ID: 1000047932

View in Genome Browser
Species Human (GRCh38)
Location 5:157536738-157536760
Sequence CTGGACACTTGCACTCCAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 287
Summary {0: 1, 1: 0, 2: 2, 3: 20, 4: 264}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000047931_1000047932 -9 Left 1000047931 5:157536724-157536746 CCAGTGTTATCTTGCTGGACACT 0: 1
1: 0
2: 1
3: 7
4: 135
Right 1000047932 5:157536738-157536760 CTGGACACTTGCACTCCAGCAGG 0: 1
1: 0
2: 2
3: 20
4: 264

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000047932 Original CRISPR CTGGACACTTGCACTCCAGC AGG Intronic