ID: 1000089015

View in Genome Browser
Species Human (GRCh38)
Location 5:157913738-157913760
Sequence CTCCAGAAGGCGGGCTTGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000089010_1000089015 10 Left 1000089010 5:157913705-157913727 CCAGGGGCTTAGCATGCACACTC No data
Right 1000089015 5:157913738-157913760 CTCCAGAAGGCGGGCTTGACAGG No data
1000089009_1000089015 21 Left 1000089009 5:157913694-157913716 CCTACTATGTGCCAGGGGCTTAG No data
Right 1000089015 5:157913738-157913760 CTCCAGAAGGCGGGCTTGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000089015 Original CRISPR CTCCAGAAGGCGGGCTTGAC AGG Intergenic
No off target data available for this crispr