ID: 1000050792

View in Genome Browser
Species Human (GRCh38)
Location 5:157561468-157561490
Sequence AAGGGCTTCTGGGACTCTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 350
Summary {0: 1, 1: 1, 2: 3, 3: 27, 4: 318}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000050792_1000050804 16 Left 1000050792 5:157561468-157561490 CCCCCAGAGTCCCAGAAGCCCTT 0: 1
1: 1
2: 3
3: 27
4: 318
Right 1000050804 5:157561507-157561529 AGACCTGAGAATCCAGTGTATGG No data
1000050792_1000050798 -8 Left 1000050792 5:157561468-157561490 CCCCCAGAGTCCCAGAAGCCCTT 0: 1
1: 1
2: 3
3: 27
4: 318
Right 1000050798 5:157561483-157561505 AAGCCCTTGCTCACCGCTCCTGG No data
1000050792_1000050806 18 Left 1000050792 5:157561468-157561490 CCCCCAGAGTCCCAGAAGCCCTT 0: 1
1: 1
2: 3
3: 27
4: 318
Right 1000050806 5:157561509-157561531 ACCTGAGAATCCAGTGTATGGGG 0: 1
1: 0
2: 0
3: 7
4: 144
1000050792_1000050799 -7 Left 1000050792 5:157561468-157561490 CCCCCAGAGTCCCAGAAGCCCTT 0: 1
1: 1
2: 3
3: 27
4: 318
Right 1000050799 5:157561484-157561506 AGCCCTTGCTCACCGCTCCTGGG 0: 1
1: 0
2: 0
3: 9
4: 135
1000050792_1000050805 17 Left 1000050792 5:157561468-157561490 CCCCCAGAGTCCCAGAAGCCCTT 0: 1
1: 1
2: 3
3: 27
4: 318
Right 1000050805 5:157561508-157561530 GACCTGAGAATCCAGTGTATGGG 0: 1
1: 0
2: 0
3: 12
4: 184

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000050792 Original CRISPR AAGGGCTTCTGGGACTCTGG GGG (reversed) Intronic
900737818 1:4310198-4310220 AGGGACTGCTGGGACACTGGAGG - Intergenic
900929778 1:5729182-5729204 ACAGTCTTCTGGGTCTCTGGTGG + Intergenic
901211037 1:7526246-7526268 AGGGGCTCCAGGGGCTCTGGAGG + Intronic
901654569 1:10762060-10762082 AAGGCCTCCGGGGACTCTGAGGG - Intronic
901702403 1:11052729-11052751 AAAGATTTCTGGGACGCTGGGGG + Intergenic
903176091 1:21581784-21581806 ATGGACTTTGGGGACTCTGGGGG - Intergenic
904356694 1:29944914-29944936 AAGACCCTCTGAGACTCTGGGGG + Intergenic
904380817 1:30109481-30109503 ATGGGCTTTGGGGACTCAGGGGG + Intergenic
904533151 1:31182136-31182158 ATGGGCCTCTGGGGGTCTGGAGG + Intronic
904675229 1:32195098-32195120 AGGCGCTTCTGTGACCCTGGGGG - Exonic
905024163 1:34838387-34838409 AAGGGCTGCAGGGCCCCTGGAGG - Intronic
905224124 1:36468034-36468056 CAGGCCTTCTGGGGCTGTGGGGG + Intronic
905785625 1:40754791-40754813 CAGTGCTTCTGGGTCTCTCGGGG + Intronic
906184590 1:43851806-43851828 CAGCGGGTCTGGGACTCTGGTGG - Intronic
907247921 1:53119976-53119998 AAGAGCCTCTGGGAGTCTGGAGG + Intronic
908944839 1:69482833-69482855 AAAGCCTTCTGGCACTCTGTGGG - Intergenic
909649513 1:77958527-77958549 AAGGGTTACTGGGTCCCTGGGGG - Intronic
910337725 1:86154398-86154420 AAGGGCTGCAAGGCCTCTGGTGG + Intronic
911102449 1:94105400-94105422 CAGGGCTGCTGTGGCTCTGGGGG + Intronic
913918975 1:124808942-124808964 AAGGGCTTCGAGGCCTGTGGTGG + Intergenic
913919372 1:124813533-124813555 AAGGGCTTCGAGGCCTGTGGTGG + Intergenic
914343350 1:146778044-146778066 AAGGCTTTCTGTAACTCTGGAGG - Intergenic
914877203 1:151520841-151520863 AAGGACTTCTGGGGTTCTGTGGG + Intronic
915000347 1:152583843-152583865 CAGGGCATCTGGGACTCTCTGGG + Intronic
915299484 1:154943972-154943994 AAGAGCTTCTGGGGCTGGGGAGG - Intergenic
915516578 1:156416300-156416322 AGGGGCCTGTGTGACTCTGGTGG + Intronic
915574542 1:156767131-156767153 AAGGGAGTCTGGGAAGCTGGCGG - Intronic
918078401 1:181187999-181188021 CAGAGATTCTGGCACTCTGGAGG + Intergenic
919919962 1:202161808-202161830 GAGGCCTTCTGAGCCTCTGGGGG - Intergenic
921244528 1:213223374-213223396 ATGGACTTCAGGGACTCAGGAGG - Intronic
922337268 1:224627891-224627913 AATGGCCTCTGAGACTCAGGTGG - Intronic
923000914 1:230005695-230005717 ATGGACTTTGGGGACTCTGGGGG - Intergenic
923325204 1:232874663-232874685 AAGGGCTTCTGGAATTCAGGAGG + Intergenic
923627388 1:235625086-235625108 AAGGGGCTCTGGGGCTCTGGGGG + Intronic
1062929835 10:1345412-1345434 AAAGCCTTCTGGGAAGCTGGAGG - Intronic
1063014958 10:2066739-2066761 AAGAGCTTCTTGAACCCTGGAGG + Intergenic
1063297692 10:4824312-4824334 ATGGACTTCGGGGACTCAGGGGG - Intronic
1064397222 10:14991668-14991690 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1064400119 10:15014138-15014160 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1066390402 10:34973491-34973513 AAGGGCCTATTGAACTCTGGGGG + Intergenic
1066881626 10:40721341-40721363 AAGCGCTTCTAGGCCTATGGCGG + Intergenic
1066881852 10:40724421-40724443 AAGCGCTTCTAGGCCTATGGCGG + Intergenic
1067542261 10:47164636-47164658 AAGGGCTGCTGGGGCACTGACGG - Intergenic
1067757736 10:49017732-49017754 ATGGGTTTGTGGGGCTCTGGGGG - Exonic
1070661934 10:78312994-78313016 AAGGGCTGCTGGGCCTCCTGAGG + Intergenic
1071456511 10:85855391-85855413 AGGTGTTTCTGGGACTCTGTAGG - Intronic
1071811806 10:89190146-89190168 ATGGACTTTGGGGACTCTGGAGG - Intergenic
1072716043 10:97753224-97753246 GTGGACTTCTGGGACTCTAGTGG + Intronic
1074441046 10:113477678-113477700 AAAGGCCTTTGGGACTGTGGTGG - Intergenic
1075342949 10:121661768-121661790 AAGGGGTTCTGGGACTCTGGAGG + Intergenic
1075845527 10:125542342-125542364 TGGGGCTTCTGGGACTCTTGGGG - Intergenic
1076516978 10:131051420-131051442 AGGGGCTCCGAGGACTCTGGTGG + Intergenic
1076618302 10:131771104-131771126 TGGGGCTTCTGGAATTCTGGAGG + Intergenic
1077421410 11:2451854-2451876 AAGGGCTTCTGGGTGTCCTGAGG - Intronic
1077589034 11:3477521-3477543 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1079810348 11:24991131-24991153 AAGGACTTTGGGGACTCAGGTGG - Intronic
1081577011 11:44325127-44325149 AAGGGCTTCTGGGAGTAAGCAGG - Intergenic
1082554801 11:54551453-54551475 CAGGGCTTTGGGGACTCTGTTGG + Intergenic
1084244729 11:67849144-67849166 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1084811532 11:71614761-71614783 AAGGGCCTATTGGACTCTGGGGG + Intergenic
1084847464 11:71911683-71911705 AAGGGCCTATTGAACTCTGGGGG + Intronic
1089853704 11:121522338-121522360 AAGGCCTTCTGAGACTCTCAGGG - Intronic
1090221119 11:125026899-125026921 ATGGACTTCTGGGGCTTTGGGGG - Intronic
1092294755 12:7189408-7189430 AAGGGCTTCCCAGGCTCTGGGGG - Intronic
1092415293 12:8286289-8286311 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1092432376 12:8419890-8419912 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1093564642 12:20588309-20588331 AAGGCCCTCTGGGTCTCTGAAGG - Intronic
1095615105 12:44179417-44179439 GAGAGCTTCTGGGAGTCTGCTGG + Intronic
1096509006 12:52116856-52116878 AACGGCCTATGGAACTCTGGGGG - Intergenic
1096567834 12:52496148-52496170 AAGGGCTTCTAAGACAGTGGAGG + Intergenic
1096796381 12:54080587-54080609 AATGGCTTTTGGGACTCTCTAGG - Intergenic
1097269621 12:57765970-57765992 CAGGGCGTCTGGGCTTCTGGGGG + Intronic
1099476674 12:83116086-83116108 ATGGACTTCAGGGACTCAGGAGG - Intronic
1100647139 12:96543453-96543475 AAGGGCTGCTAGGAGACTGGGGG + Intronic
1101409414 12:104456768-104456790 GAGGGCTTTTGGGACCCTGCGGG + Intronic
1101519066 12:105464908-105464930 GATGGCTACTGGGACTCTGATGG + Intergenic
1101753470 12:107602279-107602301 AAGGTCTACTGTGATTCTGGTGG + Intronic
1102218835 12:111180639-111180661 AAGGGCCTCTGAGGATCTGGTGG + Intronic
1102467388 12:113137897-113137919 AAGGGGTCCTGGGGGTCTGGAGG - Intergenic
1102804641 12:115769004-115769026 AAGGGCTTCTGTGACTGTCAGGG + Intergenic
1103378707 12:120477294-120477316 CATGGCATCTGGGACTTTGGTGG + Intronic
1104079894 12:125420557-125420579 CTGGGCTTCTGGGCCTCTGATGG + Intronic
1104329985 12:127835724-127835746 ATGGACTTTGGGGACTCTGGAGG - Intergenic
1104415281 12:128592752-128592774 AAGGGAATCTGGGAGCCTGGGGG - Intronic
1104550416 12:129751540-129751562 AGTGCTTTCTGGGACTCTGGTGG - Intronic
1105315411 13:19255596-19255618 ATGGACTTTTGGGACTCTAGGGG + Intergenic
1105426591 13:20300098-20300120 AAGGGCTTCCGTGACTGTGTAGG - Intergenic
1106475837 13:30097190-30097212 AGGGGCTTCAGGGACACTGTGGG - Intergenic
1106488847 13:30197391-30197413 AAGGGCTTCTGGGAGACAGAAGG + Intergenic
1106796932 13:33216542-33216564 ATGGACTTTGGGGACTCTGGGGG + Intronic
1106821849 13:33473665-33473687 AAGGGCTTCTGAGACTCTCCTGG - Intergenic
1107544157 13:41421456-41421478 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1107583921 13:41823421-41823443 AAGGGCTTCTGGTTATCTTGGGG - Intronic
1108527749 13:51300274-51300296 CTGGGTGTCTGGGACTCTGGAGG - Intergenic
1109467472 13:62755867-62755889 ATGGACTTTTGGGACTTTGGGGG + Intergenic
1111459387 13:88519847-88519869 ATAGGCTTCTGGGTCTCTGATGG - Intergenic
1111623674 13:90755927-90755949 ATGGACTTCAGGGACTCAGGGGG + Intergenic
1111805785 13:93039374-93039396 AAGAGCCTCTGGGAATCTGTTGG + Intergenic
1112489365 13:99848149-99848171 AGGGGAGTCTGGGACTCGGGTGG - Intronic
1117038795 14:51751683-51751705 AAGGGCCTATCGAACTCTGGGGG + Intergenic
1117792270 14:59353541-59353563 AAGAGTTCCTGGGACTCTGAGGG + Intronic
1118719085 14:68580921-68580943 AAGGGCGGCTGGGGCTCAGGAGG + Intronic
1118760876 14:68879561-68879583 AGTGGCCTCTGGGACTCTGCTGG - Intronic
1119381659 14:74233125-74233147 GGGGGCTGCTGGGACTCTGTTGG + Intergenic
1119889514 14:78172407-78172429 AAGGGCTACTGGGTATGTGGCGG + Intergenic
1120523315 14:85549284-85549306 CAGGGCCTCTGGGACTCTGGGGG + Intronic
1120955234 14:90076312-90076334 AGAAGGTTCTGGGACTCTGGTGG - Intronic
1121691602 14:95881599-95881621 AGGAGTTTCTGGGACTCGGGAGG + Intergenic
1122297821 14:100715008-100715030 GAGGGCTGCTGTGACTCTTGTGG + Intergenic
1125174855 15:36808993-36809015 AAGGTCTTCTGGAGCTCTGCAGG - Exonic
1126332571 15:47549333-47549355 ATGGGCTTCTGGGACCCTCAGGG - Intronic
1126837294 15:52679579-52679601 TCGGGCTTCCGGGACTCTGCTGG - Intronic
1127772201 15:62241355-62241377 CAGGGCAGCTGGCACTCTGGAGG + Intergenic
1128143972 15:65322116-65322138 AAGGGCTCCTTGGACTCAAGAGG - Intergenic
1128358891 15:66946703-66946725 AAGGGATTCTGGAACTCTGGAGG + Intergenic
1129039188 15:72670961-72670983 CAGGGCAGCTGGCACTCTGGAGG - Intergenic
1129240117 15:74245925-74245947 AAGGGCTTCTGAGAATGTGAAGG + Intronic
1129524328 15:76204360-76204382 AAGCTCTCCTGGGACCCTGGAGG + Exonic
1129924600 15:79352046-79352068 ATGGGCTTTGGGGACTCGGGGGG + Intronic
1130015966 15:80186619-80186641 ATTGGCTTCTGGGATTCTGGAGG + Exonic
1130181110 15:81629477-81629499 ATGGACTTTTGGGACTCAGGGGG + Intergenic
1132521486 16:392006-392028 CTGGGCTTCAGGGGCTCTGGTGG - Intergenic
1134109121 16:11503708-11503730 GAAGGCTGCCGGGACTCTGGTGG - Intronic
1134623149 16:15705067-15705089 AAGGACTGCTGGAACTCAGGAGG - Intronic
1139484525 16:67248389-67248411 TAGGGTTTCTGGGACGTTGGGGG + Intronic
1139990639 16:70937293-70937315 AAGGCTTTCTGTAACTCTGGAGG + Intronic
1146685161 17:34836582-34836604 AAGGACTTCGGGGACTTGGGGGG + Intergenic
1146695632 17:34907471-34907493 CAGGGCTTCTCACACTCTGGTGG - Intergenic
1147736331 17:42641051-42641073 AAGGTCTTCTGGAAATATGGAGG - Intergenic
1149996942 17:61410541-61410563 AAGGCGTCCTGGGAGTCTGGGGG - Intergenic
1151281851 17:73081936-73081958 AATGGACTCTGGGAATCTGGTGG + Intronic
1153272685 18:3338715-3338737 AAGGGTTTCTAGAACTCTAGTGG + Intergenic
1154442940 18:14409020-14409042 CAGGCCCTCTGGGGCTCTGGGGG + Intergenic
1154465264 18:14637826-14637848 AAGGGATTCTGCCACCCTGGCGG + Intergenic
1155045267 18:22097769-22097791 AAGGGGATCTGGGAATTTGGAGG - Intronic
1155937804 18:31772357-31772379 ATGGGCTTCGGGGACTCCGGGGG + Intergenic
1157934390 18:51857317-51857339 AAGGGCCTCTGGGGCACTGCGGG + Intergenic
1160014911 18:75133219-75133241 ATGGGCTTCTGGGACTAAAGGGG - Intergenic
1161983243 19:7641409-7641431 AAGAGCTCCTTGGACTCTGTGGG - Intronic
1163587020 19:18169625-18169647 AGGGGCTTCCGGGACCCCGGGGG - Exonic
1163966372 19:20750816-20750838 AAGGGCCTATTGAACTCTGGGGG - Intronic
1164583926 19:29453676-29453698 AAAGGGTTCTGGAACTGTGGAGG + Intergenic
1165311126 19:35030178-35030200 AAGTCCTCCTGTGACTCTGGGGG + Intergenic
1165776141 19:38405368-38405390 AGGGGCTGCAGGGACCCTGGGGG - Exonic
1165803635 19:38567502-38567524 AGGGGGTTGTGGGAATCTGGAGG - Intronic
1166235352 19:41451776-41451798 ATGGACTTCAGGGACTCCGGGGG + Intergenic
1166976526 19:46608190-46608212 AAGGCCTCCTTGAACTCTGGGGG - Exonic
1167124492 19:47539790-47539812 AAGGGCTTCTTGGTTCCTGGGGG + Exonic
1168252564 19:55148877-55148899 TTGGGGTTCTGGGAATCTGGGGG - Intronic
925651530 2:6094520-6094542 AAGGGGTTCTGGGTAACTGGGGG + Intergenic
926244360 2:11112331-11112353 AAGGGCTTCTGGACCACTTGAGG + Intergenic
926327124 2:11795076-11795098 AAGGGCTGCTTGGATTCTGGGGG - Intronic
926650154 2:15334865-15334887 AGGAGCTTCTAGGATTCTGGTGG - Intronic
926971457 2:18471363-18471385 AAGGGTTGCTGGGATACTGGGGG + Intergenic
926975066 2:18506590-18506612 CAGGGCTTCTGGGGTTCTGTAGG - Intergenic
927211914 2:20644303-20644325 CAGGGGTTCAGGGACTCTTGGGG - Intronic
928095422 2:28401892-28401914 AATGGGTTCTGGGATACTGGAGG - Intronic
928095439 2:28402047-28402069 AATGGGTTCTGGGATTCTGGAGG - Intronic
928095452 2:28402123-28402145 AATGGGTTCTGGGATTCTGGAGG - Intronic
928095481 2:28402275-28402297 AATGGATTCTGGGATTCTGGAGG - Intronic
928106213 2:28472058-28472080 AAGTGCAAGTGGGACTCTGGGGG - Intronic
929735023 2:44538600-44538622 ATGGACTTCAGGGACTCAGGAGG + Intronic
930026537 2:47032470-47032492 AAGGGCTTCAGGAGCTGTGGAGG + Intronic
931035834 2:58241577-58241599 AAGGGCTCCTGGGACAATTGAGG - Intergenic
932349946 2:71023607-71023629 AAGGGCCTATTGAACTCTGGGGG + Intergenic
932594612 2:73086352-73086374 AATGGCCTCTTGGAATCTGGAGG - Intronic
933162414 2:79040111-79040133 ATGGGCTCCTGGGCCTCTGATGG + Intergenic
934751366 2:96796086-96796108 AGGGGCTTCTGGAACTCTTGGGG - Intronic
936371201 2:111903718-111903740 ACTGGCTTCTGGGGCTTTGGGGG + Intronic
937301214 2:120843596-120843618 CAGGGCAGCTGGGACTCTGCAGG + Intronic
937840433 2:126519273-126519295 CATGCCCTCTGGGACTCTGGGGG + Intergenic
938735743 2:134185117-134185139 ATGGACTTTGGGGACTCTGGGGG + Intronic
939452358 2:142390660-142390682 AAGGTCATCTAGGACACTGGAGG + Intergenic
940869526 2:158848384-158848406 AAGGGCCTATTGAACTCTGGGGG + Intronic
940872202 2:158869382-158869404 AAGGGCCTATTGAACTCTGGGGG + Intergenic
940874409 2:158885370-158885392 AAGGGCCTATTGAACTCTGGGGG + Intergenic
945918869 2:215734294-215734316 AAGGACTTTGGGGACTCAGGGGG - Intergenic
946022217 2:216648523-216648545 TAGGGCTTCAGGGACACTTGAGG + Intronic
946364271 2:219238875-219238897 AAGGGCTTCAGGGATCATGGAGG + Intronic
946757160 2:222959409-222959431 AAGGCCTTCTGGATCTGTGGAGG - Intergenic
947595003 2:231405528-231405550 AAGGGCCTATTGAACTCTGGGGG + Intergenic
947771349 2:232672776-232672798 ATGGGCTGTTGGGACTCTTGTGG + Intronic
948941926 2:241201027-241201049 GAGGGGTTCTGGGTATCTGGGGG + Intronic
1170091852 20:12597818-12597840 AAGAGCCTCTGGAACACTGGGGG + Intergenic
1171080121 20:22172630-22172652 ATGGACTTTGGGGACTCTGGGGG - Intergenic
1171408547 20:24930246-24930268 AAGGGCCTATTGAACTCTGGGGG + Intergenic
1171440004 20:25152650-25152672 AAGGGCCTCTGGGCTTCTGAGGG - Intergenic
1171740748 20:28883772-28883794 GAGGGCTTCAAGGCCTCTGGTGG - Intergenic
1172005906 20:31819132-31819154 AGGGGTATCTGGGACGCTGGGGG - Intergenic
1172825564 20:37780950-37780972 AAAGGCTTCTGGGGGGCTGGAGG + Intronic
1174668592 20:52284006-52284028 TTGAGCTTCTGAGACTCTGGGGG + Intergenic
1174967880 20:55239818-55239840 ATGGACTTTGGGGACTCTGGGGG - Intergenic
1176084365 20:63289367-63289389 GAGGGCTGCTTGGACCCTGGTGG + Intronic
1176230821 20:64032072-64032094 AGTGCCTTCTGGGACTGTGGCGG + Intronic
1176809276 21:13520560-13520582 AAGGGATTCTGCCACCCTGGCGG - Intergenic
1178743112 21:35221947-35221969 AAGGGAGTCTGGCACTCGGGTGG + Intronic
1179178540 21:39026218-39026240 ATGGGCTCCTGGGACTGTGAAGG + Intergenic
1179529529 21:42009582-42009604 AAGGTCTGCGGGGGCTCTGGAGG + Intronic
1179951902 21:44712919-44712941 GAGAGCTCCTGGGGCTCTGGAGG + Intergenic
1180007133 21:45028019-45028041 AGGGGCTTCTGGGGCCCAGGGGG - Intergenic
1181634077 22:24166371-24166393 AGGGGCTGACGGGACTCTGGAGG - Intronic
1181724245 22:24800502-24800524 ATGGACTTTGGGGACTCTGGGGG - Intergenic
1182267440 22:29129071-29129093 ACAGGCATCTGGGCCTCTGGAGG - Intronic
1182299364 22:29329212-29329234 CAGACCTTCAGGGACTCTGGGGG - Intronic
1183047740 22:35233659-35233681 AAGAGCTCCTGGGACACTTGGGG + Intergenic
1183723973 22:39578309-39578331 AAAGGCCTCTGGGACTCTCTGGG + Intronic
1184081306 22:42222491-42222513 CAGGGCTTCAGGGCCTATGGGGG - Intronic
1184165339 22:42724056-42724078 AAAGGCTGCTGGGGCTTTGGGGG - Intergenic
949684256 3:6549737-6549759 CATGCCTTCTGGGGCTCTGGGGG + Intergenic
950139226 3:10603872-10603894 AAGGTCTTTTGGGTCCCTGGAGG + Intronic
950163792 3:10779034-10779056 CAGGGGTGCTGGGACTCTCGAGG - Intergenic
951027505 3:17845363-17845385 AATGGCTTGTGAGACACTGGGGG - Intronic
951094602 3:18614002-18614024 ATGGACTTTTGGGACTCAGGGGG + Intergenic
952102715 3:30033650-30033672 AATGCCTTCTGGGACTCGGCAGG + Intergenic
953103438 3:39852549-39852571 AAGGACTTTGGGGACTCAGGGGG - Intronic
953622287 3:44543498-44543520 AATGGCATCTGGGACCCTGTGGG - Intergenic
955766945 3:62354855-62354877 AAGACCTGCTGGGACTCTGGAGG + Intergenic
955805885 3:62733854-62733876 ATGAGCTTTGGGGACTCTGGAGG - Intronic
956945553 3:74218485-74218507 AAGGGCTACTTGGAGGCTGGTGG - Intergenic
957076184 3:75604895-75604917 AAGGGCCTATTGAACTCTGGGGG - Intergenic
957335194 3:78818663-78818685 AAGTGCTTCTGGGAATGTGGTGG + Intronic
958633612 3:96713477-96713499 AATAGCTTAAGGGACTCTGGAGG - Intergenic
959992730 3:112646666-112646688 AAGAGTATCTGGGACTCTAGGGG - Intronic
960517062 3:118614153-118614175 ATGGGCTTTTGGGACTCAGGAGG + Intergenic
960914300 3:122681015-122681037 ATGGGCTCCTGGGATCCTGGCGG - Exonic
960949437 3:122989521-122989543 AAGGGCCTCTGGGGCTCTGAAGG + Intronic
961026020 3:123558237-123558259 AATGGCTTCCAGGGCTCTGGGGG + Intronic
961407104 3:126687383-126687405 ATGGACTTCGGGGACTCAGGGGG - Intergenic
963957812 3:151274816-151274838 AAAAGGTTCTGGGCCTCTGGTGG - Intronic
965873896 3:173293856-173293878 ATGGACTTCGGGGACTCAGGGGG - Intergenic
966470354 3:180282234-180282256 TAGGTCCTCTGGGACTCTAGTGG - Intergenic
966731120 3:183152152-183152174 AAGGGCTTCAGGGCCTCTTATGG - Intronic
969734217 4:8976213-8976235 AAGGGCCTCTTGAACTCTGGGGG + Intergenic
969789067 4:9479509-9479531 AAGGGCCTATTGAACTCTGGGGG + Intergenic
969793804 4:9510277-9510299 AAGGGCCTATTGAACTCTGGGGG + Intergenic
971232765 4:24813231-24813253 AAGAGATTCTGTGACTCAGGAGG - Intronic
975415809 4:74103143-74103165 CTGGGCTGCTGGGACTCTGGAGG - Intergenic
975670472 4:76775118-76775140 AAGGACTTCGGGGACTCAGCGGG - Intronic
976518601 4:86000758-86000780 AAGGACTCCAGGGATTCTGGTGG + Exonic
980103636 4:128566327-128566349 AAGGACTCCTGGGTTTCTGGTGG + Intergenic
981089124 4:140714401-140714423 GGGGGCTTCTGGGTCTTTGGTGG + Intronic
981351467 4:143734462-143734484 GTGGGCTTTGGGGACTCTGGGGG - Intergenic
984098023 4:175455284-175455306 CATGCCTTCTGGGGCTCTGGGGG - Intergenic
985142209 4:186852821-186852843 AAGGATTTCTGGGAGGCTGGGGG + Intergenic
985496537 5:210041-210063 TGGAGCTTCTGGGACTCTGTTGG - Intronic
985586446 5:740106-740128 ATGGGCTTTTGGGACTCAGGGGG + Intronic
985601034 5:832283-832305 ATGGGCTTTTGGGACTCAGGGGG + Intronic
985820383 5:2156090-2156112 GATGGCTTCTGTGACTCCGGGGG + Intergenic
985884742 5:2668821-2668843 CAGGGCCTCTGGGAGCCTGGGGG - Intergenic
986233252 5:5885779-5885801 AAGGTCTTGGGGGACCCTGGAGG + Intergenic
987130814 5:14858272-14858294 AAGGACTTTGGGGGCTCTGGGGG - Intronic
994282801 5:97926169-97926191 AAGGACTTTGGGGACTCAGGGGG - Intergenic
998606137 5:143636517-143636539 TAGGGCTTATTGGACTTTGGGGG + Intergenic
998811414 5:145970284-145970306 ATGGTCTTTGGGGACTCTGGGGG - Intronic
999677878 5:154023602-154023624 ATGGGCTTCGGGGACTCAGGGGG + Intronic
999793297 5:154963856-154963878 ATAGGCTTTTGGGAGTCTGGAGG + Intronic
999930352 5:156425723-156425745 AAGGACTTTAGGGACTCGGGGGG - Intronic
1000050792 5:157561468-157561490 AAGGGCTTCTGGGACTCTGGGGG - Intronic
1000403636 5:160862099-160862121 AAAGGATTTTGGGACTATGGTGG + Intergenic
1001444810 5:171774962-171774984 AAGGGATGCCGGGCCTCTGGTGG + Intergenic
1005814481 6:29539668-29539690 AAAGGCTTCTTGGACTCCTGAGG + Intergenic
1006519801 6:34564709-34564731 AGGGGCTGCTGAGACTCTGAGGG - Intergenic
1006880466 6:37334392-37334414 AAAGGATTCTGGTACTATGGAGG + Intergenic
1007019377 6:38504008-38504030 AAGGGGTTGTGAGACTGTGGCGG - Intronic
1009627893 6:66160508-66160530 AAGGGCTTCTGGGCATCAGCAGG + Intergenic
1012135059 6:95545341-95545363 AAGGGCTGTTTGGATTCTGGAGG - Intergenic
1012207913 6:96483921-96483943 ATGGGCTTTGGGGACTCAGGGGG - Intergenic
1013483771 6:110575744-110575766 CAGGGAGTCTGGGACTCTGTTGG + Intergenic
1018536821 6:164829048-164829070 AAGGGTCTCTGGGACTCTCAAGG - Intergenic
1019017541 6:168890801-168890823 GAGGGCTTCAGGGGCTCAGGAGG + Intergenic
1019785762 7:2976362-2976384 CAGGGCTTCAGGGACTGTGAAGG - Intronic
1020307021 7:6843222-6843244 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1020311497 7:6872066-6872088 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1020323065 7:6954404-6954426 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1022451395 7:30518751-30518773 AAGGGGTTCTGTGACCCAGGAGG - Intronic
1023527469 7:41119559-41119581 ATGGACTTTTGGGACTTTGGGGG - Intergenic
1023940631 7:44766529-44766551 AAGGACTGCCGGGACGCTGGGGG - Exonic
1024006959 7:45231652-45231674 GAGAGCTTCAGGGACCCTGGAGG + Intergenic
1024225409 7:47322761-47322783 TAGGGCTTCTGTGATTCTGCGGG - Intronic
1024641731 7:51334516-51334538 AAGGGCTTCTTGGATTTTGGAGG - Intergenic
1026293889 7:69034340-69034362 ATGGACTTGGGGGACTCTGGAGG + Intergenic
1028490114 7:91401714-91401736 ATGGACTTTGGGGACTCTGGGGG - Intergenic
1028529172 7:91819154-91819176 ATGGACTTTGGGGACTCTGGGGG - Intronic
1029078175 7:97952166-97952188 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1029420627 7:100469971-100469993 AAGGGCATCTGGGACTCTTGGGG + Intronic
1029530497 7:101122162-101122184 AAGGGATTCTGGGATTCCAGAGG + Intergenic
1029607363 7:101606899-101606921 AGGGACTTATGGCACTCTGGGGG + Intergenic
1030721666 7:112878436-112878458 AAGGGCTTCTGAGACTCCTAGGG + Intronic
1032268732 7:130385438-130385460 AAGGGTGTCAGGTACTCTGGAGG - Intronic
1033162380 7:139009136-139009158 AGGGGCTTCTGGGTCACAGGTGG - Intergenic
1033238177 7:139655057-139655079 AAGGGCTGCTCTGACTGTGGGGG + Intronic
1033452938 7:141477680-141477702 AGGGGCTTCCAGGGCTCTGGGGG + Exonic
1033634863 7:143202729-143202751 ATGGGCCTCTGGGAATGTGGTGG - Intergenic
1034462194 7:151204240-151204262 AAGGGCTTCAGGAACCTTGGCGG - Intronic
1035219503 7:157397456-157397478 CAGGGCTTCTGGGAATCTTTTGG + Intronic
1035917710 8:3643379-3643401 AAGGCACTCAGGGACTCTGGAGG - Intronic
1036239833 8:7072337-7072359 AAGGGCCTATTGAACTCTGGGGG + Intergenic
1036372999 8:8176578-8176600 AAGGGCTTATTGAACTCTGGGGG + Intergenic
1036877906 8:12489063-12489085 AAGGGCTTATTGAACTCTGGGGG - Intergenic
1036903500 8:12689228-12689250 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1038799128 8:30733386-30733408 AAGGGCCTATTGAACTCTGGGGG + Intronic
1039991482 8:42491726-42491748 AAGGGTTTCTGAGACTGTGTTGG - Intronic
1040288653 8:46113177-46113199 ACGGGCCGCTGGGACTCAGGGGG - Intergenic
1040289192 8:46115721-46115743 GAGGGCCGCTGGGACTCAGGGGG - Intergenic
1040292105 8:46130815-46130837 ACAGGCTGCAGGGACTCTGGAGG - Intergenic
1040300858 8:46187335-46187357 GAGGGCTGCAGGGACTCAGGGGG - Intergenic
1040308738 8:46225666-46225688 ACGGGCTGCAGGGACTCAGGGGG + Intergenic
1040333670 8:46405191-46405213 AAGGGCTTCAGGGGCTCAGATGG + Intergenic
1040337654 8:46424206-46424228 GTGGGCTGCAGGGACTCTGGGGG + Intergenic
1041008988 8:53523228-53523250 AAGGGCCTGTTGAACTCTGGGGG - Intergenic
1041705578 8:60843287-60843309 CAGGGCTTTTGGGACGCAGGGGG - Intronic
1044908393 8:97029855-97029877 CAAGGCTTCTGGGAATATGGCGG - Intronic
1045398857 8:101790947-101790969 AAAGGCTTGTGAGAATCTGGTGG - Intronic
1046634044 8:116652256-116652278 AAAGTCTTCTGTGACTTTGGAGG + Intronic
1046646488 8:116791492-116791514 ACGGACTTTGGGGACTCTGGGGG - Intronic
1046740339 8:117820826-117820848 AAGAGATTCTGGGAATATGGAGG - Intronic
1049473691 8:142787363-142787385 GAGGGCTTCTGGGGCCCTGGAGG - Intergenic
1049615763 8:143575249-143575271 CAGGGCTCCTGGGCCCCTGGAGG + Exonic
1049784314 8:144443378-144443400 CAGGGTCTCTGGGAATCTGGCGG - Intronic
1050698615 9:8309258-8309280 AAGGGGTTCTGGGAAGGTGGTGG - Intergenic
1051091833 9:13418860-13418882 AATGTCTTCAGGGACTATGGAGG - Intergenic
1052862758 9:33447058-33447080 CTGGGATTCTGGGAATCTGGAGG + Intronic
1056917169 9:90756062-90756084 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1058530562 9:105901625-105901647 AGGGGCATGTGTGACTCTGGGGG - Intergenic
1058531122 9:105905500-105905522 ATGGACTTTGGGGACTCTGGGGG - Intergenic
1058564033 9:106261369-106261391 TAGGGCTTGTGGGACAGTGGGGG - Intergenic
1060011342 9:120045213-120045235 AAGGGAGGCTGGGACACTGGGGG + Intergenic
1060477757 9:123998938-123998960 AGGGGCTTTAGGGACCCTGGAGG + Intergenic
1061614650 9:131771963-131771985 AATGGCTTCTGGCCCTCTGTGGG + Intergenic
1062224082 9:135439214-135439236 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1185502868 X:611905-611927 AAGGGGTTATGAGACCCTGGAGG - Intergenic
1185780194 X:2837126-2837148 CGAGGCTTCTGGGACTCTTGGGG + Intronic
1185887289 X:3794063-3794085 AATGGACTCTGGGACTCAGGGGG - Intergenic
1186847148 X:13542149-13542171 ATGGACTTTGGGGACTCTGGGGG + Intergenic
1187719768 X:22138463-22138485 AAGGGGTCCTGGGAGTCTAGGGG + Intronic
1188732957 X:33674568-33674590 ATGGACTTCTGGGACTTGGGAGG - Intergenic
1189153710 X:38733659-38733681 GAGGACTTCTGGGACTGTGGTGG + Intergenic
1191119260 X:56886491-56886513 GAGGGCTTCTGAGACTCTCTTGG + Intergenic
1191794734 X:65009197-65009219 AAGAGCTTGTGGGAGTCTGCAGG - Intronic
1191950345 X:66584471-66584493 ATGGACTTTAGGGACTCTGGTGG - Intergenic
1193397831 X:81006296-81006318 GTGGACTTCGGGGACTCTGGGGG - Intergenic
1194264125 X:91734342-91734364 ATGGGCTTTAGGAACTCTGGGGG - Intergenic
1196005080 X:110828189-110828211 ATGGGCTTCGGGGACTCAAGGGG + Intergenic
1197450232 X:126604342-126604364 AAAGGCTTCTGGAATTTTGGTGG - Intergenic
1197730451 X:129805153-129805175 AAGTGGCTCTGGGACTCTGCCGG + Exonic
1197804487 X:130385796-130385818 TGGTGCTTCAGGGACTCTGGAGG + Intergenic
1197853972 X:130895007-130895029 AAGGTGTTCTGGGAATATGGAGG - Intronic
1199488001 X:148369401-148369423 ATGGTCTTTGGGGACTCTGGGGG + Intergenic
1200067147 X:153509391-153509413 ACCGGTGTCTGGGACTCTGGCGG - Exonic
1200948291 Y:8867426-8867448 AAGGGCCTATAGAACTCTGGGGG + Intergenic