ID: 1000066400

View in Genome Browser
Species Human (GRCh38)
Location 5:157696289-157696311
Sequence AACCTCACCCAGTTTTTTTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000066400_1000066404 3 Left 1000066400 5:157696289-157696311 CCTGAAAAAAACTGGGTGAGGTT No data
Right 1000066404 5:157696315-157696337 CTCTTGTCTTGTATGTCCTTGGG No data
1000066400_1000066403 2 Left 1000066400 5:157696289-157696311 CCTGAAAAAAACTGGGTGAGGTT No data
Right 1000066403 5:157696314-157696336 CCTCTTGTCTTGTATGTCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000066400 Original CRISPR AACCTCACCCAGTTTTTTTC AGG (reversed) Intergenic
No off target data available for this crispr