ID: 1000064096

View in Genome Browser
Species Human (GRCh38)
Location 5:157680389-157680411
Sequence CCAGTGGTAAGGAGGTCAGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000064084_1000064096 17 Left 1000064084 5:157680349-157680371 CCTTAGATGGAAGGCCTCAGTAA No data
Right 1000064096 5:157680389-157680411 CCAGTGGTAAGGAGGTCAGGGGG No data
1000064086_1000064096 3 Left 1000064086 5:157680363-157680385 CCTCAGTAATGCCACTGCCTGGC No data
Right 1000064096 5:157680389-157680411 CCAGTGGTAAGGAGGTCAGGGGG No data
1000064088_1000064096 -8 Left 1000064088 5:157680374-157680396 CCACTGCCTGGCATTCCAGTGGT No data
Right 1000064096 5:157680389-157680411 CCAGTGGTAAGGAGGTCAGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000064096 Original CRISPR CCAGTGGTAAGGAGGTCAGG GGG Intergenic
No off target data available for this crispr