ID: 1000073978

View in Genome Browser
Species Human (GRCh38)
Location 5:157767667-157767689
Sequence GGCAGCTGGAACCTCTGGGA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000073974_1000073978 -10 Left 1000073974 5:157767654-157767676 CCTTGCCTCTTGGGGCAGCTGGA No data
Right 1000073978 5:157767667-157767689 GGCAGCTGGAACCTCTGGGACGG No data
1000073969_1000073978 11 Left 1000073969 5:157767633-157767655 CCATGGGGTATGATATTGATGCC No data
Right 1000073978 5:157767667-157767689 GGCAGCTGGAACCTCTGGGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000073978 Original CRISPR GGCAGCTGGAACCTCTGGGA CGG Intergenic
No off target data available for this crispr