ID: 1000052662

View in Genome Browser
Species Human (GRCh38)
Location 5:157575843-157575865
Sequence CAGCCCCGCGGGCCTCCGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 336
Summary {0: 1, 1: 0, 2: 2, 3: 47, 4: 286}

Found 14 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000052648_1000052662 17 Left 1000052648 5:157575803-157575825 CCCACCCGGCTCCCAGCCCTCTG 0: 1
1: 0
2: 4
3: 58
4: 510
Right 1000052662 5:157575843-157575865 CAGCCCCGCGGGCCTCCGCCAGG 0: 1
1: 0
2: 2
3: 47
4: 286
1000052651_1000052662 12 Left 1000052651 5:157575808-157575830 CCGGCTCCCAGCCCTCTGCCGAG 0: 1
1: 0
2: 4
3: 59
4: 461
Right 1000052662 5:157575843-157575865 CAGCCCCGCGGGCCTCCGCCAGG 0: 1
1: 0
2: 2
3: 47
4: 286
1000052654_1000052662 1 Left 1000052654 5:157575819-157575841 CCCTCTGCCGAGACGCTCCGCCT 0: 1
1: 0
2: 0
3: 4
4: 82
Right 1000052662 5:157575843-157575865 CAGCCCCGCGGGCCTCCGCCAGG 0: 1
1: 0
2: 2
3: 47
4: 286
1000052644_1000052662 27 Left 1000052644 5:157575793-157575815 CCCGCGCCTCCCCACCCGGCTCC 0: 1
1: 1
2: 6
3: 98
4: 1013
Right 1000052662 5:157575843-157575865 CAGCCCCGCGGGCCTCCGCCAGG 0: 1
1: 0
2: 2
3: 47
4: 286
1000052643_1000052662 28 Left 1000052643 5:157575792-157575814 CCCCGCGCCTCCCCACCCGGCTC 0: 1
1: 0
2: 9
3: 52
4: 686
Right 1000052662 5:157575843-157575865 CAGCCCCGCGGGCCTCCGCCAGG 0: 1
1: 0
2: 2
3: 47
4: 286
1000052645_1000052662 26 Left 1000052645 5:157575794-157575816 CCGCGCCTCCCCACCCGGCTCCC 0: 1
1: 2
2: 8
3: 175
4: 1410
Right 1000052662 5:157575843-157575865 CAGCCCCGCGGGCCTCCGCCAGG 0: 1
1: 0
2: 2
3: 47
4: 286
1000052650_1000052662 13 Left 1000052650 5:157575807-157575829 CCCGGCTCCCAGCCCTCTGCCGA 0: 1
1: 0
2: 4
3: 40
4: 438
Right 1000052662 5:157575843-157575865 CAGCCCCGCGGGCCTCCGCCAGG 0: 1
1: 0
2: 2
3: 47
4: 286
1000052653_1000052662 5 Left 1000052653 5:157575815-157575837 CCAGCCCTCTGCCGAGACGCTCC 0: 1
1: 0
2: 0
3: 14
4: 130
Right 1000052662 5:157575843-157575865 CAGCCCCGCGGGCCTCCGCCAGG 0: 1
1: 0
2: 2
3: 47
4: 286
1000052656_1000052662 -6 Left 1000052656 5:157575826-157575848 CCGAGACGCTCCGCCTCCAGCCC 0: 1
1: 0
2: 1
3: 22
4: 295
Right 1000052662 5:157575843-157575865 CAGCCCCGCGGGCCTCCGCCAGG 0: 1
1: 0
2: 2
3: 47
4: 286
1000052649_1000052662 16 Left 1000052649 5:157575804-157575826 CCACCCGGCTCCCAGCCCTCTGC 0: 1
1: 0
2: 11
3: 114
4: 800
Right 1000052662 5:157575843-157575865 CAGCCCCGCGGGCCTCCGCCAGG 0: 1
1: 0
2: 2
3: 47
4: 286
1000052646_1000052662 21 Left 1000052646 5:157575799-157575821 CCTCCCCACCCGGCTCCCAGCCC 0: 1
1: 0
2: 14
3: 228
4: 2010
Right 1000052662 5:157575843-157575865 CAGCCCCGCGGGCCTCCGCCAGG 0: 1
1: 0
2: 2
3: 47
4: 286
1000052647_1000052662 18 Left 1000052647 5:157575802-157575824 CCCCACCCGGCTCCCAGCCCTCT 0: 1
1: 0
2: 7
3: 86
4: 890
Right 1000052662 5:157575843-157575865 CAGCCCCGCGGGCCTCCGCCAGG 0: 1
1: 0
2: 2
3: 47
4: 286
1000052655_1000052662 0 Left 1000052655 5:157575820-157575842 CCTCTGCCGAGACGCTCCGCCTC 0: 1
1: 0
2: 0
3: 5
4: 113
Right 1000052662 5:157575843-157575865 CAGCCCCGCGGGCCTCCGCCAGG 0: 1
1: 0
2: 2
3: 47
4: 286
1000052652_1000052662 6 Left 1000052652 5:157575814-157575836 CCCAGCCCTCTGCCGAGACGCTC 0: 1
1: 0
2: 0
3: 3
4: 123
Right 1000052662 5:157575843-157575865 CAGCCCCGCGGGCCTCCGCCAGG 0: 1
1: 0
2: 2
3: 47
4: 286

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000052662 Original CRISPR CAGCCCCGCGGGCCTCCGCC AGG Intergenic
900103659 1:973275-973297 CAGGGCCGCGGCCCTCTGCCCGG - Exonic
900578249 1:3394640-3394662 CTGCCCCACGGGCATCAGCCAGG + Intronic
900633338 1:3650131-3650153 CAGCGCCGCCGGCTTCCGCGCGG + Intronic
900997762 1:6131652-6131674 CATCACCGGGGGCCTCCGGCAGG - Exonic
901886970 1:12230180-12230202 CGGACCCGCGGGCCGCCGCTAGG + Intronic
903466253 1:23554525-23554547 CAGGCCCGCTGGGCTCCTCCGGG - Intergenic
903692416 1:25183873-25183895 CAGCCCCGCGGACCTGCCCATGG + Intergenic
903788057 1:25874706-25874728 TAGCCCCACAGGCCTCCTCCAGG + Intergenic
904445754 1:30571873-30571895 CATCCCCTAGGGCCTCTGCCTGG + Intergenic
907540876 1:55214896-55214918 TCGCCCCGCGGGCCCCCGCCGGG + Exonic
907671464 1:56477907-56477929 CCTCCCCGCGGGGCTCTGCCGGG - Intergenic
910788138 1:91022157-91022179 CACCCCCGCGGCCCGCAGCCCGG - Exonic
912263366 1:108131009-108131031 CAGCCACACGGGCCTCCTGCAGG + Intergenic
912416250 1:109509821-109509843 CGACCCCGCGCGCGTCCGCCCGG - Intergenic
912804909 1:112748055-112748077 CAGCCCCTCAGGTCTCCGCGAGG + Intergenic
912910951 1:113759033-113759055 TTGCCCCGCGGGCCGGCGCCCGG + Exonic
913680798 1:121186051-121186073 CAGCCCCCTGGGCCTCGTCCGGG + Intronic
914032631 1:143973693-143973715 CAGCCCCCTGGGCCTCGTCCGGG + Intergenic
914156815 1:145094274-145094296 CAGCCCCCTGGGCCTCGTCCGGG - Intronic
914490242 1:148146971-148146993 CCGCCCCCCGGCCCCCCGCCTGG - Intronic
914802970 1:150974185-150974207 CAACCCCGCGGGCCGCTGCCAGG + Intronic
917817511 1:178725535-178725557 CAGCCCCGGGGCCCGCGGCCGGG - Intronic
918040754 1:180912771-180912793 CGGCCCCGCGGGGCTCCGGGCGG + Intergenic
919464989 1:197915944-197915966 CAGACCCGCTTCCCTCCGCCCGG - Intronic
920013737 1:202888827-202888849 CCGCCCCTCGGGCCTCAGCTCGG - Intronic
920204718 1:204283077-204283099 CAGCCCAGCTGTCCGCCGCCGGG + Intronic
920333289 1:205227850-205227872 CAGCCCCGCGGGCTTCCCATTGG + Intergenic
920468111 1:206204577-206204599 CAGCCCCCTGGGCCTCGTCCGGG + Intronic
920668723 1:207986480-207986502 CAGCCCCGCCGGCCTGGTCCAGG + Intergenic
922775029 1:228210687-228210709 CAGCCCAGCTGGTCTCAGCCTGG + Intronic
923171698 1:231422373-231422395 CCGCCCCTCGGCCCTCCCCCCGG - Exonic
924624817 1:245689020-245689042 GCACCCCGCGGGGCTCCGCCGGG + Intronic
1062799283 10:367896-367918 CAGCCCCAGGTGCCTCCGACGGG + Intronic
1062799301 10:367954-367976 CAGCCCCAGGTGCCTCCGACGGG + Intronic
1062799318 10:368012-368034 CAGCCCCAGGTGCCTCCGACGGG + Intronic
1062799335 10:368070-368092 CAGCCCCAGGTGCCTCCGACGGG + Intronic
1062799352 10:368128-368150 CAGCCCCAGGTGCCTCCGACGGG + Intronic
1062799369 10:368186-368208 CAGCCCCAGGTGCCTCCGACGGG + Intronic
1063382718 10:5596298-5596320 AAGCCCCGAGGGCCCCAGCCTGG - Intergenic
1065186314 10:23173749-23173771 CGGCCCCGCGCGCCCCCTCCCGG - Intergenic
1065483856 10:26217890-26217912 AACCCCCGCGGGCCGCCGCCCGG + Exonic
1067084210 10:43229597-43229619 CTGCCCCGCGGCCTTGCGCCTGG + Intronic
1067498088 10:46776368-46776390 CAGCTGCGCGGGCCCCCGCCTGG - Intergenic
1067596558 10:47564046-47564068 CAGCTGCGCGGGCCCCCGCCTGG + Intergenic
1067686076 10:48466638-48466660 CGGCCGCGCGGGCCTACTCCGGG - Intronic
1072946675 10:99816638-99816660 CAACCCCGTGGGCCTCAGACTGG + Intronic
1074169666 10:110919792-110919814 CGGCCCCTCGGGCCTCGCCCCGG - Intronic
1074539312 10:114351571-114351593 CAGCCTCGCGTGCCTCCCCCCGG - Intronic
1074585916 10:114767962-114767984 CAGCCGCGCCGGCCCCAGCCCGG - Intergenic
1074923714 10:118046487-118046509 CACCCCCGCAGCCCTCCGCCCGG - Exonic
1075499019 10:122954830-122954852 GAGCCACGCTGGCCTTCGCCGGG + Intronic
1076629786 10:131845653-131845675 CAGCTCCGCAGGCCTCGTCCTGG + Intergenic
1076636628 10:131885389-131885411 CAGGAGCGCGGGCCTCGGCCCGG + Intergenic
1076667712 10:132102523-132102545 CAGGGCCGCCGGCCTCCACCTGG - Intergenic
1076861404 10:133139910-133139932 CAGCTCCGCAGTCCTCCCCCAGG + Intergenic
1076864550 10:133160426-133160448 CCGCCCCCGGGGCCTCCGGCTGG - Exonic
1076889507 10:133276848-133276870 CAGCCCCGCGGGACACGGTCTGG + Exonic
1077253821 11:1571980-1572002 CGGCTGCGCGGGCCCCCGCCGGG - Intergenic
1077350559 11:2091284-2091306 CAGCCCCACAGGCCTCCGACCGG - Intergenic
1078105820 11:8357397-8357419 CAGCCCCGCGGGCCTCCAGGAGG + Intergenic
1078498151 11:11841516-11841538 CACCACCGCGGGCCACCTCCCGG - Intronic
1081683571 11:45025923-45025945 CAGCCCCGCTGGCCTCCCCTGGG - Intergenic
1083732599 11:64660900-64660922 CAGCCCCCTGAGCCTCAGCCAGG + Exonic
1083997222 11:66278424-66278446 GCGCCCCCCGGGCCGCCGCCCGG + Exonic
1084111225 11:67015311-67015333 CACCCCTGCTGGCCTCAGCCTGG + Intronic
1085048270 11:73365832-73365854 CAGTCCCACAGGCCTCGGCCAGG + Exonic
1088462131 11:110093154-110093176 CAGCCCCGGGGCCCTCCGGCAGG - Intergenic
1088462244 11:110093529-110093551 CGGCCCCGGCGCCCTCCGCCTGG - Intronic
1089525552 11:119094614-119094636 CGGCGCCGCCGGCCTCCCCCCGG + Exonic
1090744523 11:129695671-129695693 CAGGCCCGCGGGCCCCCTCCAGG + Intergenic
1096148927 12:49296690-49296712 CAGCCCCGCTGCCCGCCGCCAGG - Intronic
1096594248 12:52684549-52684571 CAGCCCTGAGGGACTCCACCAGG + Intergenic
1100318555 12:93467749-93467771 CCTCCCCACGGGCGTCCGCCAGG - Intronic
1102119440 12:110429252-110429274 CAGCCCCCTTGCCCTCCGCCTGG - Intergenic
1103348268 12:120265466-120265488 CAGCCCCGCGGAGCCCCGGCCGG + Intronic
1103601830 12:122059381-122059403 CAGCCCCGCCTGCCTCCCCAAGG - Exonic
1103764406 12:123270937-123270959 GAGGCCCGGGGGCCTCGGCCGGG - Intronic
1104568318 12:129903984-129904006 GAGCCCCGCGAGCCCCAGCCGGG - Intergenic
1104934037 12:132355110-132355132 CGGCCCCACGGGTCTCCGCCAGG - Intergenic
1104944308 12:132408858-132408880 CAGCCCCTCGGGGCTCCGGGTGG - Intergenic
1104983340 12:132583448-132583470 CAGCCCCGAGCGCCTGCGCGGGG + Exonic
1105031485 12:132887406-132887428 CCACCCCGCGGGCCCCGGCCCGG + Intronic
1105725559 13:23159766-23159788 CACCCCTGCGCGCCTCCACCCGG - Intergenic
1108200401 13:48037762-48037784 CAGCCGCGCGGGCGGCGGCCAGG + Exonic
1109284882 13:60397646-60397668 CAGGCCCGCCGCCCGCCGCCCGG - Intronic
1113788742 13:113016351-113016373 CCGCCCCACGGGCAGCCGCCAGG + Intronic
1113805816 13:113109686-113109708 CAGCCCCGCTCGCCTCCTCCCGG + Intronic
1113958670 13:114113202-114113224 CAGCCACACCGGCCTCCTCCTGG + Intronic
1115688337 14:35819798-35819820 CAGCCCCTCGGGTCTCCGCGAGG + Intergenic
1119779984 14:77271045-77271067 ACGCCCCCCGTGCCTCCGCCCGG + Exonic
1121408313 14:93732813-93732835 CAGCCCCGCCGGGCTCAGCTGGG - Intronic
1121432875 14:93899906-93899928 CAGCCCCGAGGGCTTCCCTCTGG - Intergenic
1121442403 14:93957263-93957285 CAGCCCCGCAGGGATCTGCCTGG - Intronic
1121595200 14:95157136-95157158 CCGGCACGCGGGCCTCCGCGCGG + Intronic
1122162452 14:99793826-99793848 GTGCCCCACGCGCCTCCGCCCGG - Intronic
1122217029 14:100211547-100211569 CAGCCCCAGGTGCCTCAGCCTGG + Intergenic
1122429689 14:101632489-101632511 CAGCCAGGCGGGCATCAGCCAGG - Intergenic
1122602394 14:102928279-102928301 CAGGCCCGGGGTCCTCGGCCTGG - Intronic
1122904485 14:104795551-104795573 CATCCCCGCGGGCCGGCGCTGGG + Intronic
1124120388 15:26883565-26883587 CGGCCCCGCCCGCCCCCGCCCGG - Intronic
1125522547 15:40356241-40356263 GGGCCCTGCGGGCCTCCCCCTGG + Exonic
1125532389 15:40422103-40422125 CAACCCCGCGGGCAGCCGGCAGG - Intronic
1125597972 15:40899654-40899676 CCGCACCCCGGGCCTTCGCCTGG + Exonic
1128280088 15:66387228-66387250 CAGCCCCGGGGCCCGCGGCCCGG + Exonic
1128866001 15:71115602-71115624 CAGCCCCGAGCGCCGCCGCATGG - Intronic
1129761457 15:78131367-78131389 GACCCCCGCGCGCCTCCTCCAGG - Exonic
1132508557 16:325064-325086 CAGCCCCGCGGGCGCGCCCCAGG + Intronic
1132678221 16:1129434-1129456 CAGCCTGGCCGCCCTCCGCCCGG + Intergenic
1132684710 16:1157508-1157530 CTGCTCCGCGGGCGTCCCCCGGG + Intronic
1132727210 16:1344111-1344133 CAGCACCGCTGTCCACCGCCTGG + Exonic
1132734875 16:1380358-1380380 CAGCCAGGCGGGCCTACACCTGG + Intronic
1132804653 16:1769857-1769879 CAGCCCCACGGGCCTCTGCTTGG - Exonic
1132863688 16:2083573-2083595 CAGCCCTGCGAGCCTCCCCAGGG - Intronic
1133031638 16:3013936-3013958 CGGCCCCGCGGACCTCGGCTGGG + Exonic
1133270313 16:4608157-4608179 CAGCCGGCAGGGCCTCCGCCAGG + Intergenic
1134492196 16:14703561-14703583 GAGCCCAGCCGGCCTCCGCGGGG - Intergenic
1134497577 16:14742683-14742705 GAGCCCAGCCGGCCTCCGCGGGG - Intronic
1135382766 16:22008221-22008243 CCGCCCCATGGGCCGCCGCCGGG - Exonic
1135424511 16:22325683-22325705 CAGCCCCGCGGTCCCCTGCTGGG + Intronic
1136365036 16:29806044-29806066 CCGCCCCGCGCGCCTCCTCCCGG + Intergenic
1136452215 16:30359756-30359778 CAGCCACGGGGGCCTGGGCCTGG + Exonic
1136523727 16:30814468-30814490 CAGCGCCGCGGCCACCCGCCCGG - Intergenic
1137531200 16:49280187-49280209 CAGCCGCGCCCGCCACCGCCTGG + Intronic
1137614501 16:49838709-49838731 CTGCGCCGCGGGCCGCCCCCCGG - Intronic
1138153352 16:54679737-54679759 CAGCATCGCTGGCCTCTGCCCGG - Intergenic
1138529488 16:57627341-57627363 CAGCACCCCAGGCCTCAGCCTGG - Intronic
1139465108 16:67150276-67150298 CAGCCCCGCCGGCCTACGAAGGG - Exonic
1139950155 16:70664581-70664603 CAGCCCCGCGGGCCTGCCTTGGG + Exonic
1141656767 16:85420848-85420870 CAGTGCCGCGGGCCTCCACACGG + Intergenic
1142213121 16:88817748-88817770 CGGCCACCCGGGCCTCTGCCTGG - Intronic
1142336029 16:89490129-89490151 CTGCGCCGCGGGCCTCCGGGCGG - Intronic
1142509550 17:385500-385522 CAACCCCGCGGGACTCAGGCTGG + Intronic
1143056414 17:4165526-4165548 CAGCCCAGCGAGCGTCCGCGTGG + Exonic
1143078546 17:4365648-4365670 CCGCCTCGCCTGCCTCCGCCTGG - Intronic
1143512631 17:7404865-7404887 CAGCCCCGCGCGTCACCGCGCGG - Intronic
1144768539 17:17746185-17746207 CACCCCCGGGGGCATCTGCCGGG - Intronic
1144806616 17:17972183-17972205 GAGGACCGCGGGCCTCCGCCGGG - Intronic
1144847049 17:18225562-18225584 CGGCCCCGCGCGCCCGCGCCCGG + Intergenic
1145122647 17:20274338-20274360 CAGCGCCCTGGGCCTCAGCCAGG + Intronic
1147260039 17:39204528-39204550 TAGACCTGCGGGCCTCAGCCTGG - Exonic
1147446279 17:40477145-40477167 GAGCCCCGTGGGTCACCGCCAGG + Exonic
1148456398 17:47813766-47813788 CAGGCCCGCTGGCCGCCGGCAGG + Exonic
1150251502 17:63707246-63707268 CAGCCCCGAGGTCCTCCAGCAGG - Exonic
1150268785 17:63849268-63849290 CACCCTCGCGCGCCCCCGCCTGG + Intergenic
1151308179 17:73277215-73277237 CAGCATCCCTGGCCTCCGCCTGG - Intergenic
1152654870 17:81514807-81514829 GAGCCCCGCCCGCCTCCGCCGGG + Intronic
1154241567 18:12657983-12658005 CGGCCGCGCGCGCCGCCGCCGGG + Exonic
1155054068 18:22170061-22170083 CAGCCGGGCTGGCCTCCTCCAGG - Intronic
1155300767 18:24426861-24426883 CAGCCGAGGGGCCCTCCGCCTGG + Intronic
1156475104 18:37400995-37401017 CAGCCCCCAGGGCCCCTGCCAGG - Intronic
1160691049 19:460834-460856 CAGCCGCCCGCGCCGCCGCCGGG + Exonic
1160706233 19:531558-531580 CGGCGCCGAGCGCCTCCGCCGGG - Intergenic
1160777215 19:861809-861831 CAACCACGCGGGCCGCCGCCCGG + Exonic
1160876785 19:1300149-1300171 CGGCCCCTCGGGCCTCCGGGGGG - Exonic
1160995370 19:1879849-1879871 CCGCCCCCCGGCCCCCCGCCTGG + Intronic
1161051111 19:2164417-2164439 CAGCCGCGGGGCCCTCGGCCGGG - Intronic
1161222084 19:3122472-3122494 CAGCCCCGGGGGCCGCCTCCCGG + Exonic
1161380682 19:3963613-3963635 CAGCCGAGGGGGCCCCCGCCAGG + Intronic
1161401167 19:4066691-4066713 CGGCCCCGCGCGCCCCGGCCCGG - Exonic
1161401508 19:4067701-4067723 CCGCCCCGCGGCCCGCAGCCGGG - Intergenic
1161779260 19:6280080-6280102 CAGCCCGGCAGGCCCCCGCCAGG - Intergenic
1162039993 19:7964973-7964995 CAGCCCTGCAGGCCCCAGCCGGG + Intronic
1162933677 19:13969873-13969895 CAGTCCCGCCGGCCTCTGCGAGG - Intronic
1162953521 19:14085700-14085722 CCGCCCCGGGAGCCTCCGACTGG + Exonic
1163103359 19:15110112-15110134 CAGCGCCGGGGGCCACCCCCAGG + Exonic
1163145867 19:15379205-15379227 CGGCCCCGCGGGCCTAGGGCAGG + Intronic
1163272275 19:16261540-16261562 CAGCCACACGGGCCTCTGCCAGG - Intergenic
1163361149 19:16847136-16847158 CAGCCTCGGGGGCCTCAGCGAGG + Intronic
1163424159 19:17231998-17232020 CAGCCCCTCTGGCCGACGCCAGG + Exonic
1164639318 19:29812521-29812543 CCGCCCCGCAGGCCTCAGGCCGG + Exonic
1164658586 19:29942523-29942545 CGGGCCCGCGGGCCTCAGCGCGG - Exonic
1166100798 19:40570448-40570470 CAGCCACGCGAGCTTCCCCCAGG + Exonic
1166106679 19:40601228-40601250 CAGCCCCACGCGCCCCCGCGCGG + Intronic
1166694814 19:44846479-44846501 GTGGCCCGCGGGCCTCCGGCCGG + Intronic
1167258207 19:48443353-48443375 GAGCGCCTCGGGCCGCCGCCCGG + Exonic
1167752463 19:51389118-51389140 CAGCCCCAGGGCCCCCCGCCCGG + Exonic
1168277040 19:55284267-55284289 CAGCTCCGCGGCCCGCCGACTGG + Exonic
1168630591 19:57953253-57953275 CAGACCTGTGGGCCTCAGCCTGG + Intergenic
1168689715 19:58369130-58369152 CAGCCCCGGGAGCCCCCGCCTGG + Exonic
925725383 2:6865989-6866011 CAGCCCCGGGAGCCGGCGCCTGG - Intronic
926095813 2:10080154-10080176 CAGCCCCGAGAGCCTCCCCGCGG - Exonic
926217050 2:10912215-10912237 CAGCCCCGAGCCCCGCCGCCGGG + Exonic
931681367 2:64751774-64751796 CAGCCCCGCCGGACTTCCCCCGG - Intergenic
932623987 2:73284037-73284059 CGGCCTCGCGGGCCTCCGGAGGG + Intronic
933255704 2:80078532-80078554 CAGCCCCGCGGGCATCTGTATGG + Intronic
934461754 2:94216717-94216739 CTGCCCTGCGTGCCTCAGCCTGG + Intergenic
934636077 2:95991426-95991448 CCGCCCCGCAGCCCTCAGCCTGG + Intronic
934797569 2:97114000-97114022 CCGCCCCGCAGCCCTCAGCCTGG - Intronic
938069240 2:128299821-128299843 CAGCACCCCCAGCCTCCGCCTGG - Intronic
938318021 2:130343204-130343226 CGGCCCCGCGGGCGTCTGCGTGG + Intronic
940751318 2:157629258-157629280 GAGCCCCGCGGGCTTCCTACTGG + Intergenic
942448260 2:176092620-176092642 CCGCCCCGAGGGCCCCCGCCGGG - Intergenic
946240834 2:218354539-218354561 TAGACCTGCGGGCCTCCGCCTGG - Intergenic
946688037 2:222291200-222291222 CAGCCCCGGATGCCTCGGCCAGG + Intronic
946702105 2:222424483-222424505 CCGCCCGCCCGGCCTCCGCCCGG + Intergenic
947592883 2:231395442-231395464 CCGCCCCGGGAGGCTCCGCCAGG + Intergenic
947860573 2:233354726-233354748 CAGGGCCACGGGCCTCGGCCGGG - Intronic
948478964 2:238238928-238238950 CAGCCTCAGGGGCCTCCTCCAGG + Exonic
949014385 2:241701548-241701570 GAGCCCCCGGGGCCTCAGCCCGG - Intergenic
949018780 2:241728738-241728760 CAGCCACGTAGGCCTCCGCACGG - Exonic
1168800767 20:642290-642312 CACCCCCGCTGGCCCCCCCCAGG - Intergenic
1168800811 20:642381-642403 CACCCCCGCTGGCCCCCCCCAGG - Intergenic
1168800825 20:642410-642432 CACCCCCGCTGGCCCCCCCCAGG - Intergenic
1169117013 20:3072304-3072326 CACCCCCGCCCGCCTCCCCCTGG - Intronic
1172445517 20:34991152-34991174 CAGCCCCTCAGGCCTCCACCTGG - Intronic
1173665810 20:44762280-44762302 CAACCCCAGGGGCCTCCCCCAGG - Intronic
1174409073 20:50322017-50322039 CAGCCTCGGGGGCCTCCACTCGG - Intergenic
1175108491 20:56630325-56630347 CAGGCCCGGGCGCTTCCGCCAGG + Intronic
1175423730 20:58851696-58851718 CAGCTGCGCGGGCAACCGCCGGG + Intronic
1175517260 20:59577486-59577508 CCGCTCCGCGGCCCTCCGGCGGG + Intergenic
1176097096 20:63349221-63349243 CTGCCCCGCGGGCCTCCCCGGGG - Intronic
1176169595 20:63690871-63690893 CAGCCCCCTGGGCCTCTGCCGGG - Exonic
1176378902 21:6101973-6101995 CAGACCTGCTGGCCTCGGCCTGG + Intergenic
1178404338 21:32311946-32311968 AAGCCCAGCGAGCCTCCCCCTGG + Exonic
1179103405 21:38376748-38376770 CAGCCCCACTCGCCTCCACCAGG + Intergenic
1179491571 21:41744754-41744776 CAGCCCCACGTGGCTCCGCGGGG - Intronic
1179511846 21:41878893-41878915 CAGCCCCGCGGCCCCGCGCTGGG + Intronic
1179744572 21:43436264-43436286 CAGACCTGCTGGCCTCGGCCTGG - Intergenic
1179926816 21:44539310-44539332 CCGCCCCGCGTGCTCCCGCCCGG - Exonic
1179937094 21:44612850-44612872 CCGCCCCGCGTGCTCCCGCCTGG + Exonic
1181500396 22:23312629-23312651 CTGCCACGCTGGCCTCCTCCTGG + Intronic
1184210263 22:43031177-43031199 CAGCTCCGCGTGCCTCTGCCTGG - Intergenic
1184523109 22:45007439-45007461 CGCCCCCGCGCGCCCCCGCCCGG - Intronic
1185296236 22:50056693-50056715 CACCCCTGGGGTCCTCCGCCTGG + Intronic
1185336135 22:50271649-50271671 CCTCCCCGAGGGCCCCCGCCCGG + Intergenic
949552438 3:5122383-5122405 CACACGAGCGGGCCTCCGCCCGG - Exonic
950510042 3:13420429-13420451 CAGCCCCGCGTCCCTGCGCGAGG - Intergenic
950891571 3:16409098-16409120 CAGACCTGCAGGCCTGCGCCGGG - Intronic
951625950 3:24663252-24663274 GAGCCCCATGGGCCTCCCCCAGG - Intergenic
952436573 3:33277627-33277649 CAGCCTCGCAGGCCGCGGCCCGG - Intronic
954277851 3:49554299-49554321 CAGCCCCGCCGGCCCCCGCCCGG + Intergenic
955072848 3:55586056-55586078 GAGCCCCGGGGGCTTCCTCCTGG + Intronic
955228281 3:57078782-57078804 CAGCCCCGCGGGGCACCCGCAGG - Intronic
961182289 3:124886743-124886765 CAGCCCGGCGGGGCTGCGCGCGG + Intronic
961322330 3:126084275-126084297 CAGCCCCCCGGGCCCCCGGCGGG - Exonic
961372775 3:126441447-126441469 CAGCCCTGGGGGCCTCGGGCAGG + Intronic
963081842 3:141402236-141402258 CAGCCCCGCGGGCCCGGGGCTGG - Intronic
968137026 3:196227115-196227137 CAGCCCCGGGGGCCTCACCGTGG - Exonic
968434178 4:576377-576399 CGGCCCCGCGCGCCTCGCCCTGG + Intergenic
968619224 4:1596238-1596260 CAGCCCAGCGTCCCTCAGCCTGG - Intergenic
968811213 4:2800440-2800462 CTGCCCCTAGGGCCTCCTCCTGG - Intronic
969040286 4:4290366-4290388 CAGCCCCGCACGCCTTCGCAAGG - Intronic
969256887 4:6008298-6008320 CCGCGCCGCGGGCCTCCTGCTGG - Intergenic
969409147 4:7016439-7016461 CAGCACCGCGGGCCCCAGCCAGG - Intronic
969574372 4:8028056-8028078 CAGCACCCTGGGCCTCTGCCTGG - Intronic
969610885 4:8227320-8227342 CCGCCCCCCGGGCCTGTGCCAGG - Exonic
975329739 4:73099824-73099846 CAGCCCCGTTGCCCTCCACCTGG + Intronic
978761397 4:112358569-112358591 CAGCCCCCAGGGCCTCTGCCAGG - Intronic
981711097 4:147709680-147709702 CAGCCCCGTGGGCCGCTGCTTGG - Intergenic
985578193 5:683426-683448 GAGCCCCGCGTGCTTCTGCCTGG + Intronic
985593120 5:775566-775588 GAGCCCCGCGTGCTTCTGCCTGG + Intergenic
986721901 5:10565531-10565553 CAGAGCCGCGGGCATCCACCCGG + Intronic
987340615 5:16936158-16936180 CCGCCCCGAGGGCCCCCGGCCGG - Exonic
988823921 5:34915626-34915648 CAGCTCCGCGGTCGTCCTCCAGG - Exonic
988856131 5:35229744-35229766 CAGCCTCGCGGGCATCCGGCGGG - Intronic
994072880 5:95621061-95621083 CAGCCGCGGGGGCCTGCGGCCGG - Exonic
995512337 5:112921863-112921885 CAGCCCCGCGACCCTCAGCCTGG + Intronic
996900549 5:128538167-128538189 CGGCCCCGCGCACCTCCGCCCGG - Intronic
997305033 5:132830523-132830545 CAGCCCCGCCGGCCTCCCGGGGG + Intronic
1000052662 5:157575843-157575865 CAGCCCCGCGGGCCTCCGCCAGG + Intergenic
1001054950 5:168441699-168441721 CAGACCGGCAGACCTCCGCCAGG - Exonic
1001906625 5:175478692-175478714 CAAGCCTGCGCGCCTCCGCCGGG - Intronic
1002268834 5:178056074-178056096 TAGACCTGCGGGCCTCAGCCTGG - Intergenic
1002306394 5:178286350-178286372 GAGCCCCGCGGGCGTCCCTCAGG - Intronic
1002462281 5:179380357-179380379 CAGCCCCACGGGACTCCGGGAGG - Intergenic
1002524654 5:179808140-179808162 CAGCCCCTCGGGCCTCCCCCGGG - Intronic
1002541261 5:179907838-179907860 CCGTCTCGCGGGCCTCGGCCCGG - Exonic
1002792636 6:447191-447213 CAGCCCAGCGCGCTTGCGCCTGG - Intergenic
1002896299 6:1382328-1382350 CAGCCCCGGGCCCCTCCGCGGGG - Intergenic
1002925740 6:1604895-1604917 GAGCCCCGGGGGCCTGGGCCGGG - Intergenic
1002961063 6:1915277-1915299 CAGCCCTGTGAGCCTCTGCCAGG - Intronic
1003276244 6:4655699-4655721 CAGCCACGCTGGCCTCCCCGAGG - Intergenic
1003405919 6:5827289-5827311 CGGTCCCGTGGGCCTCCCCCAGG - Intergenic
1005680957 6:28207717-28207739 CTGCCCCGCGGCCCTTCCCCTGG - Intergenic
1006022677 6:31126629-31126651 CAGCCCTGCCAGCCTCCGACGGG + Intronic
1006474479 6:34245570-34245592 CAGCCCCCTTGCCCTCCGCCTGG + Exonic
1006504159 6:34477094-34477116 CAGCCCTGAGGGCTTCCTCCAGG + Intronic
1011734179 6:90296060-90296082 CAGACCCGCGGCCCTGCCCCCGG - Intronic
1014272329 6:119349011-119349033 CAGCCCCGCGGGCGGCGTCCTGG - Exonic
1015625928 6:135181173-135181195 CAGCCCCGCGGGCGGCAGCCAGG + Intergenic
1016988275 6:149910866-149910888 CAGCCCCGCGCGCCCCTGCCCGG - Intergenic
1016994966 6:149954992-149955014 CAGCCCCGCGCGCCCCTGCTTGG + Intergenic
1017003642 6:150014443-150014465 CAGCCCCGCGCGCCCCTGCTTGG - Intergenic
1017671855 6:156777242-156777264 CAGCCTCGCGGGACCCAGCCGGG - Intergenic
1018651921 6:165999292-165999314 CAGCCCGGCGGACCTTGGCCTGG - Intergenic
1019172134 6:170138479-170138501 CAACCCCGTGGGCCTGCACCTGG - Intergenic
1019562204 7:1664710-1664732 CAGCGCCGCGCCCCTCCGGCCGG - Intergenic
1020256031 7:6503640-6503662 GAGCCCCGCGGAGCTGCGCCAGG - Exonic
1022943239 7:35258539-35258561 CAGAGCCCCGGGCCTCCTCCCGG + Intergenic
1024236411 7:47402307-47402329 CAGCACCGCTGGCCAGCGCCAGG - Intronic
1025208589 7:57008052-57008074 CAGCCCGGGGGGCCGCAGCCGGG - Intergenic
1025663358 7:63568826-63568848 CAGCCCGGGGGGCCGCAGCCGGG + Intergenic
1025739090 7:64182168-64182190 CAGCGGCGCGGGCCGCAGCCGGG + Intronic
1027774230 7:82444113-82444135 CAGCCCCGCGGGGCTCCCGGGGG + Intergenic
1028899050 7:96075673-96075695 CATCCCCGCGGGTCTGAGCCGGG + Intronic
1029380891 7:100213891-100213913 CAGCCCAGAGGGCCACCCCCAGG - Intronic
1029689806 7:102173835-102173857 CAGCCCCGTGGGGCTCCCCGCGG + Intronic
1031895979 7:127348000-127348022 CAGCGCCGCCGCCCTGCGCCCGG - Intronic
1032262198 7:130346821-130346843 GAGCCCCGGGGGCTTCCTCCTGG - Intronic
1034093117 7:148382209-148382231 CAGCCCCACAGGCCTGGGCCCGG + Intronic
1034335917 7:150323436-150323458 CAGCCCCGCCGCCCGCCGCCTGG - Exonic
1034592401 7:152152782-152152804 CTTCTCCGTGGGCCTCCGCCAGG - Exonic
1034978023 7:155459095-155459117 CAGCTCCGCGGGCCTCCCCGCGG - Intronic
1035167852 7:157002414-157002436 GAGCCCCCTGGGCCTCCGTCTGG + Intronic
1035674084 8:1442555-1442577 CAGCCTGGCGGGTCTACGCCCGG - Intergenic
1035777013 8:2196080-2196102 CAGCCCCGCCAGCCTCTGCATGG + Intergenic
1036950099 8:13132605-13132627 CAGAGCCGCGAGCCCCCGCCCGG + Intronic
1037450701 8:19013727-19013749 CAGCCTCGCCAGCCTCCGCCAGG - Intronic
1038745088 8:30248056-30248078 AAGCCACGAGGGCCTCTGCCAGG + Intergenic
1038807914 8:30812200-30812222 CAGCCCCGCAGGCCCCCGGTGGG + Intronic
1039620853 8:38996268-38996290 CACCCCCGGGGCCCTCCGGCTGG + Exonic
1046108285 8:109691846-109691868 AAGCCCTCCTGGCCTCCGCCGGG - Intergenic
1049109973 8:140636098-140636120 CAGCCCCTCGGCCCCCAGCCTGG + Intergenic
1049555468 8:143279285-143279307 CAGCCCCGGGGGCGGCCACCCGG - Intergenic
1049799096 8:144509549-144509571 CAGCACGGCGGGCCTGGGCCTGG + Exonic
1052574790 9:30278941-30278963 GAGCCCCGCGGGCCTGAGCAAGG - Intergenic
1055315308 9:75028388-75028410 CATCCGCGCTGGGCTCCGCCAGG + Exonic
1057814573 9:98285161-98285183 CAGCCCTCCGGCCCTCAGCCTGG + Intergenic
1061192174 9:129088270-129088292 CAGCCCCGGCAGCCTCCGTCTGG - Intronic
1061447983 9:130652263-130652285 TAGACCCGCGGGCCTCAGCCTGG - Intergenic
1061559710 9:131394432-131394454 CAGCCCCGCAGCCCCGCGCCCGG - Intronic
1061877687 9:133553074-133553096 CGGCCACGCGGGCCTCCCACAGG - Intronic
1062096532 9:134706721-134706743 CAGCACTGTGGGCCCCCGCCTGG + Intronic
1062144807 9:134983123-134983145 CTGCCCCTCGGGCCTTCGCGTGG - Intergenic
1062414067 9:136439189-136439211 TCGCCCCGCGGCCCCCCGCCAGG - Exonic
1062569553 9:137178841-137178863 CTGCCCTGGGGGCCTCCGCCTGG + Intronic
1203792982 EBV:161453-161475 CAGCCCCGGGGGCCTGCAGCAGG + Intergenic
1185471469 X:386491-386513 CAGCCCCGCTCGCCGCCCCCCGG - Exonic
1186506875 X:10100684-10100706 CAGCCCCTCGGGCCTCCCACCGG + Intronic
1192169728 X:68846821-68846843 CAGCCCCCAAGGCCTCCCCCTGG + Intergenic
1192419537 X:71016923-71016945 CAGCCCCTCGGGTCTCCGCGAGG - Intergenic
1194766104 X:97846422-97846444 CAGCTCCGCGGGCATCAGCCAGG + Intergenic
1195625204 X:106999887-106999909 AAGGCCTGCGGGCCGCCGCCGGG + Exonic
1199773865 X:150993971-150993993 TAGGCCTGCGGGCCTCAGCCTGG - Intergenic
1200034571 X:153319282-153319304 CAGCCTCGCTGGCGTCCCCCTGG + Intergenic
1200092932 X:153644258-153644280 GGGCGCCCCGGGCCTCCGCCGGG - Intronic