ID: 1000071883

View in Genome Browser
Species Human (GRCh38)
Location 5:157748063-157748085
Sequence GACACTGATGTGCCTTTGCC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 159
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 148}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000071879_1000071883 6 Left 1000071879 5:157748034-157748056 CCAGTTTGACATAGCATCACAAT 0: 1
1: 0
2: 1
3: 8
4: 102
Right 1000071883 5:157748063-157748085 GACACTGATGTGCCTTTGCCGGG 0: 1
1: 0
2: 1
3: 9
4: 148

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000071883 Original CRISPR GACACTGATGTGCCTTTGCC GGG Intronic
900931421 1:5740275-5740297 GTCACTGGTGTGCCTTTGAAGGG - Intergenic
902780045 1:18699050-18699072 GGCACTGGGGTGCCTTTGCTGGG - Intronic
902793750 1:18786834-18786856 GACACTAAGGTGGCTTGGCCTGG + Intergenic
903371905 1:22841887-22841909 GCCAGGGATGTGTCTTTGCCAGG - Intronic
907268289 1:53275892-53275914 TACACTGAGGTGCCTTGGCCAGG - Intronic
908269720 1:62411180-62411202 GACACTGATGTCCTAATGCCTGG - Intergenic
910128892 1:83879532-83879554 GATTCTGATCTGCCTTTGACTGG + Intronic
921084985 1:211781900-211781922 GAGAATGATTTGCCTTTTCCTGG + Intronic
921105936 1:211978382-211978404 GATTTTGATGTGCCATTGCCTGG - Exonic
1063232038 10:4074892-4074914 AACACTGGTGTGCCTCTGCCGGG - Intergenic
1063800215 10:9568282-9568304 GTCTCTGTTGTGTCTTTGCCAGG - Intergenic
1065132256 10:22633944-22633966 GACAGTGAAGTGCCTGAGCCAGG - Intronic
1065712157 10:28529167-28529189 TGCACTGCTGTCCCTTTGCCTGG - Intergenic
1067234946 10:44439493-44439515 AGCACTCATGTGCCTTGGCCAGG - Intergenic
1069416862 10:68208442-68208464 GACACTAATGTACTTTTCCCTGG + Intronic
1071288662 10:84172493-84172515 CACCCTGATGAGCCTCTGCCTGG - Intergenic
1074934091 10:118160273-118160295 GACACTGATGTGGCTGTCACAGG - Intergenic
1075638145 10:124044422-124044444 GACCCTGCTGGGTCTTTGCCTGG + Intronic
1075640956 10:124064402-124064424 GCCACTGCTGTACCTTTGCAAGG - Intronic
1076521958 10:131086812-131086834 GACACTGCTGGTCCTATGCCTGG + Intergenic
1076793733 10:132789096-132789118 GACAATGCAGGGCCTTTGCCGGG - Intergenic
1077152205 11:1077432-1077454 GACCCCGATGTGCCTCCGCCAGG + Intergenic
1077718782 11:4606885-4606907 GACTCTGATATGCCATTGGCAGG + Intronic
1080907324 11:36560151-36560173 GACAGTGATGTGGCTTTGCTGGG + Intronic
1081137837 11:39461194-39461216 CCCAATGTTGTGCCTTTGCCTGG + Intergenic
1081312711 11:41593323-41593345 AATACTGATGAGCCTTTGTCAGG + Intergenic
1081891212 11:46543698-46543720 GTCACTCATGTGCCTCTGGCTGG - Intronic
1086159231 11:83702689-83702711 GACACTGATCTGTCTCTTCCTGG + Intronic
1089297183 11:117476835-117476857 GCCCCAAATGTGCCTTTGCCAGG - Intronic
1091696999 12:2634423-2634445 AACACTCATTTGCCTTTTCCCGG + Intronic
1091803862 12:3342384-3342406 GACACAGATGTGCCTTTTAGAGG - Intergenic
1093837232 12:23848550-23848572 GACACTGTTGTTCATTTGCATGG + Intronic
1094266726 12:28568171-28568193 GTTACTGATCTGCTTTTGCCTGG + Intronic
1095811115 12:46373544-46373566 GACAAGGCAGTGCCTTTGCCCGG - Intergenic
1096240436 12:49956937-49956959 GACTCAGATCTGCCTCTGCCTGG - Exonic
1098645067 12:72889733-72889755 TTCACTGATGTGCATTTTCCTGG + Intergenic
1100793510 12:98155946-98155968 GACACTGAGGTGCAGCTGCCAGG - Intergenic
1102255133 12:111410661-111410683 GACACTGATGCACCCTTGCTGGG - Intronic
1106604967 13:31220331-31220353 GACTTTAATGTGCCTTTTCCTGG + Intronic
1112389452 13:98969768-98969790 GGCACAGCTCTGCCTTTGCCTGG - Intronic
1113926991 13:113947142-113947164 AGCTCTGATGTGCCTTTTCCAGG - Intergenic
1116760561 14:49007738-49007760 AGCAGTGATGTGCTTTTGCCAGG - Intergenic
1118644207 14:67821096-67821118 GACACTGATCTGACTTTTGCAGG + Intronic
1124252227 15:28114243-28114265 GACACAGAGCAGCCTTTGCCAGG - Intronic
1124943042 15:34235946-34235968 GGCACAAATGTGACTTTGCCTGG - Intronic
1125130169 15:36275321-36275343 GACACTGATCTTTCTTTGGCTGG + Intergenic
1125682718 15:41542566-41542588 TATACAGATGTGCCTTTTCCTGG + Intronic
1126258513 15:46657569-46657591 GGCACTGATATCCCTCTGCCTGG + Intergenic
1127781415 15:62319852-62319874 GACCCTGACGAGCCTGTGCCTGG + Intergenic
1128580053 15:68803367-68803389 GGCAATGCAGTGCCTTTGCCTGG - Intronic
1132303706 15:100793011-100793033 GACTCTGATGTGCCCTGGCTTGG - Intergenic
1136454540 16:30372795-30372817 GCCCCTGAGGGGCCTTTGCCAGG - Intronic
1138536233 16:57661844-57661866 GACACTGCTGGGCCTCAGCCTGG + Exonic
1142213602 16:88820453-88820475 GACACACATGTCACTTTGCCAGG - Intronic
1143901397 17:10177274-10177296 GACACCTCTGTGCCTTTGCTCGG - Intronic
1144795519 17:17888739-17888761 CACACTGAGGTGACTCTGCCAGG + Intronic
1149107462 17:52986436-52986458 GACTCTGTTGTGCCTCTTCCTGG - Exonic
1149127748 17:53255438-53255460 GACACTGATGTCCTTTTGATGGG - Intergenic
1153568177 18:6441600-6441622 CAAACTGATGTTCCTTTGGCTGG + Intergenic
1158541648 18:58361608-58361630 GTCACTGATGTCCCCGTGCCGGG + Intronic
1158655181 18:59324422-59324444 AACACTGATCTTCCTCTGCCCGG + Intergenic
1162300762 19:9843503-9843525 GTCACTGATGTGCATTAGCTTGG + Intronic
1164767460 19:30782589-30782611 GACACTGGCCTGCCTTTTCCTGG + Intergenic
1167137148 19:47623637-47623659 GACACTGATCTGGCTTTGCAGGG - Intronic
1168348913 19:55664648-55664670 GACACAGATGTGCCTCCGTCTGG - Intronic
925186360 2:1849449-1849471 GACATTGATGTGGCTTCACCAGG - Intronic
926379409 2:12270121-12270143 GACTTTGATGTGCCTGTGCATGG + Intergenic
926408778 2:12580454-12580476 GACAATGAAGTGCCACTGCCGGG - Intergenic
926821394 2:16855154-16855176 GCCACTAGTGTGCCTTGGCCCGG + Intergenic
927404675 2:22753961-22753983 CACACTGATCTGCTTTTGCAAGG + Intergenic
929573916 2:43040354-43040376 GTCACTGGTGTGGCTTGGCCCGG - Intergenic
932586226 2:73031240-73031262 GGAAGTGATGTGCCTTTTCCAGG + Intronic
934043330 2:88147897-88147919 GACACTCATGTGTCCTAGCCAGG + Intergenic
937151755 2:119691113-119691135 TCCACTGAGGTGCCCTTGCCGGG + Intergenic
937197903 2:120176432-120176454 GACACTAGTGTGCGTTTGCCTGG - Exonic
938225419 2:129611702-129611724 GACACAGATGTGCATCTGGCGGG - Intergenic
939703218 2:145420179-145420201 TCCACTGATGTGGCTTTGCAAGG + Intergenic
942778282 2:179611505-179611527 GTTACTGATGTGTCTTTGACTGG + Intronic
947757420 2:232577392-232577414 ATCACTCAGGTGCCTTTGCCAGG + Intronic
947787552 2:232837214-232837236 CACACCGATGTGCTTTTCCCAGG + Intronic
948440524 2:237984222-237984244 CACACTTTTCTGCCTTTGCCAGG + Intronic
1168857403 20:1018439-1018461 GACTCAGATGTCCCTTTGCCAGG + Intergenic
1170315673 20:15038957-15038979 GACAGTGGCTTGCCTTTGCCTGG - Intronic
1170316140 20:15043358-15043380 GGCATTGCTGTGCCTTTGCATGG + Intronic
1171317150 20:24205405-24205427 GACTCTGATGGGCATTTGCTGGG + Intergenic
1171382822 20:24746255-24746277 GGCACTGACAAGCCTTTGCCCGG + Intergenic
1173648263 20:44647137-44647159 GAAACTGCTGTCCCTTGGCCGGG + Intronic
1173934523 20:46849761-46849783 GAGACTGAGGTGCTTTTACCAGG + Intergenic
1174879865 20:54267432-54267454 TACTCTGATATGCCTTTGCTAGG + Intergenic
1175318883 20:58071529-58071551 GCCCTTGAGGTGCCTTTGCCTGG + Intergenic
1175930587 20:62492043-62492065 GCTACTGCTGTGCCTTTTCCAGG - Intergenic
1176264191 20:64200158-64200180 GACACGGATGTGCCTACACCTGG + Intronic
1180665844 22:17511398-17511420 GCCACTGTGCTGCCTTTGCCCGG + Intronic
1182077603 22:27505615-27505637 GACACAGATGGGCCTTTACTGGG + Intergenic
1184061161 22:42082551-42082573 GACACTCCTGTTCCTTAGCCTGG + Intronic
1185129869 22:49032832-49032854 GACACAGACTTGCCATTGCCGGG + Intergenic
1185264239 22:49890650-49890672 GACACTGATGAGGCTTTCCTGGG + Intergenic
953078483 3:39593559-39593581 GACACAGATATGACCTTGCCCGG + Intergenic
953877763 3:46676185-46676207 GACACTAGTGTGCCCTTTCCAGG - Intronic
956326209 3:68055743-68055765 TACACAGATGTCCCTTTCCCTGG + Intronic
956628737 3:71292824-71292846 GCCACTGATCTGGCTTTGCATGG - Intronic
957161030 3:76610163-76610185 TTCACTGATGTGTCTTTGTCTGG + Intronic
958630876 3:96681851-96681873 TTCACTGATGTGTCTTTGTCTGG + Intergenic
960940918 3:122933517-122933539 CACACTGATGTGCCTTAGGACGG + Intronic
962902562 3:139774083-139774105 GGCACTGATGTGCTTTTCCTGGG + Intergenic
963979178 3:151516982-151517004 GACATTTATGTGACATTGCCTGG + Intergenic
967509180 3:190290082-190290104 GACACAGATGTCTCTTTGCTGGG + Intergenic
968419359 4:470175-470197 GACAATGATCTACTTTTGCCAGG - Intronic
968902607 4:3438600-3438622 GACACAGTTGTGTCTATGCCAGG - Intronic
969523771 4:7693809-7693831 GACATTGATGGGCCCTTGACTGG - Intronic
972104102 4:35461361-35461383 GACACTTCTGTGCCTTTGAAAGG - Intergenic
973810397 4:54563945-54563967 AACACTGCTGAGCCTTTGCTTGG + Intergenic
979662377 4:123272157-123272179 GACACTGTTGTGCTTCTGACTGG + Intronic
980156933 4:129118288-129118310 GACAGCGGTGTGCCTTTGCTGGG - Intergenic
981073924 4:140572348-140572370 GACAGTTAAGAGCCTTTGCCAGG + Intergenic
981416362 4:144498329-144498351 GACACTGCTGTGGCATTGTCTGG - Intergenic
985080716 4:186261490-186261512 GACACTGGTGTTTCTCTGCCCGG + Intergenic
985911391 5:2886741-2886763 AATACTTATGTGCCTATGCCTGG - Intergenic
987738330 5:21873418-21873440 GACACTGATGTGCAGATGCCTGG + Intronic
988626704 5:32884321-32884343 GGCAGTGATGTGGCTTTGCTGGG + Intergenic
989141995 5:38210757-38210779 GACAGGGATGTGCCTTGGCAGGG - Intergenic
995787203 5:115842298-115842320 GCCACCGACGTGGCTTTGCCCGG + Intronic
997572044 5:134937534-134937556 GAGTCTGATGTGCTTTTGGCAGG - Intronic
999409764 5:151340458-151340480 AACACTGCTCTGCCTTTGCAAGG - Intronic
1000071883 5:157748063-157748085 GACACTGATGTGCCTTTGCCGGG + Intronic
1002109192 5:176896699-176896721 GAAATTCATGTGCCTTAGCCTGG - Intronic
1002336013 5:178478768-178478790 GACACTGATGGGCCTTTTGAGGG + Intronic
1006703808 6:35999335-35999357 CTCAGTGATGTGCCTTTTCCTGG - Intronic
1006835647 6:36997442-36997464 GAAACTGAGGTGCATTTGTCAGG + Intergenic
1010448409 6:75975057-75975079 GACTTGGATGTGCCTGTGCCAGG + Intronic
1010972517 6:82277925-82277947 GAAACTGATTTGCACTTGCCAGG + Intergenic
1023293833 7:38694063-38694085 GACACTGATGTTCCAGTGTCTGG + Intergenic
1024616165 7:51114262-51114284 CACACTGATTTGCCTTTGATGGG - Intronic
1026528073 7:71173127-71173149 GACACTGACATGCCTGTTCCAGG + Intronic
1028766453 7:94565174-94565196 GACACTTATGTGCCACTACCTGG + Intergenic
1029026169 7:97418963-97418985 CAAACTGGTGTGCATTTGCCAGG - Intergenic
1031350319 7:120722852-120722874 GACTCCCAAGTGCCTTTGCCAGG - Intronic
1031397961 7:121295066-121295088 GGCACTGGTGTGCCTTTGCCAGG - Intronic
1032965885 7:137096905-137096927 GTCATTGCTGTGTCTTTGCCAGG - Intergenic
1034752888 7:153587367-153587389 GGCACAGATGTGCCTCTGGCTGG + Intergenic
1035007339 7:155676107-155676129 CACAATGATGAGCCTTTGCTTGG + Intronic
1040586693 8:48750121-48750143 GACTCAGATCTGCCTCTGCCTGG - Intergenic
1041034417 8:53774190-53774212 GACAATGCTATGCCTTTGCATGG - Intronic
1042567456 8:70126831-70126853 GAAACTGCTGTGCATTTGCCTGG + Exonic
1044974101 8:97646297-97646319 GACAAAGTTGTGCCTTTTCCAGG - Intronic
1049180617 8:141220253-141220275 GACACTGATGAGGCTTCGCGAGG + Intronic
1049851787 8:144836477-144836499 CACACTGAGTTGCATTTGCCTGG + Intronic
1050740249 9:8811434-8811456 AACACTGATGGGCCTTTTCCAGG - Intronic
1058123087 9:101160361-101160383 GACATTGATGTAACTCTGCCTGG + Intronic
1058941549 9:109817372-109817394 CACAGTGATGTGCATTTCCCTGG - Intronic
1186110760 X:6253377-6253399 GAAACTGATGAGGGTTTGCCAGG + Intergenic
1188786749 X:34356037-34356059 CACAGTGATATGCCTTTCCCAGG + Intergenic
1189628520 X:42925549-42925571 GTTTCTGATGTGCCTTTGTCTGG - Intergenic
1190121598 X:47664473-47664495 GACTCTGATGTGCCTCAGCATGG + Intergenic
1194518327 X:94887529-94887551 GACAATGATGAGGCTTTGCTGGG + Intergenic
1195904163 X:109827646-109827668 TACACTGATGTGCATTCTCCTGG - Intergenic
1198215821 X:134553733-134553755 GAAACTGAAGTGCCTTTGGAAGG + Intergenic
1199007634 X:142720936-142720958 GACAATGTTGTGTCTCTGCCAGG - Intergenic
1199505104 X:148552524-148552546 GACACATGTGTGCATTTGCCAGG + Intronic