - Intronic
953933592 3:47020497-47020519 TTCCCTTCCAGCACTGCTAGAGG + Intronic
956691438 3:71881309-71881331 GTCCTTTTCTCCACTGCTGCTGG - Intergenic
960464518 3:117980506-117980528 CTCCCTTTCAGAATTGCATCAGG - Intergenic
961979464 3:131061809-131061831 CTCCCTGCCATCACTGGTGCTGG + Intronic
962552497 3:136509445-136509467 GCCACTTTCAGCTCTGCTGCAGG + Intronic
963936083 3:151054978-151055000 ATGCCTTTCAGCACTGGTGCTGG + Intergenic
964514887 3:157497249-157497271 CTCCCCTTCTACACTGCTCCTGG + Intronic
965700120 3:171452099-171452121 CTCCCTTACAGTGTTGCTGCTGG - Intronic
966298600 3:178452987-178453009 CTCCCTTGCAGCTATGGTGCTGG - Intronic
967524584 3:190476131-190476153 TTCTCTTTCAGCACTGCTTTTGG - Intergenic
968137623 3:196230360-196230382 CTCCCTTTGAGCCCTGCAGGGGG + Intronic
969190527 4:5514999-5515021 ATCCCATTCAGAACTGCTGTGGG + Intergenic
969227893 4:5811099-5811121 CTGCCTCTCAGCACTGCAGGAGG - Exonic
970423211 4:15924143-15924165 CTCCATTTCAACCCAGCTGCAGG + Intergenic
972011843 4:34192184-34192206 CTCACTTACATCACTGCTGAGGG - Intergenic
972761978 4:42115317-42115339 CGCCCTTGCAGCAGTGGTGCAGG + Exonic
972774765 4:42230643-42230665 CTCCCTTCCAGCCCTCCTCCTGG + Intergenic
973937633 4:55864276-55864298 ATTCTTTTCAGCAGTGCTGCTGG - Exonic
978061644 4:104346040-104346062 CTCCCTCTCTGCTCTGCTCCTGG + Intergenic
981077590 4:140606684-140606706 CTCCCTTTCAGAATTACTGATGG + Intergenic
981742982 4:148022458-148022480 CTTCCTTCCAGCAATGCTGCAGG - Intronic
981871190 4:149487653-149487675 CTCCCTTTGTGCACAGGTGCAGG + Intergenic
982616575 4:157644652-157644674 CTCCCTTTTAGCACTCATCCAGG - Intergenic
983264684 4:165495654-165495676 GTTCCTTACAGCCCTGCTGCTGG + Exonic
984125915 4:175810408-175810430 CTGCTTTCCACCACTGCTGCTGG + Intronic
987643494 5:20641555-20641577 CTCCCTTGCAGTATTGCTGTGGG + Intergenic
988556328 5:32239186-32239208 CTTCCTCTTTGCACTGCTGCTGG - Intronic
988965672 5:36415079-36415101 GTCCATTTCAGCTCAGCTGCTGG - Intergenic
989394740 5:40942103-40942125 CTGACTTCCAGCAATGCTGCTGG - Intronic
991193038 5:63897781-63897803 GTCCCTTTCATCACTACTGCTGG - Intergenic
997192000 5:131945991-131946013 CTCCCTATCAGCACTGCATAAGG + Intronic
997382072 5:133445303-133445325 CTCCCTCAGATCACTGCTGCGGG + Intronic
997382082 5:133445346-133445368 CTCCCTCAGATCACTGCTGCGGG + Intronic
997382092 5:133445389-133445411 CTCCCTCAGATCACTGCTGCGGG + Intronic
998451666 5:142239348-142239370 CTCCCCTTCAGGACTGTTGTAGG - Intergenic
1000046772 5:157528320-157528342 CTCCCTTTCAGCACTGCTGCTGG + Intronic
1001884887 5:175280489-175280511 CTCCTTTTCTGGCCTGCTGCTGG + Intergenic
1002415910 5:179121022-179121044 CTCTCTCTCAGCCCTGCGGCGGG + Intronic
1003066533 6:2908553-2908575 ATCCCAGTCATCACTGCTGCCGG - Intergenic
1003283564 6:4714544-4714566 CCCCATCACAGCACTGCTGCTGG + Intronic
1005939291 6:30548664-30548686 TGCCCATTCAGCACTGCTCCTGG + Intronic
1006154385 6:32006434-32006456 CACCCGCTCAGCCCTGCTGCTGG + Intergenic
1006160698 6:32039170-32039192 CACCCGCTCAGCCCTGCTGCTGG + Exonic
1006180699 6:32151913-32151935 CTCCATCTCTGCGCTGCTGCCGG - Exonic
1006850745 6:37096438-37096460 CTCCTTTTCAGCTGTGCTGAAGG - Intergenic
1007268074 6:40612214-40612236 CTCTCTGCTAGCACTGCTGCAGG - Intergenic
1011538419 6:88403617-88403639 ATCCCTTTCAGCACTCTTCCTGG + Intergenic
1011784522 6:90829096-90829118 CTCACTCCCAGGACTGCTGCAGG - Intergenic
1012423983 6:99094427-99094449 CTTCCTTCCAGCACACCTGCAGG + Intergenic
1013603331 6:111725621-111725643 AACACTTTCAGCACTGATGCTGG + Intronic
1014315852 6:119863829-119863851 CTCCCCTTTAGCCCTGCAGCAGG + Intergenic
1015482975 6:133734836-133734858 AACCCTTTCTGCACTGCTGGTGG + Intergenic
1017273298 6:152534763-152534785 TTATCTTTCAGCACTGCTGGTGG + Intronic
1019695936 7:2446173-2446195 CTCCCTTCCAGCCCTGCTGCTGG - Intergenic
1019728548 7:2617000-2617022 GCTCCTTTCAGCACTGCTGTCGG + Intergenic
1020526499 7:9266579-9266601 TTCTCATTCAGCACTGCTGCAGG - Intergenic
1022240061 7:28502102-28502124 CTGCCTTTCAGGACAGATGCAGG + Intronic
1022465077 7:30648198-30648220 CTCCCATACAGCGCTGCAGCAGG - Intergenic
1023567250 7:41535778-41535800 GTGCCTTTCAGCTCTGCTTCAGG - Intergenic
1024096200 7:45984797-45984819 CTCCCTTTGGGCACAGCTACAGG + Intergenic
1024970703 7:55067088-55067110 CACCCTGACAGCAGTGCTGCAGG - Intronic
1026535676 7:71236753-71236775 CTCCCTCGCAGCACTTCTGCGGG + Intronic
1026675995 7:72428607-72428629 GTCTCAGTCAGCACTGCTGCTGG + Intronic
1028316201 7:89405874-89405896 CTCCCTCTCAGCCCTTCAGCAGG + Intergenic
1029199189 7:98827299-98827321 CCCCCTTCCAGCCCTGCTCCAGG + Intergenic
1032409704 7:131685989-131686011 CTCCATTTCAGAAATGATGCAGG - Intergenic
1035619376 8:1025969-1025991 CACCGTCTCAGCCCTGCTGCTGG - Intergenic
1036079134 8:5534144-5534166 CTTCCTGTTAGCACCGCTGCCGG + Intergenic
1038666759 8:29543983-29544005 GTCCCTGGCAGCGCTGCTGCAGG + Intergenic
1038818625 8:30931905-30931927 CCCCTTTTCTGCACTGCTCCTGG + Intergenic
1039803711 8:40981438-40981460 CCAGCTTTCAGCTCTGCTGCAGG + Intergenic
1040431128 8:47343607-47343629 TTCACTTTCAACACAGCTGCAGG + Intronic
1040891935 8:52326257-52326279 CTCCCCTTCCCCACTGCTGCAGG - Intronic
1041724399 8:61004704-61004726 CTCCCCCGCAGCCCTGCTGCCGG - Intergenic
1041777924 8:61544555-61544577 CTCCCTTACTGCACTGCACCAGG - Intronic
1044322803 8:90823548-90823570 CTGCATTTCAGCAGTGCTCCAGG + Intronic
1044326008 8:90859125-90859147 CTCTCTTCCCTCACTGCTGCTGG - Intronic
1044609172 8:94075183-94075205 CTCCCACTCAGCACAGTTGCTGG + Intergenic
1044762455 8:95535900-95535922 CTCCCTTTCAGCAGTTTTGGTGG + Intergenic
1047169626 8:122479229-122479251 CTCCCTTCCAGCAGCTCTGCTGG + Intergenic
1048315644 8:133359776-133359798 CTCTCTCACAGCACTGCTGGGGG + Intergenic
1048884494 8:138898777-138898799 CTCCCCTTCTCCACTCCTGCTGG + Intronic
1049013333 8:139902789-139902811 CTCCCTTTCAGGACAGAGGCGGG - Intronic
1049067099 8:140325191-140325213 TTCCCTCTAAGCACTGCTTCAGG - Intronic
1049601364 8:143509345-143509367 CCACCTTCCAGCCCTGCTGCAGG + Intronic
1049717490 8:144099829-144099851 CTCCCTGCCAGCTCTTCTGCAGG + Exonic
1053097204 9:35339019-35339041 CTCCCCTTTAGAACTCCTGCAGG + Intronic
1053135507 9:35648049-35648071 CTCCCTTTCACCTCCCCTGCAGG + Intergenic
1054870687 9:70044836-70044858 ATCCCTTGCAGCACAGCTGAGGG - Intronic
1059024810 9:110615064-110615086 CTCCCTTTCAGTCCTGGTACTGG - Intergenic
1059372358 9:113852695-113852717 ATCACTTTCACCAGTGCTGCTGG + Intergenic
1060858945 9:126938193-126938215 CTCCTTTCCAACACTGCTGATGG - Intronic
1061120283 9:128637772-128637794 CTTGCTTTCAGCCCTGCAGCCGG + Intronic
1186594300 X:10964339-10964361 CACCCTTCCAGCATTCCTGCTGG + Intergenic
1187276908 X:17824276-17824298 CTCCCTTTAATCAGCGCTGCAGG - Intronic
1188941896 X:36249028-36249050 TTCCCTTTAAGCACTGCTTCAGG - Intronic
1193894781 X:87099891-87099913 CTCCCTCCCTGCACTGGTGCTGG - Intergenic
1194320878 X:92444608-92444630 CTCCCTTTGAGAACTGCAACAGG - Intronic
1195146854 X:102026832-102026854 CTACCCATCACCACTGCTGCTGG + Intergenic
1195697760 X:107679300-107679322 CCCCATCTCAGCCCTGCTGCTGG - Intergenic
1200313905 X:155110635-155110657 GTCCCTTTAAGCACTGCTTTGGG + Intronic
1200628993 Y:5557744-5557766 CTCCCTTTGAGAACTGCAACAGG - Intronic