ID: 1000062155

View in Genome Browser
Species Human (GRCh38)
Location 5:157667433-157667455
Sequence CAGCCTCAAGGTTTTTAAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 164
Summary {0: 1, 1: 0, 2: 3, 3: 9, 4: 151}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000062155_1000062168 27 Left 1000062155 5:157667433-157667455 CCAGTTTAAAAACCTTGAGGCTG 0: 1
1: 0
2: 3
3: 9
4: 151
Right 1000062168 5:157667483-157667505 AGCACTTTGGGAGGCCAAGGCGG 0: 55360
1: 145174
2: 158991
3: 100124
4: 51656
1000062155_1000062161 14 Left 1000062155 5:157667433-157667455 CCAGTTTAAAAACCTTGAGGCTG 0: 1
1: 0
2: 3
3: 9
4: 151
Right 1000062161 5:157667470-157667492 TGCCTGTAATCCCAGCACTTTGG 0: 89533
1: 228199
2: 240322
3: 214910
4: 187714
1000062155_1000062164 18 Left 1000062155 5:157667433-157667455 CCAGTTTAAAAACCTTGAGGCTG 0: 1
1: 0
2: 3
3: 9
4: 151
Right 1000062164 5:157667474-157667496 TGTAATCCCAGCACTTTGGGAGG 0: 288135
1: 266162
2: 155564
3: 133776
4: 191789
1000062155_1000062162 15 Left 1000062155 5:157667433-157667455 CCAGTTTAAAAACCTTGAGGCTG 0: 1
1: 0
2: 3
3: 9
4: 151
Right 1000062162 5:157667471-157667493 GCCTGTAATCCCAGCACTTTGGG 0: 215700
1: 270647
2: 186590
3: 142154
4: 223611
1000062155_1000062166 24 Left 1000062155 5:157667433-157667455 CCAGTTTAAAAACCTTGAGGCTG 0: 1
1: 0
2: 3
3: 9
4: 151
Right 1000062166 5:157667480-157667502 CCCAGCACTTTGGGAGGCCAAGG 0: 79234
1: 201556
2: 232767
3: 156913
4: 93134

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000062155 Original CRISPR CAGCCTCAAGGTTTTTAAAC TGG (reversed) Intronic
907711709 1:56889039-56889061 CAGCCTCACAGATTTTAAAGAGG - Intronic
907813561 1:57896130-57896152 CAGCCTATAGGTTGTAAAACAGG - Intronic
909283824 1:73789860-73789882 CAGACTCAAGGTTTTCAAGGTGG + Intergenic
910188133 1:84567706-84567728 TGGCCCCAAGGTTTTTAAACTGG - Intronic
910896634 1:92076714-92076736 CAGCCTAAACATTTTTAAAGAGG + Intergenic
911802785 1:102164659-102164681 CAACCTCAACTTTTTAAAACTGG - Intergenic
913064121 1:115233857-115233879 CAGCATCAAGGTCGTAAAACAGG + Intergenic
917365434 1:174226536-174226558 CAGACTCAAGATTATTGAACTGG - Intronic
917889885 1:179425650-179425672 CAAACTCATGGTTTTTACACTGG - Intronic
918559577 1:185848469-185848491 GTTCCTCAAGGTTTTGAAACTGG + Intronic
919730085 1:200908288-200908310 CATCCTCATGGTTTGTACACAGG - Intronic
921136738 1:212267565-212267587 CAGGTTCAAGGTCTATAAACTGG + Intergenic
921750166 1:218783027-218783049 GAGTCTCAAGGTGTTTACACAGG + Intergenic
923917118 1:238521259-238521281 CAGCTTCAAGTCTTTTAAACAGG + Intergenic
1063961195 10:11306836-11306858 CAGCCTCCCAGTTTTTAAATAGG + Intronic
1064741724 10:18441105-18441127 CAGCCGGATGGTTATTAAACTGG - Intronic
1066292114 10:34023697-34023719 TGGGCTCATGGTTTTTAAACAGG + Intergenic
1066749347 10:38636495-38636517 CAGCCTGAAGGCTGATAAACTGG - Intergenic
1066967303 10:42281297-42281319 CAGCCTGAAGGCTGATAAACTGG + Intergenic
1067367390 10:45646253-45646275 CAGCATCAAGGATATTAAATAGG - Intronic
1068286766 10:54948215-54948237 AAGCCTTAAGGCTTTCAAACTGG - Intronic
1069505487 10:68993779-68993801 CAACCTCAAGGTTGTTAACCTGG + Intronic
1070025344 10:72626523-72626545 AAGTCTCAAGGTTATGAAACAGG - Intergenic
1073776611 10:106793472-106793494 CAGAATCAAGATTTTTAAGCAGG + Intronic
1074997220 10:118768138-118768160 CATCCTCAAGGTTTGAAAATGGG + Intergenic
1075246698 10:120828856-120828878 CTGCCTAAATGTTTTAAAACTGG - Intergenic
1085114556 11:73919205-73919227 CACCCTCAAGGAGTTTGAACTGG - Intronic
1085251722 11:75148332-75148354 CAGCCTTGAGGTCTTTAATCTGG + Intronic
1089817154 11:121186558-121186580 CAGGCTCAAGGATTCTAAAGTGG - Intronic
1093218790 12:16393919-16393941 CAGCCTAAATGTTCATAAACTGG - Intronic
1094173983 12:27523448-27523470 CAGCCTTAAGGTCTTTAAACGGG + Intronic
1094463050 12:30718877-30718899 CAGCCTCTAGAATTTTAAATGGG - Intronic
1102785849 12:115604292-115604314 TAGCTTAATGGTTTTTAAACTGG - Intergenic
1105892625 13:24692473-24692495 CAGCCTCCAGGTTCTTCACCAGG - Exonic
1107588325 13:41876440-41876462 CTGCCTCAGCGTTTTTATACTGG + Intronic
1108247836 13:48535010-48535032 CAGTCTCAAGGTTTTCACTCAGG + Intergenic
1108463030 13:50686416-50686438 CAACCTCAAGGTGTTCAAGCTGG - Intronic
1110676973 13:78259934-78259956 CAGGCTTAAGTTTTATAAACTGG - Intergenic
1112705193 13:102060595-102060617 TATCCTCAATGTTTTTTAACTGG + Intronic
1112907458 13:104442718-104442740 CAGCCTCAAGGCATTAACACGGG - Intergenic
1114739164 14:25077212-25077234 CAGTCTCACAGTTTTTAAAGGGG + Intergenic
1117575968 14:57098092-57098114 CAGCCTCAGGGTCTTGCAACTGG + Intergenic
1119494897 14:75069893-75069915 CAGCCTTAAGGATCTAAAACCGG + Intronic
1121047661 14:90799780-90799802 GAGTCTGAAGGTTTTTAAGCAGG + Intronic
1126030069 15:44488166-44488188 CGGCCTGAAAGGTTTTAAACTGG + Intronic
1128357425 15:66937877-66937899 CAGCCCCAAGGTTCTAAGACAGG + Intergenic
1130121052 15:81047951-81047973 GAGAGCCAAGGTTTTTAAACAGG - Intronic
1130219546 15:82007707-82007729 CAGCCTGAACATTTTTAAATAGG - Intergenic
1134463388 16:14449790-14449812 CACCCACTAGGTTTTTAGACTGG + Intronic
1136733369 16:32440638-32440660 CAGCCTGAAGGCTGATAAACTGG + Intergenic
1137067226 16:35860181-35860203 CAGTGTTAAGGTTTTTATACTGG + Intergenic
1138711561 16:58976318-58976340 CAGACCCAAGGTTTTTACAGTGG + Intergenic
1138906715 16:61344789-61344811 CATCATCAATGTATTTAAACAGG - Intergenic
1139220151 16:65173380-65173402 CAACCTAAATGTTTTTCAACAGG - Intergenic
1203019714 16_KI270728v1_random:388964-388986 CAGCCTGAAGGCTGATAAACTGG - Intergenic
1203038049 16_KI270728v1_random:662122-662144 CAGCCTGAAGGCTGATAAACTGG - Intergenic
1143939118 17:10520337-10520359 GAGGATCAAGATTTTTAAACTGG - Intergenic
1144787339 17:17839414-17839436 CCGCCTCACCGTTTTTAAATGGG + Intergenic
1145887842 17:28395389-28395411 GAGCCTCCAGGTTGATAAACAGG - Exonic
1149161328 17:53696776-53696798 CAGCTTTAAGATTTTTAAAAAGG - Intergenic
1153895627 18:9556488-9556510 CAGCCTCAGTGTTTTTTAAAAGG + Intronic
1154305252 18:13225921-13225943 CAGCCTCAATGTCCTAAAACTGG - Intronic
1164064602 19:21705155-21705177 CAGCCTGAAGTATTTTAAAATGG + Intergenic
1164415249 19:28041679-28041701 CAGCCTCAAGTTCTTTATAGTGG - Intergenic
1166314606 19:41982040-41982062 CAGCCTCCAGGTTCTTCACCAGG + Exonic
1166829479 19:45630136-45630158 CAGCCTGAAGGTTTTAAAACAGG - Intronic
930332571 2:50004528-50004550 CAGCCTCATGGTTGCAAAACTGG + Intronic
934312340 2:91878613-91878635 CAGCCTGAAGGCTGATAAACTGG - Intergenic
936014228 2:108945429-108945451 AAGTCTCAAGGCTTTAAAACAGG - Intronic
937344793 2:121118911-121118933 GAGCTTCAAGGTTTCTGAACTGG + Intergenic
937808382 2:126171766-126171788 CAGCCTCAGAGTTTTTAACTTGG - Intergenic
940139626 2:150479394-150479416 AAGCCTCACAGTGTTTAAACTGG - Intronic
940405385 2:153295329-153295351 CATCCCCAAGGTTATTAAATGGG - Intergenic
941373679 2:164701231-164701253 GAGCCTCAATATTTTTAAAGGGG - Intronic
944421519 2:199536020-199536042 TAGGCTCAAACTTTTTAAACAGG + Intergenic
947871643 2:233441974-233441996 CAGCCTCAACCTTCATAAACAGG + Exonic
1170033666 20:11968181-11968203 CATCTTCAAGAATTTTAAACTGG - Intergenic
1171452035 20:25242729-25242751 CAGCCTGAAGTTCTTTAAATAGG - Intergenic
1172556407 20:35845684-35845706 TAGTTTTAAGGTTTTTAAACAGG + Intronic
1172637003 20:36416700-36416722 GAGCTTCAAGGATTTTAAGCAGG + Intronic
1173693280 20:44983066-44983088 CAGCCTCAAGGTCTTTGCACTGG - Intronic
1173840513 20:46153714-46153736 CAGCATCCAGGTTTTAAAGCAGG - Intergenic
1175434968 20:58939099-58939121 CAAACTCAAGGATGTTAAACAGG + Intergenic
1175557929 20:59886436-59886458 CATCCTAAAGATTTTTAAAATGG + Intronic
1180539098 22:16424448-16424470 CAGCCTGAAGGCTGATAAACTGG - Intergenic
1181142426 22:20816227-20816249 CAACCTGAAAGTTTTTAAGCAGG + Intronic
1182016518 22:27044722-27044744 CAGCCTCAAGGCCTTTAATCTGG + Intergenic
949098260 3:112386-112408 CAGCCTGAAGGTTGAAAAACTGG - Intergenic
949945179 3:9184446-9184468 AGACCTCAAGGTTTTAAAACAGG + Intronic
953034931 3:39203208-39203230 CATCCTGAAGGATTTTAATCAGG + Intergenic
958148767 3:89661812-89661834 CAGCATCTAGGTTTTTAAGTTGG + Intergenic
959956670 3:112246909-112246931 CAGCACCAAGGTTGTTAACCAGG + Intronic
960702939 3:120454973-120454995 CTGTCTGAAGATTTTTAAACAGG - Intergenic
961804364 3:129478287-129478309 CCACCTCATGGTTTTAAAACTGG + Intronic
962531169 3:136281964-136281986 CAGCCACAAGGGATTTAAAAAGG - Intronic
963006392 3:140729758-140729780 AAGACTCAAGGTTCTTAAGCAGG + Intergenic
963475447 3:145798238-145798260 CAGCCTCAAGGTTGAAAGACTGG + Intergenic
965426077 3:168524707-168524729 CAGCCTCAAAACTTTCAAACTGG + Intergenic
967706188 3:192653606-192653628 TTGCTTCAAGGTTTTTATACAGG - Intronic
969905905 4:10395945-10395967 CAGCCTCAAGTTTTTTGTACAGG + Intergenic
972803910 4:42507860-42507882 TAACCTCACTGTTTTTAAACAGG - Intronic
973108515 4:46371196-46371218 CATCCTCTAGGTTTGTAAAGTGG + Intronic
975968433 4:80004001-80004023 CAACCTAAATGTTTTTCAACAGG + Intronic
977736790 4:100426661-100426683 AAGCCTCAGGAATTTTAAACTGG + Intronic
977817752 4:101434871-101434893 CAGCCTCAATTTTCTTACACTGG + Intronic
978830273 4:113075831-113075853 CAGCCTAAGGGTGTTTAAGCAGG - Intronic
979301836 4:119095379-119095401 CATCCTCAAAGCTTTAAAACTGG + Intergenic
980276687 4:130661324-130661346 CAGCCTCAATGTTTTTCATGTGG - Intergenic
980554743 4:134388523-134388545 CAGCCTGAAGCTTTTAAAAAGGG + Intergenic
981106530 4:140888067-140888089 AATCCTTAAGGTTTTTAATCAGG - Intronic
985740887 5:1616604-1616626 TAGGATTAAGGTTTTTAAACTGG + Intergenic
986270587 5:6227406-6227428 CAGCCTCAAGGTGTGTTATCAGG + Intergenic
987225385 5:15834781-15834803 CAGCCTCAAGGCTACAAAACAGG - Intronic
989123515 5:38028412-38028434 TTGCCTCAAGGTTTAGAAACCGG + Intergenic
991668677 5:69025302-69025324 CAGCCTACAGCTTTTTAAATTGG + Intergenic
992983284 5:82200033-82200055 CAGCCCAAAGGTCTTTCAACTGG - Intronic
994901712 5:105781407-105781429 CAGCCTCTAGTTTTTTAAATAGG - Intergenic
998155049 5:139781258-139781280 CAGCTGCAAGGTTATAAAACTGG + Intergenic
999100195 5:149017463-149017485 CAGCCTTCAGGTTTTTACTCTGG - Intronic
1000062155 5:157667433-157667455 CAGCCTCAAGGTTTTTAAACTGG - Intronic
1003814497 6:9822795-9822817 CAGCTTAAAGCTTTTGAAACTGG + Intronic
1008748477 6:54702864-54702886 GAGACTGAAGATTTTTAAACTGG - Intergenic
1008903698 6:56652923-56652945 CAACCTCAAGATTAGTAAACAGG + Intronic
1011351659 6:86430992-86431014 CATCTTCAAGGTTCTTAAACAGG - Intergenic
1012963246 6:105645008-105645030 AAGCCTAAAGGTTTTGAAAGGGG - Intergenic
1015854296 6:137607111-137607133 CAGCCCAAATGTTTTTAAAGTGG - Intergenic
1016656618 6:146525597-146525619 TGGCCTCATGGTTTTAAAACTGG + Intergenic
1018538300 6:164848064-164848086 CAGCCTCCAGGGTTGTCAACTGG + Intergenic
1018606078 6:165599603-165599625 CAGCCTCAGGGTCTTTAAACAGG + Intronic
1019807986 7:3142715-3142737 CAGACTCATGGTTTATAAATGGG + Intronic
1020492471 7:8804907-8804929 AACCCCCAAGGTTTTTCAACAGG + Intergenic
1022000033 7:26217835-26217857 CGGCCAGAAGATTTTTAAACTGG - Intergenic
1028555831 7:92123639-92123661 CAGCATCACTGTTTTTTAACTGG + Intronic
1029450447 7:100638943-100638965 CAGACTCAAGGTCTTTCAGCAGG + Intronic
1030374361 7:108738069-108738091 CAACCTCAAGGTTTTCAAGAAGG - Intergenic
1032427029 7:131830566-131830588 CTGGCTTAAGGTTATTAAACAGG + Intergenic
1035429708 7:158809716-158809738 CAGCCTGAAGGTTTCCTAACTGG + Intronic
1035518199 8:254771-254793 CAACCTGCAGGTTTTTACACAGG - Intergenic
1035956408 8:4085107-4085129 CAGCCTCAGGGTTGTCCAACTGG - Intronic
1037280573 8:17237300-17237322 CCTCCTCATGTTTTTTAAACTGG + Exonic
1037793477 8:21969414-21969436 CAGTCACAAGGTTTTTAACTTGG - Intronic
1037917265 8:22780265-22780287 CTGCCTCAAGATTTTAAAAAGGG - Intronic
1040932245 8:52747405-52747427 ATGTCTAAAGGTTTTTAAACCGG + Intergenic
1042067150 8:64890965-64890987 CAGCCTCCTGGGTTTAAAACTGG - Intergenic
1042831004 8:73028487-73028509 GAGCCAAAAGGTTTTTAAGCTGG - Intronic
1044839450 8:96325494-96325516 CAGCCTCCAGGTTTTTAGCTGGG - Intronic
1045028568 8:98113981-98114003 CAGGCTAAATGTTTTTAAGCAGG - Intronic
1048485735 8:134845670-134845692 GACCCTCAAAGTTTTCAAACAGG - Intergenic
1050287271 9:4116927-4116949 AACCCTCAGGGTTTATAAACAGG - Intronic
1051495721 9:17720623-17720645 CAGCCTAAAGGTTTCTTAGCAGG - Intronic
1052139401 9:24960285-24960307 AAGGTTCAAGGTTTTAAAACAGG + Intergenic
1055124493 9:72703422-72703444 CAGCCTCAATCTTTTAAAAGTGG + Intronic
1060166924 9:121425071-121425093 CAGACTCATGGTTTCTACACTGG + Intergenic
1186010009 X:5119636-5119658 CAGCCTCATGCCTTTTAATCAGG - Intergenic
1187203467 X:17158535-17158557 GTGTCTCAAGTTTTTTAAACAGG + Intergenic
1192259099 X:69493359-69493381 CAGGCTCCAGGTTTTTTAACTGG - Intergenic
1194044015 X:88979426-88979448 CTGCCTGAAGATTTTCAAACTGG - Intergenic
1194142033 X:90219655-90219677 CACACTCAAGATTTTTAAGCGGG + Intergenic
1194682579 X:96871832-96871854 CAGCCTAAATGTTCTTTAACGGG + Intronic
1194868434 X:99098013-99098035 CTGCCTCAAGGTATTAATACAGG + Intergenic
1196133261 X:112180534-112180556 CAACCTCAAGCTTATTAAATGGG + Intergenic
1197520900 X:127495119-127495141 CAGCCTGATGGCATTTAAACAGG + Intergenic
1200487790 Y:3788768-3788790 CACACTCAAGATTTTTAAGCGGG + Intergenic
1201180305 Y:11336105-11336127 CAGCCTGAACGTTGATAAACTGG - Intergenic