ID: 1000051037

View in Genome Browser
Species Human (GRCh38)
Location 5:157563143-157563165
Sequence GTCTAGGGACGCAGCTGGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 138
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 128}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000051033_1000051037 -6 Left 1000051033 5:157563126-157563148 CCAATAGACGCTGCACTGTCTAG 0: 1
1: 0
2: 0
3: 1
4: 48
Right 1000051037 5:157563143-157563165 GTCTAGGGACGCAGCTGGCCAGG 0: 1
1: 0
2: 0
3: 9
4: 128
1000051029_1000051037 27 Left 1000051029 5:157563093-157563115 CCAAAGGAAGACAATGCAAGGAA 0: 1
1: 0
2: 4
3: 49
4: 374
Right 1000051037 5:157563143-157563165 GTCTAGGGACGCAGCTGGCCAGG 0: 1
1: 0
2: 0
3: 9
4: 128
1000051032_1000051037 0 Left 1000051032 5:157563120-157563142 CCAGGGCCAATAGACGCTGCACT 0: 1
1: 0
2: 0
3: 9
4: 45
Right 1000051037 5:157563143-157563165 GTCTAGGGACGCAGCTGGCCAGG 0: 1
1: 0
2: 0
3: 9
4: 128

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000051037 Original CRISPR GTCTAGGGACGCAGCTGGCC AGG Intronic
900505581 1:3028537-3028559 GTCTAGGCACACAGCTGACTTGG + Intergenic
900582085 1:3414351-3414373 GTCTAGGGGTGCAGGTGGGCTGG + Intronic
902348694 1:15837333-15837355 GTCTAGGGAGGCGGCTAGGCGGG - Intergenic
902403836 1:16172506-16172528 GGCTAGGGACGGAGGGGGCCTGG - Intergenic
905232913 1:36526222-36526244 GTAAAGGGAAACAGCTGGCCGGG - Intergenic
907519615 1:55014647-55014669 GTCAATGGACCCAGCTGGGCTGG + Intergenic
911128973 1:94369903-94369925 GTCTACAGAGGCAGCAGGCCTGG + Intergenic
918185255 1:182121128-182121150 GTCTAGGGGAGGAGCTGCCCTGG + Intergenic
918313825 1:183306100-183306122 TTCTAGGGAACCAGCTGTCCAGG + Intronic
920822884 1:209397964-209397986 GTCTCGGCACCCAGCAGGCCTGG + Intergenic
921133041 1:212236137-212236159 GCCTAGGGAAGCTGCAGGCCTGG - Intergenic
922814108 1:228437049-228437071 GTCTGGGGAAGCTGGTGGCCAGG + Intergenic
924726299 1:246674405-246674427 TTCTTGGGACGCAGCAGCCCTGG - Intergenic
1063462480 10:6223375-6223397 GTCTAGGGATTCAGCTGCACTGG - Intronic
1063547320 10:6993849-6993871 GTCTATGGCCGCTGCTGGCTGGG + Intergenic
1068658366 10:59596990-59597012 CTCTATGGACAGAGCTGGCCTGG - Intergenic
1075398917 10:122147810-122147832 GTCTTGGCAGGCAGCTGGCCAGG - Intronic
1076439129 10:130467518-130467540 TTCAAGGGAAGCAGCTGGGCTGG + Intergenic
1076529117 10:131132877-131132899 GTCTAGGGCCGCACGTGGCAGGG - Intronic
1081113103 11:39161773-39161795 CTCTAGGGCCGCGGCGGGCCCGG - Intergenic
1083854621 11:65386644-65386666 CGCTAAGGACGCAGCTGACCGGG - Exonic
1085258642 11:75191574-75191596 GGCTAGGGAACCAGCTGGCTTGG + Intronic
1085883963 11:80500373-80500395 GTCTAGTGGCTCTGCTGGCCTGG - Intergenic
1090612525 11:128484211-128484233 GACCAGGGACGGAGGTGGCCAGG - Intronic
1091670231 12:2447280-2447302 GTTTAGGGAGGCAGCTGCCTTGG - Intronic
1091916180 12:4272973-4272995 GTCTAGGGCCGCCGCAGGCCGGG - Intergenic
1095938907 12:47712937-47712959 CTCTTGGGAAGCAGCTGGCCAGG + Intronic
1095970131 12:47896001-47896023 GGCTCTGGAGGCAGCTGGCCTGG + Intronic
1096489840 12:52007379-52007401 GTCGAGGCACCCAGCGGGCCGGG - Intronic
1096520621 12:52182668-52182690 GTTGAGGGAGACAGCTGGCCTGG + Intronic
1097107327 12:56633456-56633478 AGCTAGGGGCGCAGCTGGACTGG + Intronic
1097158538 12:57029586-57029608 GTCTAGGGACGGAACAGGCAAGG + Exonic
1106478108 13:30115135-30115157 GTCTGGGGACGCAGCGCTCCGGG - Intergenic
1115636258 14:35292638-35292660 GTCTGGGGCCGAAGCTGGGCTGG + Intronic
1118687637 14:68307088-68307110 GTCTTGGGAGGCGGCTGGACTGG + Intronic
1118921476 14:70153320-70153342 GTCTAAGGACACAGCTTGCATGG + Intronic
1122357229 14:101131047-101131069 CGGTAGGGACGGAGCTGGCCAGG - Intergenic
1122867019 14:104610959-104610981 GTCACTGGAAGCAGCTGGCCTGG + Intergenic
1123735554 15:23179935-23179957 GACTGGGGGCGCGGCTGGCCGGG - Intergenic
1124286270 15:28402918-28402940 GACTGGGGGCGCGGCTGGCCGGG - Intergenic
1124296433 15:28508718-28508740 GACTGGGGGCGCGGCTGGCCGGG + Intergenic
1128384128 15:67135076-67135098 TGCTAGGGACAGAGCTGGCCTGG + Intronic
1129585872 15:76864010-76864032 TTCTAGGGGCTCAGCTGGGCTGG - Intronic
1132855070 16:2041068-2041090 GGCTGGGGCTGCAGCTGGCCGGG - Intronic
1133749552 16:8713768-8713790 GGCCAGGAACGCAGCTGGCTGGG - Exonic
1139952117 16:70677581-70677603 GTCTGAGAACGCTGCTGGCCAGG + Intronic
1140456327 16:75107652-75107674 CTCTTGGGATGCAGCTGCCCTGG + Intronic
1141540143 16:84713839-84713861 CTCTTGGGACCCTGCTGGCCTGG - Intronic
1141590443 16:85065285-85065307 GGCCGGGGACGCAGCTGGCGAGG + Intronic
1142410566 16:89913822-89913844 GTCTGTGGCCGCAGCTGGACAGG + Intronic
1142947958 17:3450257-3450279 GTCTAGGTACACTGCTGACCAGG + Intronic
1143632588 17:8147518-8147540 GTCCAGGGAGGGAGCTGGGCTGG + Exonic
1143705390 17:8694350-8694372 GTCTACTGAGGCATCTGGCCTGG - Intergenic
1145004282 17:19328714-19328736 GTCAATGGAGGCAGCTGGCTTGG - Exonic
1148873946 17:50675610-50675632 GTCTGTGGAGGCAGCTGGTCAGG - Exonic
1152068969 17:78125883-78125905 GCCTATGGAGGCAGCTGGGCAGG + Exonic
1159889354 18:73939648-73939670 GTCTAAGGACACACCTGGGCTGG + Intergenic
1161218080 19:3104696-3104718 GGCTAGGGATGCAGGTGGGCAGG + Intronic
1163250103 19:16121744-16121766 GTTTAGGGACACAGCCGGTCAGG + Exonic
1165454399 19:35902378-35902400 GACCAGGGAGGCTGCTGGCCTGG - Intergenic
1165767884 19:38362135-38362157 GTCTGGGGATGCCGCTTGCCTGG + Intronic
1168326655 19:55542148-55542170 GTCTAGCCAGCCAGCTGGCCAGG + Intronic
1168686154 19:58350760-58350782 GGCGAGGGAGGAAGCTGGCCAGG - Intronic
934655483 2:96115055-96115077 GTCGACGGGCGCAGCTGACCCGG - Exonic
935982161 2:108638319-108638341 GGGTAGGGACGCAGCTCACCAGG + Intronic
937092810 2:119217770-119217792 GTCTAGGGGCACAGCTACCCAGG - Intergenic
937500369 2:122471932-122471954 GTCAAGGAAAGCAGCTGCCCTGG - Intergenic
939949366 2:148450517-148450539 GTCTAGGGCCTCAGCTGGACTGG + Intronic
944493619 2:200283840-200283862 ATCAAGGGACACAGCTAGCCTGG + Intergenic
946158796 2:217823559-217823581 GTCTAGAGAGGCCTCTGGCCTGG - Intronic
947554933 2:231083562-231083584 GCCAGGGGAAGCAGCTGGCCTGG + Exonic
947666448 2:231908948-231908970 GTCTAGGGAAACGGCTGTCCAGG + Intergenic
1171328603 20:24318009-24318031 GTCCAGGGACACAGATAGCCAGG - Intergenic
1172838111 20:37886033-37886055 GGCCAGGCACGGAGCTGGCCGGG + Intergenic
1175259225 20:57664219-57664241 GTCCCGGGACTCACCTGGCCTGG + Intronic
1181846567 22:25714765-25714787 GTCTATGGAGACAGGTGGCCGGG + Intronic
1182453418 22:30434432-30434454 GGCAAGGGAGGCAGCTGGCCCGG + Intergenic
1184894505 22:47399353-47399375 GTCTGGTGACCCTGCTGGCCAGG - Intergenic
1184957749 22:47903023-47903045 GTCTAGAGTGGCAGCTGCCCTGG + Intergenic
949862237 3:8516216-8516238 GTCTGGGGAAGCGGTTGGCCTGG + Intronic
953219033 3:40950883-40950905 GTCTAGAGAGGCAGTAGGCCTGG + Intergenic
954852805 3:53617772-53617794 AGCTAGGGACGCAGCTGGGGAGG + Intronic
956670595 3:71685918-71685940 TTCTAGGGAGGCAGATGGGCTGG + Intronic
956794939 3:72709379-72709401 TTTTAGGGACGAAGCTGACCTGG + Intergenic
962987029 3:140545331-140545353 GGCTGGGGAAGCTGCTGGCCAGG + Intronic
965699249 3:171442709-171442731 GTTTAGGTACCCAGCTGGTCAGG + Intronic
967199275 3:187057906-187057928 GTCTACAGAGGCAGCAGGCCTGG + Intronic
968090842 3:195897293-195897315 GTCTGGGGAGGAGGCTGGCCAGG + Intronic
968512597 4:1002190-1002212 GTCTCGGGAGGAAGGTGGCCGGG - Intronic
968608960 4:1548401-1548423 GTCCAGGGAAGCAGCTTGCCGGG + Intergenic
981093679 4:140757333-140757355 GTCTAGGGATAAAGCTGCCCTGG - Intergenic
982059549 4:151591125-151591147 GGTTAGGGACGGAGCAGGCCAGG + Intronic
985511351 5:315864-315886 GTCTAGGGAGGCACCCGGCGTGG - Intronic
985816901 5:2134054-2134076 GTTTGGGGACCCAGCTGGCTGGG + Intergenic
989178869 5:38556680-38556702 GGCTGGGGGCGCAGCGGGCCCGG + Intronic
990003923 5:50923438-50923460 GTCCAGGGAAGCAGCTTGCCGGG - Intergenic
991216935 5:64166091-64166113 GGCTAGGGTTGCCGCTGGCCTGG + Intronic
999944597 5:156581532-156581554 GTCTACAGAGGCAGCAGGCCTGG + Intronic
1000051037 5:157563143-157563165 GTCTAGGGACGCAGCTGGCCAGG + Intronic
1001399340 5:171437438-171437460 GAGAAGGGAGGCAGCTGGCCCGG - Intronic
1001694658 5:173661001-173661023 GCCTAGGGCTGCAGCTGGCATGG + Intergenic
1002533430 5:179863078-179863100 ATGGAGGGACTCAGCTGGCCTGG + Exonic
1009967398 6:70592088-70592110 GTCAAGGGGCACATCTGGCCAGG - Intergenic
1013145041 6:107381112-107381134 CACTGGGGATGCAGCTGGCCAGG - Intronic
1013156025 6:107491219-107491241 CTCTCGGGCCGCAGCTCGCCGGG - Intronic
1015718280 6:136214333-136214355 GGCTCTGGACCCAGCTGGCCTGG - Intergenic
1019466753 7:1193885-1193907 GTCTGGGGAGACAGCTGCCCTGG - Intergenic
1023027276 7:36062131-36062153 GTCTTGTAAGGCAGCTGGCCTGG - Intergenic
1033230815 7:139596001-139596023 CTCTAGGGATGCAGAAGGCCAGG + Intronic
1034222554 7:149457966-149457988 GTCAACTGAGGCAGCTGGCCAGG + Intronic
1035252886 7:157608673-157608695 GTGAAGGGAAGCAGGTGGCCTGG + Intronic
1035547718 8:496575-496597 GTGTTGGGACACAGCAGGCCTGG - Intronic
1039435338 8:37556081-37556103 GACTAGGGTCACACCTGGCCAGG + Intergenic
1041083510 8:54235658-54235680 GTCTAGAGACACTCCTGGCCAGG + Intergenic
1041244804 8:55879990-55880012 GTATGGGGAGGCTGCTGGCCGGG - Exonic
1043068983 8:75614100-75614122 GACTAGGGATGCAGGTGACCAGG - Intergenic
1043938844 8:86173996-86174018 GTCTACAGAGGCAGCAGGCCTGG + Intergenic
1045547547 8:103141442-103141464 GGCTGGGTACGCAGGTGGCCAGG - Intronic
1046380072 8:113438294-113438316 GCCAAGGGACAAAGCTGGCCAGG - Intergenic
1049582915 8:143420911-143420933 GTCCAGGGAGGTCGCTGGCCCGG - Intronic
1049779498 8:144422365-144422387 GTCAAGGGGGGCAGGTGGCCAGG - Intergenic
1051080303 9:13286320-13286342 GACAAGGCATGCAGCTGGCCTGG - Intergenic
1057030484 9:91771211-91771233 GTCGAGAGACACAGCTCGCCGGG + Intronic
1057739113 9:97696818-97696840 GTTTAGGGATGCAGCCGCCCCGG - Intronic
1060207303 9:121689643-121689665 TTCCAGGCACCCAGCTGGCCCGG - Intronic
1060788416 9:126468623-126468645 GGCGAGGGACGCTGGTGGCCCGG - Intronic
1061020208 9:128009390-128009412 GTCAAGGAACATAGCTGGCCCGG + Intergenic
1061724738 9:132575902-132575924 GCCTAGGGAGGCAGCTGGTCTGG + Intergenic
1062042240 9:134409446-134409468 GCCTCGGGAGGAAGCTGGCCCGG - Intronic
1062279243 9:135744625-135744647 GTGTAGGGACGGGGCTGGCCAGG + Intronic
1062523690 9:136969882-136969904 CTCTGGGGCAGCAGCTGGCCTGG - Exonic
1187565414 X:20444737-20444759 GTCTGGGGAGGGTGCTGGCCAGG + Intergenic
1188864966 X:35303599-35303621 GTCTAGGAATACAGCTAGCCAGG + Intergenic
1189320225 X:40083268-40083290 GTCGAGGGAGGTGGCTGGCCCGG + Intronic
1190246964 X:48696997-48697019 GCCTCGGAACGCAGCGGGCCTGG + Intronic
1192815462 X:74586101-74586123 GAGTAGGTACGCAGTTGGCCTGG - Exonic
1193819858 X:86148421-86148443 GTCTGGGGCCGCAGCGGGTCGGG + Intergenic
1200788112 Y:7276171-7276193 CTCTAGGGACCAAGCTGGCTGGG + Intergenic