ID: 1000048311

View in Genome Browser
Species Human (GRCh38)
Location 5:157540124-157540146
Sequence ATGCCATGCCTGGCACAAAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 311
Summary {0: 1, 1: 1, 2: 7, 3: 30, 4: 272}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000048311 Original CRISPR ATGCCATGCCTGGCACAAAG TGG Intronic
900080073 1:850011-850033 GGGCCATGCCTGGCACAGTGAGG - Intergenic
900667037 1:3822537-3822559 ATTCGCTGCCTGGCATAAAGAGG + Intronic
902264028 1:15248195-15248217 CTGCCATGCCTGACACATAGTGG - Intronic
902281799 1:15380141-15380163 GTGCCATGCTGGGCACAAGGAGG + Intronic
902551225 1:17220787-17220809 GTGCAGTGCCTGGCACAGAGAGG + Intronic
902642140 1:17773938-17773960 ATGTAATGCCTGGCACAAGAGGG + Intronic
902753689 1:18535479-18535501 GTGACATGCCAGGCACCAAGGGG + Intergenic
902849330 1:19141319-19141341 AGGCCATGCCAAGAACAAAGCGG - Intronic
903557765 1:24206051-24206073 AGGCCATGCCTCCCAGAAAGGGG - Intergenic
904428707 1:30448079-30448101 AGGACATGGGTGGCACAAAGAGG + Intergenic
904744353 1:32702199-32702221 ATGCCCAGCCTTGCACCAAGTGG + Intronic
905180540 1:36162875-36162897 AGGACCTGCCTGGCACAGAGTGG - Intronic
905376381 1:37523967-37523989 CTGTCATGCCTGGCCCAAAGTGG - Intergenic
905631107 1:39519015-39519037 AAGCCAGGCCTGGCTCAGAGGGG + Intronic
905666652 1:39767156-39767178 AAGCCAGGCCTGGCTCAGAGGGG - Intronic
905696776 1:39980477-39980499 ACACAATGCCTAGCACAAAGTGG + Intergenic
905861338 1:41354001-41354023 AGGCCATGCCTAGCACCCAGAGG + Intergenic
905996708 1:42387595-42387617 GTACAATGCCTGGCACAGAGTGG - Intronic
906365697 1:45207356-45207378 ATCCTCTGCCTGGCACATAGTGG + Intronic
906497121 1:46312536-46312558 ATACCATGCCTGGCCTCAAGGGG + Intronic
906746949 1:48228727-48228749 ATGCAGTGCCTGGCATACAGTGG + Intronic
908261780 1:62344719-62344741 AAGCTCTGCCTGGCACATAGTGG - Intergenic
909620481 1:77661696-77661718 ATGGAATGTCTGGCATAAAGTGG + Intronic
915232369 1:154455196-154455218 CTACCATGCCCGGCCCAAAGAGG + Intronic
915492339 1:156258045-156258067 CTGTCATGTCTGGCACAAAATGG + Intronic
916458810 1:164999318-164999340 TTCCTATGACTGGCACAAAGAGG + Intergenic
917791436 1:178501661-178501683 TTGCCATGCCTGGCAAGGAGGGG + Intergenic
918043736 1:180928524-180928546 ATGTCATGGCTGGCACGGAGGGG - Exonic
920101506 1:203519844-203519866 ATCCCATGTCTGGCACACAGTGG - Intergenic
920498737 1:206473144-206473166 ATTCCATTCCTGGCACAGGGTGG - Intronic
922008068 1:221552074-221552096 AGAACATGCCTGGCACAGAGTGG + Intergenic
922228145 1:223663585-223663607 AGCCCATGCCTGGCACAAAATGG + Intronic
922973032 1:229759154-229759176 GTGGCATGCCTGGCAGAAGGAGG + Intergenic
923150065 1:231224897-231224919 CCCACATGCCTGGCACAAAGAGG + Intronic
924569132 1:245221962-245221984 ATGACATGCATGACAGAAAGTGG + Intronic
924691295 1:246353802-246353824 ATACAGTGCCTGGCACACAGTGG + Intronic
924736861 1:246765374-246765396 TTGCCATGCCTGGCCCACGGGGG + Intronic
1065613901 10:27500719-27500741 ATACCATGCCTGGTTTAAAGAGG - Intergenic
1065660886 10:28003268-28003290 ATGGAGTGCCTGGCACAAAATGG - Intergenic
1068761466 10:60715317-60715339 ACAAAATGCCTGGCACAAAGAGG + Intronic
1069128471 10:64668560-64668582 ATGACATGTCTGGCACTAATTGG + Intergenic
1069745349 10:70711578-70711600 AGCACATGCCTGGCACATAGTGG + Intronic
1071519351 10:86319487-86319509 ATCCCATGCCAGGCAGAAAAGGG - Intronic
1072798588 10:98375581-98375603 ATGCCATGCCGGGCAGAAGGTGG - Intergenic
1073447905 10:103592081-103592103 ATGCCCTGCCTGCCACACAGAGG - Exonic
1073489702 10:103844822-103844844 ATGCAATGCCTGGCACAAAATGG + Intronic
1073767195 10:106695648-106695670 ACACCATGCCTGGCATAAAGTGG + Intronic
1076754496 10:132562200-132562222 AGGTCATGCCTGGCACCAACTGG - Intronic
1077442513 11:2575241-2575263 ATGCCAAGCCGGGCACAAAGGGG - Intronic
1082774044 11:57232352-57232374 GTGAGATGCCTGGCACACAGTGG - Intergenic
1083921813 11:65785422-65785444 CAGCTGTGCCTGGCACAAAGTGG - Intergenic
1084229819 11:67743481-67743503 GTGCCATCTCTGGCACAAAGTGG + Intergenic
1085648102 11:78241021-78241043 ATGCCAGACCTGACACTAAGAGG + Intronic
1086182666 11:83972811-83972833 ATCCTGTGCCTGGCACAGAGTGG - Intronic
1087043242 11:93821846-93821868 GTACAATGCCTGGCACATAGTGG + Intronic
1087604122 11:100354474-100354496 ATGCCAAACCTGGCAAAAAATGG - Intronic
1087887348 11:103496005-103496027 ATGCCATCCCAGGCACAATCAGG - Intergenic
1088219734 11:107556598-107556620 GTCCCATGCCTGGCACAAATAGG + Intronic
1089215974 11:116835055-116835077 CTGCCAGGGCTGGCAGAAAGAGG + Intergenic
1089659943 11:119979207-119979229 ACCCAATGCCTGGCACATAGTGG - Intergenic
1091890623 12:4051342-4051364 ATGCAGTGCCTCGCACAAGGTGG + Intergenic
1097297798 12:57985693-57985715 ATGCCAAGGCTAGCACAAAGAGG - Intergenic
1100120441 12:91363710-91363732 CTCCAATGTCTGGCACAAAGTGG + Intergenic
1101060430 12:100965538-100965560 ATGCCAGGCCAGGTACAATGTGG - Intronic
1101440955 12:104704044-104704066 GTCCAATGCCTGGCACCAAGTGG + Intronic
1101735322 12:107458891-107458913 TTCCCATGCCTGGCATAGAGGGG - Intronic
1101873225 12:108582280-108582302 GTACCATGCCTGGTACACAGTGG + Intergenic
1101993636 12:109508411-109508433 GTGCAGTGCCTGGCACAGAGTGG + Intronic
1102439284 12:112949025-112949047 AGGCCATTCCCGGCACAGAGGGG - Exonic
1102555755 12:113725386-113725408 ATGACATGCGTGTCCCAAAGTGG - Intergenic
1102955995 12:117059323-117059345 AGGCCATGCCGGGGACACAGAGG - Intronic
1102979360 12:117229235-117229257 AAGCCAGGCCTGGCACCAACAGG - Intronic
1103943148 12:124511722-124511744 ATGCACTCCCAGGCACAAAGGGG + Intronic
1104017548 12:124970998-124971020 ATGCCTTGCCAGGCGCAATGGGG - Intronic
1104830408 12:131747190-131747212 CTGCCATGCCAGGAACACAGTGG + Intronic
1104848818 12:131861204-131861226 GAGCCATGCCAGGCACACAGTGG + Intergenic
1105255259 13:18740071-18740093 GTGCCATGCCTGACACATGGTGG + Intergenic
1107167472 13:37299336-37299358 TTTCCATGCCTGTCACAATGTGG + Intergenic
1108014725 13:46062694-46062716 GTGCAGTGCCTGGCACAAGGAGG - Intronic
1108729119 13:53214646-53214668 ATGACAGGTCTTGCACAAAGAGG + Intergenic
1109011073 13:56945245-56945267 ATACCATGGCTGGAACAAAATGG + Intergenic
1112136529 13:96584534-96584556 GGACCATGCCTGGCACATAGAGG + Intronic
1112189746 13:97164412-97164434 GTGCAATGCCTGGTACACAGAGG + Intergenic
1114636501 14:24190056-24190078 ATTCTTTGCCTGGCACAAAGAGG + Intronic
1117087822 14:52219673-52219695 ATGCCATGCCTGGCTAATTGTGG + Intergenic
1117467924 14:56012787-56012809 ATGCCAAAACTGGCACAGAGAGG + Intergenic
1119104010 14:71907085-71907107 ATACCATGTCTGGCACATATGGG - Intergenic
1119112609 14:71989111-71989133 GCCCAATGCCTGGCACAAAGTGG - Intronic
1119265203 14:73260230-73260252 ACAGCATGCCTGGCACAGAGAGG + Intronic
1122123172 14:99565367-99565389 ATGCAATGCCTGGCACAATGTGG + Intronic
1122206109 14:100148843-100148865 ATGCCATGACTAGCACAAAAAGG + Intronic
1122211184 14:100175180-100175202 CAGCCTTGCCTGGCACACAGTGG + Intergenic
1124614163 15:31229529-31229551 AGACCATGCCTGGAACAAGGAGG - Intergenic
1124851647 15:33345252-33345274 GCTCCATGCCTGGCACATAGTGG - Intronic
1125147146 15:36484955-36484977 ATGCAATGCTTGGCATAAAAAGG + Intergenic
1125487645 15:40123425-40123447 CTGCCCAGCCTGGGACAAAGAGG + Intergenic
1125515737 15:40319865-40319887 AAGCCATGCCTGACAGCAAGAGG - Intergenic
1125745245 15:41993178-41993200 CTGTTATGCCTGGCACACAGTGG - Intronic
1126238031 15:46408359-46408381 ATACAATGCCTGGCACATAGTGG + Intergenic
1127002842 15:54530405-54530427 ATGCCATGCTTGGCACAAAGAGG - Intronic
1127630564 15:60823511-60823533 ACCTCATGCCTGGCACACAGTGG + Intronic
1127647167 15:60970428-60970450 ATACAATGCCTGGCACGCAGTGG - Intronic
1128321512 15:66698015-66698037 ATTCAATGCCTGTCACATAGTGG - Intergenic
1128515582 15:68339837-68339859 ATTCCATCCTTGGCACAAAATGG + Intronic
1128707352 15:69846594-69846616 ATGCAGTGCCTGGCATATAGTGG + Intergenic
1128899794 15:71410056-71410078 ACACCAAGCCTGGCACACAGAGG - Intronic
1129249288 15:74299744-74299766 ATGGCGTGCCTGGAACAGAGTGG - Intronic
1130090752 15:80819243-80819265 ATGCCATGCCTGTCAGAGTGTGG + Intronic
1131649936 15:94387608-94387630 AAGCACTGCCTGGCACCAAGTGG - Intronic
1131728963 15:95258993-95259015 ATGCCCTGCCATGCACAAAGAGG - Intergenic
1134013346 16:10871352-10871374 ATGGAATGCGAGGCACAAAGGGG + Intergenic
1134355857 16:13481641-13481663 GTACCATGCCCGGCACATAGAGG + Intergenic
1134677227 16:16099205-16099227 ATGAAGTGCCTGGCACACAGTGG + Intronic
1135725219 16:24849064-24849086 ATGTAGTGCCTGGCACATAGAGG + Intronic
1135799220 16:25476921-25476943 CCACCATGCCTGGCCCAAAGCGG + Intergenic
1135956573 16:26961040-26961062 CTACCATGCCTGGCACAGAGCGG - Intergenic
1135990956 16:27218492-27218514 TTGCCATACCTGGCAGAAACAGG - Intronic
1137018773 16:35401620-35401642 ATTCCATGCCTGCCTCAAAGAGG - Intergenic
1137774562 16:51044374-51044396 ATGCCAGGCTTGGCACTAAAAGG + Intergenic
1139595324 16:67954440-67954462 CTGCCTTGCCTGGCCCAAACTGG + Intronic
1139710515 16:68772271-68772293 CTTCCATGCATGGCACGAAGAGG - Intronic
1141468689 16:84223797-84223819 GAACCATGCCTGGCACAAAGTGG - Intronic
1142227732 16:88885680-88885702 AGTCCATGCCCGGCACACAGGGG + Intronic
1142965817 17:3580360-3580382 ACGCCGGGCCTGGCACATAGTGG - Intronic
1148449923 17:47770347-47770369 ATCCCAGGCCTGGCAAATAGGGG + Intergenic
1148476291 17:47930900-47930922 ATTCCATGCCTGGAAGAAAGAGG + Intergenic
1149530286 17:57389594-57389616 ATGCAGTGCTTGGCACATAGTGG + Intronic
1149983993 17:61333387-61333409 AAGCCAGGCCTAGGACAAAGTGG + Intronic
1151026012 17:70677942-70677964 GGGCCATGCCTGGAAGAAAGGGG + Intergenic
1151591830 17:75049890-75049912 ATGCCAAGCCTTGTAGAAAGTGG - Intronic
1153894335 18:9544816-9544838 AAGCCAGGCCGGGCAGAAAGTGG + Intergenic
1154306149 18:13232353-13232375 AAACCATGCCAGGCAAAAAGGGG - Intronic
1154435762 18:14340531-14340553 GTGCCATGCCTGACACATGGTGG - Intergenic
1157158932 18:45295142-45295164 AGGCCACTCCTGGCACAGAGGGG + Intronic
1159883325 18:73880700-73880722 CAGCCCTGCCTGGCACTAAGAGG + Intergenic
1160120814 18:76129198-76129220 ATGCCATGCCATGCCCACAGAGG - Intergenic
1160663797 19:313462-313484 CTGCCATGCCGGGGACAGAGGGG - Intronic
1161049005 19:2152144-2152166 TTACCATGCCTGGCACACAATGG - Intronic
1162611211 19:11755025-11755047 CCACCATGCCTGGCCCAAAGAGG - Intergenic
1163245426 19:16090924-16090946 ATGCCAGGGCTGGCACATATGGG - Intronic
1165221483 19:34320282-34320304 GGCACATGCCTGGCACAAAGTGG - Intronic
1166222290 19:41373466-41373488 AAACAGTGCCTGGCACAAAGTGG - Intronic
1166740727 19:45113349-45113371 ACGCCATGCGTGGCACCCAGTGG - Intronic
1168200714 19:54813464-54813486 ATTCCATGACAGGCAGAAAGTGG + Intronic
925650739 2:6086613-6086635 ATGTCGTGTCTGACACAAAGTGG + Intergenic
927749621 2:25655805-25655827 GTGCCATGCCGGGAACAAAATGG - Intronic
928096356 2:28407378-28407400 ATCCCATGCCTGTCACACAGAGG - Intronic
928340379 2:30438252-30438274 ATGCCATGCTTGGGTCATAGTGG - Intergenic
929269434 2:39957605-39957627 ATGGCATGCATGGTACAGAGGGG - Intergenic
929270633 2:39967456-39967478 ATGGCATGCATGGTGCAAAGTGG + Intergenic
929601313 2:43206457-43206479 ACACCTTGCCTGGCACACAGTGG - Intergenic
930295706 2:49550463-49550485 CTGCAATGTTTGGCACAAAGGGG - Intergenic
930832900 2:55764181-55764203 ATACCTTGCCTGGCCAAAAGTGG - Intergenic
932180069 2:69638934-69638956 ATACAGTGCCTGCCACAAAGAGG + Intronic
932272413 2:70422480-70422502 AAGCCACGCCTGACACAATGAGG - Intergenic
934490274 2:94757609-94757631 GTGCCATGCCTGACACAAGGTGG + Intergenic
935120682 2:100180914-100180936 ATGCCGTGCCTTGCACACAGAGG + Intergenic
937894531 2:126968722-126968744 ATGGCATGCCTGGTGCAGAGTGG - Intergenic
938067825 2:128291610-128291632 ACGCCATGCCTGGGGCAAGGTGG + Intronic
938558248 2:132446259-132446281 AGCACATGCCTGGCACATAGTGG - Intronic
938685282 2:133732001-133732023 ATCCCATGCCTTCCACAAACAGG + Intergenic
938742735 2:134248280-134248302 TGGCCATGCCTTGCACACAGAGG - Intronic
941396646 2:164981994-164982016 ATGCAATTACTGGCACCAAGAGG - Intergenic
941600322 2:167535515-167535537 CTGGCATGCCTTGCAGAAAGAGG + Intergenic
942682845 2:178496256-178496278 CTGCCACCCCTGGCAAAAAGAGG - Intronic
943230652 2:185246056-185246078 ATGCTATGCCTGGAACTCAGAGG + Intergenic
945501147 2:210577156-210577178 ATGCCATGCATGTCAGAAGGGGG + Intronic
948353345 2:237358774-237358796 CTCCAGTGCCTGGCACAAAGTGG - Intronic
948404502 2:237706919-237706941 ATGCCTAGCCTGGCCCCAAGAGG + Intronic
1170588836 20:17755704-17755726 ATACCATGCCTGGCATCTAGTGG - Intergenic
1171880086 20:30612050-30612072 GTGCCATGCTTGACACAAGGTGG + Intergenic
1172675013 20:36663192-36663214 ATGGCATGACTTGCACATAGAGG - Intronic
1173010083 20:39174571-39174593 GTGTCATGCTTGGCACACAGGGG - Intergenic
1173419900 20:42891762-42891784 ATACAGTGCCTGGCACACAGTGG - Intronic
1173662147 20:44742260-44742282 ATGGCTTGCCTGGCTCACAGAGG + Intergenic
1173800002 20:45889164-45889186 AGCACAGGCCTGGCACAAAGAGG + Intronic
1174436132 20:50508428-50508450 ATGACATGCCAGGCCCAGAGGGG + Intergenic
1174541977 20:51296835-51296857 TGGCCATGCTTGGCACAGAGAGG - Intergenic
1174560201 20:51425622-51425644 ACGGCAAGCCTGGGACAAAGCGG - Intronic
1175957332 20:62618119-62618141 AGGCCATTCCGGGCACACAGCGG + Intergenic
1176841274 21:13845103-13845125 GTGCCATGCCTGACACATGGTGG + Intergenic
1178407326 21:32335314-32335336 ATGCCAACCCTGGCACGAATCGG + Intronic
1178429855 21:32509575-32509597 GTGCCATCCCTGGCACAGAGTGG - Intronic
1180741573 22:18056874-18056896 AGCACATGACTGGCACAAAGGGG - Intergenic
1180946580 22:19697126-19697148 ATGCCATTCCAGGCAGACAGTGG - Intergenic
1181918807 22:26302971-26302993 ATGCCATCCCTGGCACAGAGTGG - Intronic
1182075098 22:27490197-27490219 AGGTCCTGGCTGGCACAAAGGGG + Intergenic
1183079847 22:35449396-35449418 AGGCCATGGCTGGGACAGAGAGG - Intergenic
1183260427 22:36791490-36791512 ATACGCTCCCTGGCACAAAGGGG - Intergenic
1183934111 22:41252397-41252419 ATGCAGTGCCTGGCAGAAAATGG + Intronic
1184099323 22:42333806-42333828 AGGCCAGGCCTGGCACATAGTGG - Intronic
1184280890 22:43436770-43436792 ACCCCGTGCCTGGCACACAGCGG - Intronic
1184800081 22:46753766-46753788 ATGGCCTGCCTGGCACAGTGTGG - Intergenic
949479768 3:4482467-4482489 TCGCAATGCCTGGCACATAGTGG - Intergenic
950131925 3:10553329-10553351 GTTCCATGCCTGACACAGAGAGG + Intronic
950500601 3:13361229-13361251 GAACCATGCCTGGCACATAGCGG + Intronic
950933076 3:16810662-16810684 CTGCCATGCCTGGCAGGAAAGGG - Intronic
952250546 3:31648794-31648816 ATGCCATGCCAGCCACCCAGGGG + Intergenic
952358574 3:32606943-32606965 TAGCAATGCCTGGCACATAGTGG + Intergenic
954293907 3:49663730-49663752 ATGCCCAGCCTGGAACCAAGGGG - Intronic
954461708 3:50630543-50630565 ATGACATGCCTGGTACAGGGCGG + Intronic
955290856 3:57691362-57691384 ATGCAGTGCCTGGCACCTAGTGG - Intronic
955719606 3:61867179-61867201 ATGCCATGCCAGGCACCCAGTGG - Intronic
956688412 3:71853936-71853958 AGCACATGCCTGGCACACAGTGG + Intergenic
957046387 3:75378327-75378349 GTGCCATCTCTGGCACAGAGTGG + Intergenic
957566610 3:81892220-81892242 ATGTTGTGCCTGGCACAAGGTGG - Intergenic
959713682 3:109410067-109410089 ATACCATGGCTTGTACAAAGCGG - Intergenic
961048397 3:123725631-123725653 ATGAGATGCCTGACACATAGGGG - Intronic
961798078 3:129424160-129424182 GTGCCCAGCCTGGCCCAAAGTGG + Intronic
961878452 3:130042565-130042587 TTGCCATCTCTGGCACAGAGTGG + Intergenic
962464072 3:135640696-135640718 GTAGCATGCCTGGCACAGAGTGG - Intergenic
966773350 3:183523216-183523238 ATGCAATGCCTGGGACATAGCGG - Intronic
968799464 4:2732726-2732748 CTGCTCTGCCTGGCACACAGAGG - Intergenic
968990674 4:3909440-3909462 GTGCCATCTCTGGCACAGAGTGG + Intergenic
969105641 4:4805289-4805311 AACCCATGCCTAGCACAAAATGG - Intergenic
969258557 4:6019577-6019599 AGGCCAGGCCTGGTGCAAAGAGG + Intergenic
969266718 4:6069197-6069219 CTGTCATGACTGGCACACAGTGG + Intronic
969824665 4:9747902-9747924 GTGCCATCTCTGGCACAGAGTGG - Intergenic
969987147 4:11224150-11224172 ATGCAATGGCTGTCACAACGTGG + Intergenic
971529850 4:27673299-27673321 AAGCTATGCCTAGCACAAATTGG - Intergenic
975671898 4:76788224-76788246 ATGTCATACCTGACACCAAGAGG + Intergenic
979110664 4:116751100-116751122 ATGCAATGCCTGTCAAAGAGTGG + Intergenic
981409654 4:144413959-144413981 ATGCAATGCTTGGCACATAATGG + Intergenic
983901956 4:173145567-173145589 AGACCAACCCTGGCACAAAGTGG + Intergenic
987043279 5:14083138-14083160 AGAACATGCCTGGCACACAGTGG + Intergenic
990511596 5:56494019-56494041 ATGAAATGCCTGGCTCCAAGGGG - Intergenic
994428723 5:99628163-99628185 ATGCCCTGCCTGGGTCAGAGGGG - Intergenic
996148807 5:120010003-120010025 ATGCCAAGAGTGGCAGAAAGAGG + Intergenic
997033231 5:130156314-130156336 ATGAAATGCCTTGCACAAAATGG - Intronic
997243633 5:132327491-132327513 GTGCAATGCCTGGTACATAGTGG - Intronic
997408855 5:133674705-133674727 ATACCATGCCTGGCACACAGTGG + Intergenic
997594793 5:135099850-135099872 CTGCCATGCCTGGCCCCAACTGG - Intronic
997859452 5:137403379-137403401 GAGACATGCCTGGCACAGAGTGG - Intronic
998509702 5:142701439-142701461 ATTACAGGCCTGGCACACAGTGG + Intergenic
998666752 5:144306511-144306533 AAGCCATCACTGGCATAAAGTGG - Intronic
1000048311 5:157540124-157540146 ATGCCATGCCTGGCACAAAGTGG + Intronic
1000251305 5:159498067-159498089 GCTCCTTGCCTGGCACAAAGAGG - Intergenic
1001117004 5:168948224-168948246 ATGCACTGCCTGGCACACAGTGG + Intronic
1007976273 6:46104592-46104614 TTGCCAGGCTTGGAACAAAGTGG - Intergenic
1008866221 6:56213796-56213818 CTCCCATGCCTGGCGCAAATAGG - Intronic
1010237393 6:73586766-73586788 AAGCAATGCCTGGTACATAGTGG + Intergenic
1011418546 6:87148688-87148710 GTTCAATGCCTGGCACATAGTGG - Intergenic
1012425591 6:99110793-99110815 ATGCATGGCCTGGCACATAGGGG + Intergenic
1014624212 6:123705697-123705719 GTGCTATGCATGGCACAAACTGG - Intergenic
1014810146 6:125875972-125875994 ATCCTAGGCTTGGCACAAAGTGG + Intronic
1015524788 6:134165856-134165878 ATGTCATGCTAGGCAAAAAGAGG - Intergenic
1015923277 6:138286687-138286709 ATGCCACGCCTGGAACATGGAGG - Exonic
1017791216 6:157801439-157801461 CTACCATGCCTGGCACACAGTGG - Intronic
1017813728 6:158002180-158002202 GAACCATGCCTGGCACACAGTGG + Intronic
1017919518 6:158859073-158859095 ACACACTGCCTGGCACAAAGTGG + Intergenic
1018984056 6:168622468-168622490 ATGCCATGGCGAGAACAAAGGGG - Intronic
1020313506 7:6887560-6887582 GTGCCATCTCTGGCACACAGTGG + Intergenic
1021441549 7:20682677-20682699 AGACAATGCCTGGCACACAGTGG + Intronic
1024535837 7:50431706-50431728 AGGCAATGCCTGACACAAAAAGG + Intergenic
1025605539 7:63037758-63037780 GTTCCATGCCTGGCACATTGGGG - Intergenic
1026944960 7:74309909-74309931 CCACCATGCCTGGCCCAAAGTGG - Intronic
1027127688 7:75568497-75568519 AAGCCATGCCGGGCACAATAGGG + Intronic
1029551422 7:101239025-101239047 ATGCCGAGCCTGGCACGAGGGGG + Intergenic
1029858269 7:103540987-103541009 ATGCCTGGCCTTTCACAAAGAGG - Intronic
1031398021 7:121295928-121295950 ATGCCATACCTGGCCCACAGTGG - Exonic
1031555842 7:123175100-123175122 AGCACATGCCTGGCACAAACTGG + Intronic
1033775639 7:144607588-144607610 AAGCAATACCTGGCACATAGCGG - Intronic
1034515570 7:151575697-151575719 ATGCCATGTGTGGCCCAAAGTGG + Intronic
1034536938 7:151731292-151731314 AGGCCATGTCTGGCACAGAAGGG - Intronic
1035066065 7:156105814-156105836 ATGCCTTGCCTGGCAGAAGATGG + Intergenic
1035176411 7:157055161-157055183 ATCCCATGCCTGTCCTAAAGGGG + Intergenic
1037263002 8:17027958-17027980 AGGCCATGACAGGCAGAAAGTGG + Intronic
1037454238 8:19047671-19047693 ATGTCATACCTGGCACAACACGG + Intronic
1037660677 8:20924005-20924027 ATTCCAGGCCAGGCACAAAATGG - Intergenic
1037761312 8:21743591-21743613 ACACAATGCCTGGCCCAAAGTGG + Intronic
1037931309 8:22881981-22882003 CTGCCATCCCTGGCTCAATGGGG + Intronic
1042498997 8:69488801-69488823 ATACCATGCAGGGCACACAGGGG + Intronic
1042522417 8:69727612-69727634 ATGCCATGCCTGGCTCAGAGTGG + Intronic
1042701217 8:71617033-71617055 ATGCAGTGTCTGGCACAGAGAGG - Intergenic
1043051997 8:75395822-75395844 AGGCCATCCCTGGCACAAGGTGG - Intergenic
1043605146 8:81990901-81990923 ATCCCATGCCTGGCTCAGTGGGG - Intergenic
1044408287 8:91855813-91855835 ACTCTATGCCTAGCACAAAGAGG - Intergenic
1044850617 8:96423911-96423933 ATGTCATGGCTGGCAGAAAATGG + Intergenic
1045046269 8:98282019-98282041 TTACCTTGCCTGGCAGAAAGAGG - Intronic
1046873276 8:119226958-119226980 ATCCCACACCTGGCACAAATTGG + Intronic
1049003947 8:139843103-139843125 ATACCATGCCTGGCATATGGTGG + Intronic
1049507819 8:143013257-143013279 AAGCCATGCCCGGGAAAAAGAGG - Intergenic
1050098249 9:2090583-2090605 ATACCATGCCAGGCACATGGTGG + Intronic
1053474173 9:38370158-38370180 ATGCCATTCCAGGCAGAGAGAGG + Intergenic
1054198351 9:62057153-62057175 ACGCTATGCCTGGAACAGAGTGG + Intergenic
1054640003 9:67531210-67531232 ACGCTATGCCTGGAACAGAGTGG - Intergenic
1055023514 9:71695054-71695076 ATGCCTTGCAGGTCACAAAGAGG - Intronic
1057314944 9:93961874-93961896 AGCCCATTCCTGGCACCAAGAGG - Intergenic
1058532766 9:105923490-105923512 ATATAATGCCTGGCACAGAGTGG - Intergenic
1059501899 9:114761996-114762018 CTGCCCTGCCTGCCACTAAGAGG - Intergenic
1059543890 9:115157236-115157258 ATACTGTGCCTGGCCCAAAGTGG - Intronic
1059973153 9:119688195-119688217 ATACAATTTCTGGCACAAAGAGG + Intergenic
1060775612 9:126371542-126371564 TAGCCATGCCAGGCACAGAGGGG - Intronic
1060965124 9:127707917-127707939 ATGGCCTGCCTGGCACCACGAGG - Intronic
1061896329 9:133650143-133650165 CTCCCAGGCCTGGCACACAGTGG + Intronic
1186149085 X:6655298-6655320 ATGCCATCCCAGGCAGCAAGAGG - Intergenic
1186385505 X:9106496-9106518 ATGTCAAGGCTGGGACAAAGTGG + Intronic
1186954985 X:14671839-14671861 AAGTCTTGCCTGGCACATAGAGG + Intronic
1187675134 X:21709108-21709130 AGTCCATGCCAGTCACAAAGTGG + Intronic
1188308003 X:28582477-28582499 GAACCATGCCTGGCACATAGTGG + Intergenic
1189186896 X:39062542-39062564 ATGCCAGACAGGGCACAAAGAGG - Intergenic
1189337620 X:40179855-40179877 GTACAGTGCCTGGCACAAAGTGG - Intergenic
1192615613 X:72618457-72618479 ATACAATGCCTGGCACATGGTGG - Intronic
1194305655 X:92244809-92244831 GTGCTATGCCTGTCACATAGTGG + Intronic
1194952897 X:100148190-100148212 ATGACATGCTTGGATCAAAGCGG - Intergenic
1195430794 X:104787090-104787112 AAACGTTGCCTGGCACAAAGTGG - Intronic
1198138772 X:133781798-133781820 GTACCATGTCTGGCACAGAGCGG - Intronic
1198754830 X:139971543-139971565 ATTCCATGCCTGGCATACGGTGG - Intergenic
1199315991 X:146378899-146378921 AGACCATGCCTGGCAGAAAATGG + Intergenic
1199418565 X:147616022-147616044 ATGCTGTGCCTGGCACAAAGTGG + Intergenic
1199784276 X:151090449-151090471 ATACAGTGCCTGGCACAGAGTGG + Intergenic