ID: 1000047932

View in Genome Browser
Species Human (GRCh38)
Location 5:157536738-157536760
Sequence CTGGACACTTGCACTCCAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 287
Summary {0: 1, 1: 0, 2: 2, 3: 20, 4: 264}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000047931_1000047932 -9 Left 1000047931 5:157536724-157536746 CCAGTGTTATCTTGCTGGACACT 0: 1
1: 0
2: 1
3: 7
4: 135
Right 1000047932 5:157536738-157536760 CTGGACACTTGCACTCCAGCAGG 0: 1
1: 0
2: 2
3: 20
4: 264

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000047932 Original CRISPR CTGGACACTTGCACTCCAGC AGG Intronic
901436411 1:9249746-9249768 CAGGACAGTTGCAGTCCTGCTGG - Intronic
903323992 1:22559250-22559272 CTTGGCACTGGCACTCCACCGGG - Intergenic
903860432 1:26361255-26361277 TTGGCCACTTGCACCTCAGCCGG - Intergenic
904086226 1:27910814-27910836 CTGCACCACTGCACTCCAGCGGG + Intronic
905078018 1:35291680-35291702 TTGCACCATTGCACTCCAGCCGG - Intronic
905970335 1:42137182-42137204 CTGGACACTTGGAGCACAGCTGG - Intergenic
907264768 1:53250877-53250899 CAGGACACTGGACCTCCAGCAGG + Intronic
907390838 1:54157223-54157245 GGGGACACCTGCACCCCAGCTGG + Intronic
907774868 1:57504066-57504088 CTGGAAACCTGCACTACATCTGG + Intronic
908326560 1:63029110-63029132 CTGCTCACCTGCACCCCAGCTGG - Intergenic
908477192 1:64501002-64501024 TTGCACCATTGCACTCCAGCTGG + Intronic
909360336 1:74751623-74751645 TTGCACCATTGCACTCCAGCCGG + Intronic
910255328 1:85241912-85241934 CTGTACCATTGCACTCCAGCTGG - Intergenic
912020942 1:105109004-105109026 CTGGACACAGGAAGTCCAGCTGG - Intergenic
913125725 1:115786638-115786660 TCGCACAATTGCACTCCAGCCGG + Intergenic
913706064 1:121424086-121424108 CTGGACACTTGGGCTGCTGCAGG + Intergenic
915290418 1:154879391-154879413 TTAGAGACTTGGACTCCAGCAGG - Intergenic
915405500 1:155656995-155657017 CTGGACACTTCCTCTCCAGAAGG - Intergenic
915788107 1:158638191-158638213 CTGAAGATTTGCTCTCCAGCGGG - Exonic
916696741 1:167245284-167245306 CATGCCACTTGCATTCCAGCTGG - Intronic
917543165 1:175935248-175935270 CTGTGCAACTGCACTCCAGCAGG + Intergenic
918516850 1:185372829-185372851 GTGGACACTGCCACTCTAGCAGG - Intergenic
919030163 1:192231973-192231995 CTGCACCACTGCACTCCAGCTGG - Intergenic
919812857 1:201420018-201420040 CTGGACACTGGCATTCCTGGAGG - Intronic
920091785 1:203459122-203459144 CTGCGCCATTGCACTCCAGCTGG - Intergenic
921387551 1:214586251-214586273 CTGGTGACTTGCACTTGAGCTGG + Intergenic
921611776 1:217221210-217221232 CTGCGCCATTGCACTCCAGCTGG - Intergenic
923587131 1:235283778-235283800 TTGCACCATTGCACTCCAGCTGG - Intronic
923639718 1:235742408-235742430 CTGGGCCACTGCACTCCAGCTGG + Intronic
923701188 1:236301797-236301819 CTGGCTACTTCCACGCCAGCAGG - Intergenic
1063218535 10:3945129-3945151 CTGGAATCTTGTACTTCAGCTGG - Intergenic
1064158255 10:12921784-12921806 TTGGGCCATTGCACTCCAGCTGG - Intronic
1064733967 10:18361655-18361677 CATGCCACTTGCACTCCAGCCGG - Intronic
1066045330 10:31589576-31589598 CTGCACTCCAGCACTCCAGCTGG + Intergenic
1067168160 10:43881892-43881914 CTGGACACATGTGCTCCAGTGGG - Intergenic
1067794733 10:49312551-49312573 CTGGACGCTGGCCCTCCAGAAGG + Intronic
1069874658 10:71554240-71554262 CTGCACTGCTGCACTCCAGCTGG - Intronic
1071613411 10:87052441-87052463 TTGCACCATTGCACTCCAGCTGG + Intronic
1072344200 10:94487739-94487761 CTGTACCACTGCACTCCAGCTGG - Intronic
1072930803 10:99659971-99659993 CTGCACACTTTCCCTCCGGCTGG + Intronic
1073826399 10:107328409-107328431 CTGCACCACTGCACTCCAGCTGG - Intergenic
1076221156 10:128734160-128734182 CCTGGCACTTCCACTCCAGCTGG + Intergenic
1077173293 11:1177874-1177896 CTGGACACTGGAAGTCCAGCAGG + Intronic
1078436254 11:11328210-11328232 CTGGACATGGGTACTCCAGCAGG - Intronic
1080418146 11:32088786-32088808 TAGGACACTTGCATTTCAGCAGG + Intronic
1082034894 11:47637000-47637022 TTGCACCATTGCACTCCAGCTGG - Intronic
1083763505 11:64831445-64831467 CTAGACACCAGCACTCCCGCAGG + Intronic
1084920573 11:72466184-72466206 TTGCACCATTGCACTCCAGCCGG + Intergenic
1085094896 11:73752409-73752431 TTGCACCATTGCACTCCAGCCGG + Intronic
1087291623 11:96326718-96326740 TCGCACAATTGCACTCCAGCCGG + Intronic
1088329770 11:108639296-108639318 CTGCATTGTTGCACTCCAGCCGG - Intergenic
1091141413 11:133238279-133238301 TTGGGCACTTGCAATGCAGCTGG + Intronic
1092745873 12:11672078-11672100 CTTGTCACCTGCACTCCAGTGGG + Intronic
1093647150 12:21600162-21600184 TTGCACCATTGCACTCCAGCCGG - Intronic
1094192923 12:27715178-27715200 CTGCACCACTGCACTCCAGCTGG - Intronic
1097638770 12:62153623-62153645 TTGAACCCCTGCACTCCAGCCGG + Intronic
1099498458 12:83381233-83381255 CGTGCCACTTGCACTCCAGCTGG - Intergenic
1099888785 12:88563915-88563937 TTGCACCATTGCACTCCAGCAGG + Intronic
1100356594 12:93836843-93836865 CGAGACACTTACATTCCAGCAGG + Intronic
1100542516 12:95571431-95571453 TTGCACCATTGCACTCCAGCTGG + Intergenic
1100820968 12:98429469-98429491 CTGCACCATTGCACTGCAGCTGG + Intergenic
1101833985 12:108282193-108282215 CTGGATACATCCACTCCATCAGG + Intergenic
1101850666 12:108399565-108399587 CTGGACACGTGGACACCAGCTGG - Intergenic
1102347383 12:112168691-112168713 CTGGACCCTGGAACCCCAGCTGG + Intronic
1103106180 12:118228194-118228216 CCGTACCATTGCACTCCAGCTGG - Intronic
1103697054 12:122824369-122824391 TTGCACCATTGCACTCCAGCCGG + Intronic
1103832005 12:123787719-123787741 CGGGACACTGGCTCCCCAGCCGG + Intronic
1105448190 13:20475279-20475301 CAGGTCGCTTGGACTCCAGCTGG - Intronic
1107475618 13:40733046-40733068 TTGCACCATTGCACTCCAGCTGG - Intronic
1110368834 13:74718421-74718443 CGGGGCACTTGCAGGCCAGCTGG + Intergenic
1115466767 14:33723576-33723598 CTGGACAGTTGCACTGGAGAGGG - Intronic
1115543378 14:34443266-34443288 CTGTGCCATTGCACTCCAGCTGG - Intronic
1115543395 14:34443423-34443445 CTGTGCCATTGCACTCCAGCTGG - Intronic
1115543412 14:34443578-34443600 CTGTGCCATTGCACTCCAGCTGG - Intronic
1115939116 14:38589252-38589274 CTGGACTCTGGAACCCCAGCAGG - Intergenic
1118552626 14:66972221-66972243 TTGCACCATTGCACTCCAGCCGG + Intronic
1120621710 14:86773537-86773559 TTGCACCATTGCACTCCAGCTGG - Intergenic
1120722288 14:87902182-87902204 ATGGACACTTGGAGACCAGCTGG - Intronic
1121609631 14:95268675-95268697 CTGGACACAATCCCTCCAGCTGG - Intronic
1122566777 14:102664148-102664170 CTGCACCACTGCACTCCAGCGGG - Intronic
1124015425 15:25869884-25869906 CTGGAGAGTTGCAACCCAGCTGG - Intergenic
1126059823 15:44769754-44769776 CTGTACACTGGGACTCTAGCAGG - Intergenic
1127118262 15:55748221-55748243 TTGCACCATTGCACTCCAGCTGG + Intergenic
1127234892 15:57038382-57038404 CATACCACTTGCACTCCAGCTGG + Intronic
1127563598 15:60164928-60164950 CTGCACACTTACACTCCATGTGG + Intergenic
1127590324 15:60415877-60415899 TTGCACCATTGCACTCCAGCTGG + Intergenic
1127796466 15:62442447-62442469 CTACGCAGTTGCACTCCAGCTGG + Intronic
1127980584 15:64032144-64032166 CTGGAAACCTTCAGTCCAGCAGG + Intronic
1128583138 15:68822425-68822447 CTTTACACTTGCAATCCATCAGG - Intronic
1129340146 15:74880544-74880566 TTGCACCATTGCACTCCAGCTGG - Intergenic
1129987399 15:79930291-79930313 CTGCACCACTGCACTCCAGCCGG - Intergenic
1133792412 16:9019229-9019251 CTGCACCACTGCACTCCAGCGGG + Intergenic
1134685338 16:16154647-16154669 CAGCACACTTGTACTGCAGCTGG + Exonic
1136521354 16:30798217-30798239 CTGCACCACTGCACTCCAGCCGG + Intergenic
1137372952 16:47925756-47925778 CTGGACAATTGCAATTCAGCCGG - Intergenic
1137376418 16:47955824-47955846 CTGGGCACCTGCTCTCCCGCTGG - Intergenic
1138630659 16:58291971-58291993 TTGCACCATTGCACTCCAGCCGG - Intronic
1138971561 16:62150509-62150531 TTGCACCATTGCACTCCAGCTGG - Intergenic
1139910917 16:70397083-70397105 TTGCACCATTGCACTCCAGCTGG - Intronic
1139914707 16:70420933-70420955 CTGGACACTTCCTTTCCAACAGG + Intronic
1141205098 16:81927432-81927454 TTGGTCACTTTCACTCCAGCGGG - Intronic
1142128188 16:88420488-88420510 TTGGACAGTGGCACTCCAGTTGG + Intergenic
1142609166 17:1098828-1098850 TTGCACCATTGCACTCCAGCCGG - Intronic
1142796874 17:2314706-2314728 CTGCACCAGTGCACTCCAGCCGG + Intronic
1143225289 17:5296789-5296811 CTGTACCACTGCACTCCAGCTGG - Intronic
1143362208 17:6381485-6381507 CTGGACATTTGAAATCCAGCAGG + Intergenic
1143366580 17:6412700-6412722 CAGGACACCTGTACTCCAGCTGG + Intronic
1143630934 17:8140043-8140065 TTGCACCATTGCACTCCAGCTGG + Intergenic
1147858618 17:43502467-43502489 CTGCACCACTGCACTCCAGCTGG - Intronic
1148003305 17:44403736-44403758 TTGTACCATTGCACTCCAGCCGG - Intronic
1148756198 17:49974173-49974195 CTGGACACCTTCACTCCAGCTGG + Exonic
1149452838 17:56763469-56763491 CTGGACACTTGCACCTTAACAGG + Intergenic
1151160031 17:72157535-72157557 TTGCACCATTGCACTCCAGCCGG + Intergenic
1151698141 17:75728492-75728514 CTGGACCCTTGCCCACCTGCGGG - Intronic
1152261964 17:79272144-79272166 CTGGACTGTTTCTCTCCAGCAGG - Intronic
1152412357 17:80133968-80133990 CTGGACCCTTGCTAGCCAGCTGG - Intergenic
1152931756 17:83113594-83113616 CTGGACACCGGCCCTCCGGCAGG - Intergenic
1154234347 18:12590130-12590152 CTACACCATTGCACTCCAGCTGG - Intronic
1156521017 18:37722362-37722384 CTGGAAAAATGCAATCCAGCTGG - Intergenic
1156864827 18:41877057-41877079 CTGCGCTATTGCACTCCAGCGGG - Intergenic
1157337871 18:46754846-46754868 CTTGGCACTTGCTCTTCAGCAGG - Intronic
1157403557 18:47405608-47405630 CTGGGCACCTGCAGTTCAGCAGG - Intergenic
1159353603 18:67306380-67306402 CCGCACCATTGCACTCCAGCTGG + Intergenic
1160302263 18:77693305-77693327 CAGGCCACCTTCACTCCAGCAGG - Intergenic
1160966994 19:1751018-1751040 ATGGACACTTGGACTCCCCCAGG - Intergenic
1160990505 19:1858461-1858483 CTGCACCCCTGCACTCCAGTGGG + Intronic
1161886391 19:6999567-6999589 ATGGCCTCTTACACTCCAGCAGG - Intergenic
1161888308 19:7013998-7014020 GTGGCCTCTTACACTCCAGCAGG + Intergenic
1163682529 19:18691474-18691496 TTGTACCATTGCACTCCAGCTGG + Intronic
1165391329 19:35540637-35540659 CCAGCCACCTGCACTCCAGCAGG + Intronic
1166361860 19:42255779-42255801 CTGGTCACTTCCTCCCCAGCTGG - Intergenic
1167088371 19:47326211-47326233 CTGTGCCATTGCACTCCAGCTGG - Intergenic
1167308713 19:48723850-48723872 TTGCACCATTGCACTCCAGCCGG - Intronic
1167607502 19:50489280-50489302 CTGCACTACTGCACTCCAGCGGG + Exonic
926099123 2:10102759-10102781 TTGTACCATTGCACTCCAGCTGG + Intergenic
928332518 2:30368570-30368592 CTGGACAGCTGCCCTCCTGCTGG + Intergenic
928515416 2:32039996-32040018 CTGGTCACTTGGTCTGCAGCTGG - Intergenic
928906099 2:36369333-36369355 CAGGACACTTGAGATCCAGCAGG - Intronic
932068001 2:68587680-68587702 CTCGACACTGTCACTCCAACAGG - Intronic
933832112 2:86219493-86219515 CTGCACTGCTGCACTCCAGCCGG - Intronic
934098893 2:88632953-88632975 TTGCACCATTGCACTCCAGCCGG - Intergenic
935221046 2:101013104-101013126 CTGGACACTTGCCCACCCCCTGG - Intronic
935262635 2:101368520-101368542 CTGGGGAGCTGCACTCCAGCAGG + Intronic
939057849 2:137384750-137384772 CTGGAGACTTTCTCTCCAGAGGG - Intronic
939825152 2:147006269-147006291 GTGGACACTTACAATGCAGCTGG - Intergenic
939910324 2:147974588-147974610 CTGCACCACTGCACTCCAGCTGG + Intronic
942708474 2:178804130-178804152 CTGGACACCTGAACTTCAGTTGG - Intronic
943190610 2:184673544-184673566 CTGAAAAATTGCACTGCAGCAGG + Intronic
943980064 2:194538824-194538846 TTGTACCATTGCACTCCAGCTGG - Intergenic
946449048 2:219764074-219764096 CTGGAAACTGGAAGTCCAGCAGG - Intergenic
948802411 2:240438867-240438889 CTGGACGGTGGCACTGCAGCAGG + Intronic
1168761195 20:350601-350623 TTGCACCATTGCACTCCAGCTGG + Intronic
1169033585 20:2432091-2432113 CTGCACCACTGCACTCCAGCTGG - Intronic
1169281463 20:4270827-4270849 CTGGACACTTGCAATTGAGAAGG - Intergenic
1169489647 20:6060275-6060297 TTGCACCGTTGCACTCCAGCTGG + Intergenic
1171380779 20:24732444-24732466 CTGGAAGCTTGCATTCTAGCGGG - Intergenic
1172537302 20:35684066-35684088 CTGTGCCATTGCACTCCAGCTGG + Intronic
1173152153 20:40576725-40576747 TTGCACCATTGCACTCCAGCCGG + Intergenic
1174230468 20:49041823-49041845 TTGCACCATTGCACTCCAGCTGG - Intergenic
1175087757 20:56474434-56474456 TTGCACCATTGCACTCCAGCCGG + Intronic
1175650666 20:60719147-60719169 CAGGCCACGGGCACTCCAGCAGG + Intergenic
1177888724 21:26778886-26778908 CTGCACCACTGCACTCCAGCTGG - Intergenic
1177888854 21:26780842-26780864 TTGCACCATTGCACTCCAGCTGG - Intergenic
1179095798 21:38313634-38313656 CTGGACACTTGCCCTTTATCTGG - Intergenic
1179491222 21:41742741-41742763 CTGAACACTGGCACTCCAAGTGG + Intronic
1180090954 21:45533635-45533657 CTGGACTCTGGGCCTCCAGCAGG + Intronic
1180706324 22:17812290-17812312 ATGACCACATGCACTCCAGCCGG + Intronic
1181468108 22:23121279-23121301 CTGGAACCCTGCACTCCACCTGG - Intronic
1183653279 22:39171223-39171245 CTAGACATTTGCACACCTGCAGG + Intergenic
1183911782 22:41085059-41085081 CTGCACCACTGCACTCCAGCTGG + Intergenic
1184213629 22:43051884-43051906 CTGGTCACTCTCTCTCCAGCCGG - Exonic
1184566746 22:45296634-45296656 CAGTACACTCCCACTCCAGCAGG + Intergenic
949176829 3:1073635-1073657 CTTTTCACTTGCACTCCAGATGG + Intergenic
949387734 3:3522617-3522639 CTGTACCACTGCACTCCAGCCGG - Intergenic
950495148 3:13329243-13329265 CTGGACATTTGCAGCCCAGGGGG - Intronic
953631044 3:44617933-44617955 CTTGTCACTTGCCCTCCAGTTGG - Intronic
954285145 3:49613802-49613824 CTTTACACTTGAACTACAGCTGG - Intronic
955185305 3:56709431-56709453 TTGGGCCATTGCACTCCAGCTGG + Intergenic
955717915 3:61850205-61850227 TTGCACCATTGCACTCCAGCAGG - Intronic
956817793 3:72924236-72924258 CTGCACCACTGCACTCCAGCAGG - Intronic
959700048 3:109290176-109290198 TTGTACCATTGCACTCCAGCGGG + Intergenic
960882280 3:122357014-122357036 CTGGACACTGGCACATTAGCAGG + Intergenic
961253127 3:125523179-125523201 CTGTGCCATTGCACTCCAGCTGG + Intergenic
961794725 3:129401430-129401452 CTGGACACTTTGAGTCCAGAGGG + Exonic
962367574 3:134796307-134796329 CTGGAAACCTGCAGTCCCGCAGG - Intronic
964489267 3:157217596-157217618 CTTGCCACCTGCACTCCAGGTGG + Intergenic
965797662 3:172458000-172458022 CTGGGCACTTATATTCCAGCAGG + Intergenic
966933438 3:184690584-184690606 CTGGAGGCTGGCACACCAGCCGG - Intergenic
967784403 3:193474489-193474511 CTGCACCATTGCACTCCAGTTGG + Intronic
968113872 3:196073900-196073922 CTAGATACTTGCACAGCAGCTGG + Intronic
968358097 3:198123689-198123711 CTGGACACCTGTACCCCAGGAGG + Intergenic
969600670 4:8174151-8174173 CAGGTCTCTTGCACTCCAGAGGG - Intergenic
973341115 4:49005602-49005624 CTGCACCACTGCACTCCAGCTGG - Intronic
973623978 4:52752692-52752714 CTGCGCTATTGCACTCCAGCGGG + Intergenic
973910364 4:55573704-55573726 CTGGGCCACTGCACTCCAGCTGG + Intronic
976826388 4:89264888-89264910 CTTGAAGCTTGCATTCCAGCAGG - Intronic
977369105 4:96112377-96112399 TTGCACAACTGCACTCCAGCTGG - Intergenic
977837520 4:101662781-101662803 TTGCACCATTGCACTCCAGCTGG - Intronic
978932145 4:114327728-114327750 CTGGACACTGTGAGTCCAGCAGG - Intergenic
980758565 4:137198322-137198344 CTGGACACTAGGGATCCAGCAGG + Intergenic
985440358 4:189979395-189979417 CTGGACCCCTGCACCCCAGGAGG - Intergenic
986946569 5:13029046-13029068 TTGCACGATTGCACTCCAGCAGG + Intergenic
987045788 5:14106660-14106682 TTGGGCCATTGCACTCCAGCTGG - Intergenic
989000217 5:36752082-36752104 CTGGGCACAGGCACTTCAGCAGG + Intergenic
990398705 5:55413290-55413312 TTGCACCATTGCACTCCAGCTGG + Intronic
991914490 5:71592334-71592356 TTGCACCATTGCACTCCAGCCGG + Intronic
993556223 5:89342817-89342839 CTGGCCACTTGCACACCATCTGG + Intergenic
994449185 5:99919618-99919640 CTGGACACAGGAAGTCCAGCTGG - Intergenic
997501820 5:134381298-134381320 CTGTACCACTGCACTCCAGCAGG - Intronic
997513275 5:134467144-134467166 CGGGACACTGGCACCCCAGCAGG + Intergenic
997624715 5:135323933-135323955 CTGCCCACTTGCAGTCCAGCAGG - Intronic
998937674 5:147248074-147248096 TTGCACCATTGCACTCCAGCCGG + Intronic
999207081 5:149856813-149856835 TTGCACCATTGCACTCCAGCTGG - Intergenic
1000047932 5:157536738-157536760 CTGGACACTTGCACTCCAGCAGG + Intronic
1000579016 5:163012249-163012271 CTGCGCCATTGCACTCCAGCCGG + Intergenic
1002126621 5:177050375-177050397 ATGCACACTTGCACTCTTGCAGG - Intronic
1003625429 6:7737139-7737161 CTGCACCACTGCACTCCAGCCGG + Intronic
1003754448 6:9100774-9100796 CTGGACACTTCCATTCTAGCTGG + Intergenic
1003927457 6:10889663-10889685 TTGCACTATTGCACTCCAGCTGG - Intronic
1005853055 6:29836981-29837003 TTGCACCATTGCACTCCAGCTGG + Intergenic
1007236089 6:40392271-40392293 CTGGACTCCAGGACTCCAGCCGG - Exonic
1013554429 6:111241677-111241699 TTGCACCATTGCACTCCAGCTGG + Intergenic
1014002188 6:116376413-116376435 CTGAACACTTTTCCTCCAGCAGG - Intronic
1015122043 6:129710339-129710361 CTGGACAATTGCACTCTGGGCGG + Intergenic
1015236459 6:130976908-130976930 CTGGACATTTACAGTCTAGCAGG + Intronic
1015237539 6:130988069-130988091 CTGGGCTACTGCACTCCAGCTGG + Intronic
1015355128 6:132268928-132268950 CTGCACTCCTGCACTCCAGCTGG + Intergenic
1015550900 6:134411612-134411634 CTGGATACTTGCTGGCCAGCTGG - Intergenic
1016746559 6:147587115-147587137 CTGGAAACTTACAATCAAGCAGG - Intronic
1017910551 6:158788600-158788622 TTGCACCATTGCACTCCAGCCGG + Intronic
1018341030 6:162851158-162851180 CTGGACACGTGCTCACCAGGAGG - Intronic
1019261437 7:84137-84159 CTGGAAACTTGGACTCCAGCTGG + Intergenic
1020506183 7:8991777-8991799 CTGTACCATTGCACTCCAGCTGG - Intergenic
1020609364 7:10375958-10375980 CTGGACACTTACACTCTCCCAGG + Intergenic
1022969768 7:35506051-35506073 CTGGACACTTACTCTGCAGCAGG + Intergenic
1024005356 7:45221544-45221566 CTGGACCCATTCACTCCTGCAGG - Intergenic
1025165057 7:56705092-56705114 TTGAACCATTGCACTCCAGCCGG - Intergenic
1025728309 7:64087953-64087975 CTGGACCCTGGAATTCCAGCTGG - Intronic
1027360923 7:77408902-77408924 CTGGACACCTGCACTGGAGCTGG + Intronic
1028198336 7:87933227-87933249 CTCACCACTTGCACTCCAGTTGG + Intergenic
1029388599 7:100259710-100259732 TTGCACCATTGCACTCCAGCAGG + Intronic
1029695686 7:102211733-102211755 TTGCACTATTGCACTCCAGCAGG + Intronic
1031922994 7:127614951-127614973 CTGGACACTCACCCTTCAGCTGG + Exonic
1032506523 7:132439168-132439190 CCTGACACTTGCAGTGCAGCTGG + Intronic
1033408109 7:141090228-141090250 TTGCACCATTGCACTCCAGCCGG - Intronic
1033435708 7:141331756-141331778 ATAGACACTTGCCCTCCATCAGG - Intronic
1034046084 7:147929045-147929067 CTGCGCCGTTGCACTCCAGCCGG + Intronic
1034183150 7:149154190-149154212 CGGCCCACTTGCCCTCCAGCTGG - Exonic
1034196248 7:149250398-149250420 CGGCCCACTTGCCCTCCAGCTGG - Exonic
1034198588 7:149266580-149266602 CGGCCCACTTGCCCTCCAGCTGG - Exonic
1034227352 7:149494332-149494354 CGGCCCACTTGCCCTCCAGCTGG + Exonic
1034242530 7:149621388-149621410 CGGCCCACTTGCCCTCCAGCTGG + Intergenic
1036088898 8:5643337-5643359 TTGCACCATTGCACTCCAGCCGG + Intergenic
1036691284 8:10946345-10946367 ATGGACACGTGCACTTGAGCAGG + Intronic
1038401010 8:27284516-27284538 CTGGAGAAATGCACTGCAGCGGG + Intergenic
1039834869 8:41248160-41248182 CAGGCCACCTGCACTCCAGCTGG + Intergenic
1041735236 8:61104082-61104104 CTGGACATTTGGATTTCAGCAGG + Intronic
1042323824 8:67507231-67507253 CTGGTCTCTTGCAATCCTGCTGG + Intronic
1042586713 8:70347613-70347635 TTGCACCATTGCACTCCAGCTGG + Intronic
1043154765 8:76764687-76764709 CCGTACATTTTCACTCCAGCTGG + Intronic
1043835314 8:85038548-85038570 GTGGAGACTTGCAGCCCAGCAGG - Intergenic
1048572098 8:135664847-135664869 GAGGACACTTACACACCAGCAGG + Intergenic
1049348477 8:142151725-142151747 CTGGACAACTGCCCTCCTGCTGG - Intergenic
1049767854 8:144363249-144363271 CTGGCCACTTGCTGTGCAGCTGG - Intergenic
1049817443 8:144612806-144612828 CTGCACCACTGCACTCCAGCCGG + Intergenic
1052593596 9:30530802-30530824 CTGGCCACTTTCGCACCAGCAGG + Intergenic
1052818749 9:33122543-33122565 CTGGAAACTGGCACTCCAAAAGG + Intronic
1053457753 9:38244103-38244125 CTGAACACCTGCGCTCCATCTGG + Intergenic
1054715992 9:68558253-68558275 CTCGACACGTGAACTTCAGCTGG - Intergenic
1058146589 9:101418751-101418773 CTGGAGTCTTTCATTCCAGCAGG + Intergenic
1058766318 9:108185997-108186019 TTGCACCATTGCACTCCAGCTGG - Intergenic
1058778113 9:108305317-108305339 TTGCGCATTTGCACTCCAGCCGG + Intergenic
1059047587 9:110886151-110886173 TTGCACCATTGCACTCCAGCCGG + Intronic
1059433691 9:114264376-114264398 CTGGACCCTTGCTCCCCAGCTGG - Exonic
1060884989 9:127145108-127145130 CTGGGCCCTGACACTCCAGCTGG + Intronic
1062422021 9:136487236-136487258 CTGGAAGCTTGCAGTACAGCTGG - Intergenic
1062623173 9:137431644-137431666 CTGGTCACTCGCACCCCAGTGGG - Intronic
1062741967 9:138180224-138180246 CTGGACACCTGTACCCCAGGAGG + Intergenic
1185608782 X:1381987-1382009 TTGCACCATTGCACTCCAGCCGG - Intronic
1187534154 X:20122987-20123009 TTGCACCATTGCACTCCAGCCGG - Intergenic
1187830899 X:23380164-23380186 CTGGCCACTCTCACTGCAGCCGG + Exonic
1187890936 X:23934443-23934465 CTGCACCACTGCACTCCAGCCGG - Intronic
1190688053 X:52891650-52891672 AAGGACACTAGCACACCAGCAGG + Intronic
1190697929 X:52964142-52964164 AAGGACACTAGCACACCAGCAGG - Intronic
1198327051 X:135584415-135584437 CTGGACACATGCTGTCCAGGAGG + Intergenic
1198369345 X:135974659-135974681 CTGGAAACTGGCACTGCAGAAGG + Intergenic
1201365327 Y:13199186-13199208 TTGTACCATTGCACTCCAGCTGG + Intergenic