ID: 1000072963

View in Genome Browser
Species Human (GRCh38)
Location 5:157758188-157758210
Sequence CCTGGGAGGCAGAAGTTGCA GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 4891
Summary {0: 18, 1: 262, 2: 800, 3: 1509, 4: 2302}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000072963_1000072975 30 Left 1000072963 5:157758188-157758210 CCCTGCAACTTCTGCCTCCCAGG 0: 18
1: 262
2: 800
3: 1509
4: 2302
Right 1000072975 5:157758241-157758263 AGTAGCTGGGTCAGCCACCATGG 0: 1
1: 0
2: 1
3: 13
4: 162
1000072963_1000072972 17 Left 1000072963 5:157758188-157758210 CCCTGCAACTTCTGCCTCCCAGG 0: 18
1: 262
2: 800
3: 1509
4: 2302
Right 1000072972 5:157758228-157758250 CCTTAGCCTCCTGAGTAGCTGGG 0: 3769
1: 105626
2: 210490
3: 240684
4: 150489
1000072963_1000072970 16 Left 1000072963 5:157758188-157758210 CCCTGCAACTTCTGCCTCCCAGG 0: 18
1: 262
2: 800
3: 1509
4: 2302
Right 1000072970 5:157758227-157758249 GCCTTAGCCTCCTGAGTAGCTGG 0: 2931
1: 92302
2: 198207
3: 231078
4: 156316

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000072963 Original CRISPR CCTGGGAGGCAGAAGTTGCA GGG (reversed) Exonic
Too many off-targets to display for this crispr