ID: 1000060718

View in Genome Browser
Species Human (GRCh38)
Location 5:157652628-157652650
Sequence ACCTATTAGCTAATGTTGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000060716_1000060718 15 Left 1000060716 5:157652590-157652612 CCAAGGGAGAATGGGGAAGATTT 0: 1
1: 0
2: 4
3: 24
4: 227
Right 1000060718 5:157652628-157652650 ACCTATTAGCTAATGTTGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000060718 Original CRISPR ACCTATTAGCTAATGTTGCT GGG Intronic
No off target data available for this crispr